Abstract
Today, the spread of vancomycin-resistant strains isolated from Enterococcus faecalis (E. faecalis) has become a major health concern worldwide. Therefore, it is essential to provide a rapid and sensitive assay for identifying vanA gene for timely and appropriate antimicrobial control of resistant enterococcal infections. For this purpose, a cross-sectional study was performed on different clinical specimens of enterococci from Imam Reza hospital, Kermanshah, Iran. The antimicrobial susceptibility testing was determined by disk diffusion and MIC methods. Triplex-PCR and duplex-LAMP assays were also used to identify vanA E. faecalis resistance gene isolates. The results of this study shown that out of 108 Enterococcus isolates, 86, 18, 2, 1, and one isolates of E. faecalis, E. faecium, E. avium, E. psudoavium, and E. raffinosus were identified, respectively. On the other hand, E. faecalis was confirmed in 87 and 88 isolates using duplex-LAMP and triplex PCR, respectively. The LAMP primer set designed in this study can reliably identify seven distinct regions of the vanA gene, and finally the sensitivity, specificity, and the positive and negative predictive values of LAMP assay were shown to be 94.19%, 72.73%, 76.19%, and 93.10%, respectively. In general, sample processing, isothermal reaction and result reporting were completed using the LAMP assay in 75 minutes. Our findings suggest that LAMP assay has been approved as an alternative to the vancomycin resistance Enterococcus genotype (vanA and vanB) compared to other methods and has the advantage of being rapid, time-consuming, and easy for diagnosis.
1. Introduction
Enterococci are positive gram cocci that are ubiquitous in the gastrointestinal tract of animals and humans, and even in water and soil [1]. However, this organism recognized as predominantly nonpathogenic bacteria is sometimes opportunistic and causes human diseases [2]. E. faecium and E. faecalis are two common species of enterococci that are now recognized as the most important hospital-acquired infections such as bacteremia and urinary tract infections [3, 4]. In the 1970s and 1980s, E. faecium first developed high levels of resistance to ampicillin and during the 1980s became resistant to aminoglycosides, fluoroquinolones, and glycopeptides, especially vancomycin [5–7]. On the other hand, E. faecalis is resistant to aminoglycosides, but resistance to ampicillin and vancomycin is infrequent than E. faecium [8]. Vancomycin was previously considered the “last line of treatment” for the treatment of severe infections caused by multidrug-resistant enterococci [9]. Acquired resistance to vancomycin is caused by 37 different clusters (vanA, B, D, E, F, G, L, M, and N) of which vanA is clinically significant [3]. In addition, the plasticity of enterococcal genomes by the vanA gene allows the organism to respond rapidly and with limitations by obtaining genetic determinants that enhance its ability to colonize or infect the host [10]. Conventional diagnosis of vancomycin resistance by culture-based methods (Kirby-Bauer and broth dilution) is both require an experienced laboratory expert and time-consuming. On the other hand, molecular detection techniques (such as conventional and real-time PCR methods) require specialized and expensive tools and consumables. Therefore, it is important to have a rapid, sensitive, and cost-effective assay for identifying vancomycin resistance genes. For this reason, in recent years, loop-mediated isothermal amplification (LAMP) assay has been considered for the detection of vancomycin resistance genes due to its specificity and high sensitivity [11]. LAMP requires only a temperature-controlled water- or dry-bath, and the results can be analyzed directly by the naked eye [12]. The focus of this study is LAMP assay for rapid and sensitive detection of the vanA gene in Enterococcus species isolated from different clinical specimens.
2. Materials and Methods
2.1. Bacterial Strains
A total of 108 Enterococcus strains were collected from different clinical specimens including blood, urine, wound, and CSF from Imam Reza Hospital in Kermanshah, Iran. Then, bile esculin agar, sodium azide selective medium, blood agar (Merck, Germany) and also API 20 Strep (bioMerieux, France) were used to detect Enterococcus strains. Biochemical tests such as catalase, growth in 6.5% NaCl, arabinose, pyruvate, and sorbitol fermentation were also used to differentiate Enterococcus strains [13]. These strains were stored in 10% glycerol broth (w/v) at − 70 °C for later steps. This study was ethically approved by the Kermanshah University of Medical Sciences, Institutional Review Board (IR. KUMS.REC.1394.498).
2.2. Disk Diffusion and MIC Methods
Two methods of disk diffusion and Minimum Inhibitory Concentration (MIC) were used to test the antimicrobial susceptibility of E. faecalis and E. faecium isolates. Antibiotic susceptibility testing was carried out using Kirby-Bauer disk diffusion method according to the Clinical and Laboratory Standard Institute (CLSI) guidelines [14]. Antibiotics used (Mast, England) included ampicillin (10 micrograms), penicillin (10 micrograms), ciprofloxacillin (5 micrograms), norfloxacin (10 micrograms), and erythromycin (15 micrograms). Broth microdilution method was used for vancomycin susceptibility testing according to CLSI guidelines, with a range of 0.0625 to 64 micrograms/mL. Vancomycin resistant breakpoint was considered equal or more than 32 micrograms/mL [15].
2.3. Genomic DNA Preparation
The genomic DNA templates were extracted from all culture strains using DNA extraction kits AccuPrep® Genomic DNA extraction kit (Bioneer, South Korea) according to the manufacturer's instructions. The extracted templates were tested with ultraviolet spectrophotometer (Nano drop Technologies, Inc., Wilmington, DE, USA) at A260/280. On the other hand, the templates were stored under at − 20 °C before the templates were used.
2.4. PCR and LAMP Primer Design
For detection of Enterococcus genus, six pairs of the LAMP primers for each target (vanA and E. faecalis species) were separately designed using primer explorer software version 4 (http://primerexplorer.jp/e/). More than 1000 sets of the primers screened to select two of them that can develop different pattern when compared together. There were four primers needed for PCR reaction; to design these primers, the whole genome of E. faecalis and E. faecium has been downloaded from NCBI gene bank; then, the primers were designed with consideration of multiplex-PCR. Primers for LAMP assay have been designed with primer explorer software version4. All the primers are listed in Table 1.
Table 1.
List of PCR and LAMP primers that were designed and used in this study.
| Primer name | Sequence (5′ to 3′) | Product size | Reference |
|---|---|---|---|
| Enterococcus tuf gene | F: TAC TGA CAA ACC ATT CAT GAT G R: TTC GTC ACC AAC GCG AAC |
109 bp | This study |
| E. feacalis ddl gene | F: CCA CAA GTA CCA TTC GTG C R: GCG ACA TCT TTC ACC ACT TC |
305 bp | This study |
| Tn 1546 VanA gene |
F: TCG TTG ACA TAC ATC GTT GC R: TGT CTT GCC GAT TCA ATT GC |
195 bp | This study |
| Van A BIP | CCGCAGACCTTTCAGCAGAG-GAATTC-GAGCGCTTTATATATTTTTTTTGCC | This study | |
| Van A FIP | GAACGGTTATAACTGCGTTTTCAG-GAATTC-ATCTTTCGTATTCATCAGGAAG | This study | |
| Van A B3 | GGGCTAGACCTCTACAGC | This study | |
| Van A F3 | AAATCAGGCTGCAGTACG | This study | |
| Van A LB | AGCGAGGACGGATACAGGA | This study | |
| Van A LF | AGCCTTTTTCCGGCTCGA | This study | |
| E. faecalis BIP | CATTCCACAAGTACCATTCGTGC-GAATTC-CCTTCACATTTTTCAAAGACTTC | This study | |
| E. faecalis FIP | TCCATTGCGTTAACGCTAGCTA-GAATTC-ATGGAAACCATTAATATGCCTT | This study | |
| E. faecalis B3 | AGGTTTAACAAAGACCGGATA | This study | |
| E. faecalis F3 | AGATGGAACAATTCAAGGATTC | This study | |
| E. faecalis LB | TAAGAAGTGACTGGAAAGGAAATCC | This study | |
| E. faecalis LF | GACACCCGCGCCTACATAA | This study |
2.5. PCR Assay
The reaction mixture for multiplex-PCR assay was 25 μL that was prepared as follows: 12.5 μl of 2× Taq premix Master mix (Ampliqon UK), 7.5 μl of sterile double distilled water, 1 μl of each forward and reverse primer, and 3 μl of DNA sample. The DNA samples as well as a quality control (E. faecalis strain ATCC 29212) was amplified for vanA gene by an initial denaturation step for 5 min at 95 °C followed by 35 cycles of 92 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min and a final extension step at 72 °C for 5 min in a Bio-Rad Thermal Cycler (Bio-Rad Laboratories, Inc., USA).
2.6. LAMP Reaction
LAMP reaction was carried out in a final volume of 45 μl containing 1.6 mM each of FIP and BIP, 0.2 mM each of B3 and F3, 0.8 mM each of LB and LF, 2 μM dNTP, 0.8 M betaine, 1.5× buffer,12 mM MgSO4, and 3 μl target DNA. LAMP reactions were incubated in a program as follows: initial denaturation 92 °C for 3 min; after adding 8 U Bst polymerase, reaction continued with amplification at 65 °C for 60 min and end of amplification in at 92 °C for 1 min. In addition to a positive control, a negative control was included to monitor for possible cross-contamination.
2.7. Analytical Sensitivity and Specificity of LAMP and Multiplex-PCR
The specificity of the each duplex-LAMP and multiplex-PCR methods were determined using performing reaction on purified DNA of some bacteria including E. faecium, E. avium, E. raffinosus, E. psudoavium, E. hirae, E. durans, streptococcus pneumonia, and staphylococcus aureus. All species were confirmed using standard biochemical tests. To determine the LAMP limit of detection (LOD) for E. faecalis, a fresh suspension of E. faecalis reference strain broth culture has been prepared in Mueller Hinton Agar (MHA) to reach the concentration of 4 McFarland (12 × 108) CFU/ml. The DNA of suspension was extracted using specific kit and the concentration of DNA of that measured using NanoDrop (Thermo Fisher Scientific, USA). Then, ten-fold serial dilutions of purified DNA were prepared, and 3 μl of each diluted DNA was used as DNA template for PCR and LAMP assay [16]. For the construction of a multiplex LAMP (mLAMP), we modified the FIPs and BIPs by inserting a restriction enzyme (EcoRI) cleavage site between the F1 complementary and F2 and between the B1 complementary and B2, respectively, as shown in Table 1. To confirm the LAMP amplification product specificity, restriction fragment length polymorphism (RFLP) analysis was performed with the restriction enzyme EcoRI (Jena Bioscience, Germany). The specific restriction sites in the LAMP products were analyzed and selected with NEB cutter V2.0 (http://toolshttp://neb.com/NEBcutter2). Briefly, the DNA products amplified by LAMP were digested with 1.5 U/μl EcoRI following the manufacturer's standard protocol. EcoRI can specifically digest the DNA sequence 5′-GAATTC-3′. The final digestion products were expected to be 170 and 135 bases [17].
2.8. Spiked Blood Culture Specimens
Spiked blood culture was prepared to evaluate the ability of LAMP to detect organism in clinical specimens. Starting with a 1-McFarland standard suspension of organism, three successive 100-fold dilutions were performed by placing 10 μl of suspension into 990 μl of diluent. This was followed by a 30-fold dilution through placement of 100 μl of suspension into a blood culture bottle with 3 ml of banked blood, to produce a final organism concentration between 10 and 100 CFU/ml. Colony counts were performed prior to the final 1 : 30 dilution, to verify the organism concentration [16].
2.9. Detection of Amplified Product
Amplified product in single LAMP reaction was analyzed using naked eye for detection of pyrophosphate sediment. For detection of amplification in duplex-LAMP, one μL of the LAMP product or EcoRI digested products were subjected to 1.5% agarose gel electrophoresis and visualized using transilluminator. For detection of specific PCR amplification, 5 μl of PCR product was subjected to electrophoresis through 1.5% agarose gel, stained with ethidium bromide, and visualized using transilluminator.
2.10. Statistical Analysis
The analysis was performed using the SPSS version 19 (Chicago, IL, USA). Data were analyzed using the chi-square test and Fisher's exact test, with significance set at p value < 0.05. Diagnostic test value of each test was calculated using MedCalc's online software.
3. Results
3.1. Enterococci Isolates
Among 108 clinical samples, 86 isolates (79.62%) were identified E. faecalis, 18 isolates E. faecium (16.66%), two isolates E. avium (1.85%), one isolate E. psudoavium (0.91), and also one isolate E. raffinosus (0.91) using culture method. The results of the collected samples are shown in Table 2.
Table 2.
Distribution of Enterococcus strains isolated from different clinical samples.
| Samples | E. faecalis | E. faecium | E. avium | E. psudoavium | E. raffinosus | Total |
|---|---|---|---|---|---|---|
| Urine | 53 | 5 | 0 | 0 | 0 | 58 |
| Blood | 10 | 9 | 1 | 1 | 1 | 22 |
| Wound | 20 | 4 | 1 | 0 | 0 | 25 |
| CSF | 4 | 0 | 0 | 0 | 0 | 4 |
| Total | 86 | 18 | 2 | 1 | 1 | 108 |
3.2. Antimicrobial Susceptibility Testing
The rate of resistance to ampicillin, penicillin, gentamicin, erythromycin, and ciprofloxacin norfloxacin, among E. faecium isolates, was 91.66%, 83.33%, 75%, 83.33%, 66.66%, and 58.33%, respectively. Meanwhile, E. faecalis isolates exhibited 5.81%, 5.81%, 33.72%, 54.65%, 40.69%, and 34.88% resistance to ampicillin, penicillin gentamicin, erythromycin, ciprofloxacin, and norfloxacin, respectively. The results of microdilution method showed that 8 isolates were phenotypically resistant to vancomycin.
3.3. Clinical Specificity and Sensitivity of the LAMP Assay
Sensitivity, specificity, positive predicting value (PPV), and negative predicting value (NPV) of the duplex-LAMP and PCR in comparison with gold standards culture were as the same 94.19%, 72.73%, 76.19%, and 93.10%, respectively. There was perfect agreement between lamp and culture as gold standard methods with kappa coefficient of %8981. While kappa coefficient for PCR and API were %8981 and %8333, respectively. The results are shown in Table 3.
Table 3.
Clinical specificity and sensitivity of the PCR, LAMP, and API.
| PCR | LAMP | API | ||||
|---|---|---|---|---|---|---|
| Sensitivity | =94.19% | 95% CI: 86.94% to 98.06% | =94.19% | 95% CI: 86.94% to 98.06% | =93.57% | 95% CI: 86.00% to 97.92% |
| Specificity | =72.73% | 95% CI: 49.78% to 89.20% | =72.73% | 95% CI: 49.78% to 89.20% | =53.57% | 95% CI: 33.88% to 72.47% |
| Positive likelihood ratio | =3.45 | 95% CI: 1.74% to 6.85% | =3.45 | 95% CI: 1.74% to 6.85% | =2.02 | 95% CI: 1.35% to 3.02% |
| Negative likelihood ratio | =0.08 | 95% CI: 0.03% to 0.19% | =0.08 | 95% CI: 0.03% to 0.19% | =0.12 | 95% CI: 0.05% to 0.29% |
| Disease prevalence | =79.63% (∗) | 95% CI: 70.80% to 86.77% | =79.63% (∗) | 95% CI: 70.80% to 89.20% | =74.07% (∗) | 95% CI: 64.75% to 82.03% |
| Positive predictive value | =93.10% (∗) | 95% CI: 85.58% to 97.41% | =93.10% (∗) | 95% CI: 85.58% to 97.41% | =85.23% (∗) | 95% CI: 76.06% to 91.89% |
| Negative predictive value | =76.19% (∗) | 95% CI: 52.83% to 91.69% | =76.19% (∗) | 95% CI: 52.83% to 91.69% | =75.00% (∗) | 95% CI: 50.89% to 91.25% |
| KAPA | 0.8981 | 0.8981 | 0.8333 | |||
3.4. Analytical Specificity of the Primers
To evaluate the analytical specificity of the primer sets, single and multiplex-PCR and also single and duplex-LAMP were carried out on purified extracted DNA from E. faecium, E. avium, E. raffinosus, E. psudoavium, E. hirae, E. durans, Streptococcus pneumoniae, and Staphylococcus aureus. All species were fully identified using standard biochemical tests. The results were shown that single and duplex-LAMP and PCR only were positive for E. faecalis are shown in Figures 1 and 2.
Figure 1.

(a) PCR product electrophoresis of Enterococcus isolates. Lane 1: 100 bp DNA ladder; lane 2: negative control; and lane 3: positive control with 305 bp product for E. faecalis, 195 bp product for vanA, and 109 bp product for Enterococcus. (b) LAMP electrophoresis of amplified Enterococcus isolates. Lane 1: 8: 50 bp DNA ladder; lane 2: single reaction for detection of E. faecalis; lane 3: the duplex-LAMP for detection of E. faecalis and vanA gene; lane 4: the single reaction for detection of vanA; lane 5: EcoRI digested single reaction for detection of E. faecalis; lane 6: EcoRI digested of duplex-LAMP for detection of E. faecalis and vanA gene; and lane 7: EcoRI digested of single reaction for detection of vanA.
Figure 2.

Result of analytical specificity of the LAMP primers. (a) Positive and negative reaction of the LAMP method. Naked eyes visual detection of LAMP reaction with purified DNA of non-E. faecalis. 1: positive control; 2: negative control; 3: E. faecium; 4: E. avium; 5: E. raffinosus; 6: E. psudoavium; 7: E. hirae; 8: E. durans; 9: S. pneumoniae; and 10: S. aureus. (b) PCR product for analytical specificity of primers. Lane 1: 100 bp DNA ladder; lane 2: negative control; and lane 3: positive control with 109 bp product for enterococcus, 195 bp product for vanA gene, and 305 bp product for E. faecalis.
3.5. Analytical Sensitivity (LOD)
The detection limits of duplex-LAMP and multiplex-PCR were determined using 10-fold serial dilutions of E. faecalis DNA. The LOD for multiplex-PCR was 1 pg/reaction and for duplex-LAMP reaction was 10 fg/reaction. It means that the analytical sensitivity of the duplex-LAMP was 100-fold more sensitive than multiplex-PCR that is shown in Figure 3.
Figure 3.

(a) LAMP primers targeting the VanA (E. faecalis) gene were used in the serial dilutions to determine limit of detection. 1: negative control; 2: positive control; 3: 1 ng; 4: 0.01 ng; 5: 1 pg; 6: 0.01 pg; 7: 1 fg (LOD of E. faecalis); 8: 0.1 fg; 9: 0.01 fg; 10: 1 Ag from purify DNA of E. faecalis. (b) LOD of E. faecalis by PCR assay. 1: 100 bp DNA ladder; 2: positive control (109 bp Enterococcus, 195 bp vanA, and 305 bp E. faecalis); 3: negative control; 4: 10 ng; 5: 1 g; 6 : 0.1 ng; 7: 10 pg (LOD of vanA); 8: 1 pg; 9: 0.1 pg (LOD of E. faecalis); 10: 10 fg (LOD of Enterococcus); 11: 1 fg; 12: 0.1 fg; and 13: 0.01 fg from purify DNA of E. faecalis.
Among 87 isolates of E. faecalis, 2 isolates were vanA positive using multiplex-PCR and duplex-LAMP assay, while MIC of 8 isolates against vancomycin were more than 32 μg/mL. The results are shown in Table 4.
Table 4.
Detection of vanA gene using PCR and LAMP in comparison with MIC against vancomycin in E. faecalis isolates.
| Test | Result | |
|---|---|---|
| Positive | Negative | |
| MIC | 8 | 78 |
| PCR vanA | 2 | 84 |
| LAMP vanA | 2 | 84 |
4. Discussion
E. faecalis is one of the most important bacterial pathogens in nosocomial infections such as surgical site, urinary tract, and bloodstream infections [18]. Vancomycin is still active against some multidrug-resistant bacteria and is therefore considered the last effective antibiotic. The vancomycin resistance Enterococcus (VRE), which first appeared three decades ago, is now a serious threat to public health because it has spread rapidly to many parts of the world. Therefore, rapid, sensitive, and reliable diagnosis of VRE is essential in reducing morbidity and mortality of this pathogen. The VanA gene is the most common phenotype observed in hospital isolates and is increasingly predominant in VRE isolates [19, 20]. Based on the results, E. faecium isolates showed high resistance to antibiotics compared to E. faecalis in our study. However, 91.66% of them were resistant to ampicillin. In contrast, ampicillin resistance was observed in only 5.81% of E. faecalis isolates. Several studies have reported that ampicillin resistance is very common among clinical isolates of E. faecium [21–23]. The results of MIC method showed that 8 isolates were phenotypically resistant to vancomycin.
The prevalence of Enterococcus strains by culture method in different clinical isolates including 79.63%, 16.66%, 1.85%, 0.92%, and 0.92% were reported in E. faecalis, E. faecium, E. avium, E. psudoavium, and E. raffinosus, respectively. Similar to our study, E. faecalis was reported from 80 to 90% of all enterococcal-related infections [24–26]. Sensitivity, specificity, positive predicting value, and negative predicting value, of both methods of PCR and LAMP in detecting E. faecalis, were 94.19%, 72.73%, 76.19%, and 93.10%. These results were approximately the same which was reported by Benadof et al. (96.8%, 76.0%, 67.7%, and 97.9%, respectively [27]). LAMP assay were recognized 87 isolates as E. faecalis that was in perfect agreement with multiplex-PCR assay. It means that the agreement of PCR and LAMP was 94%. Agreement of LAMP and gold standard method for detection of E. faecalis was %97 that was the highest rate of agreement that was reported [27, 28]. The detection of vancomycin resistance has been done using multiplex-PCR and duplex-LAMP, and the results were compared with microdilution test as a gold standard. The results were showed that 8 samples had the MIC of more than 32 μg/ml but only two samples were positive for vanA gene using PCR and LAMP. The duplex-LAMP method was highly analytically sensitive, as DNA with as few as six target gene copies was detectable in the LAMP reaction. Amplification of the target sequence was confirmed by visualization on agarose gel electrophoresis with or without restriction digestion using EcoRI. The electrophoresis pattern of each single or duplex reaction of LAMP products were distinguished from each other even before restriction enzyme digestion. In this study, we demonstrated the usefulness of LAMP for detecting VRE infection in clinical specimen. We determined that the lowest amount of DNA template could yield a positive reaction. This notion is of importance when dealing with clinical specimen, especially under a condition where fast onsite diagnosis is necessary. The LOD for detection was found to be 10 fg target DNA in reaction within 40 min. This result clearly was lower than what reported from a previous study, with a LOD of 62.5 ng DNA [29]. The main reason for this difference is the presence of different inhibitors in the samples to which PCR is sensitive while LAMP is resistant [30]. Finally, compared to the PCR method, the LAMP assay optimized in this study can effectively identify the vanA gene with high sensitivity and specificity, which eliminates the use of an expensive specialized device and required only a simple water bath or heat blocker that was needed to perform the reaction.
5. Conclusion
In this study, duplex-LAMP was conducted for the first time for detection of E. faecalis and vanA gene simultaneously which was in perfect agreement with culture and multiplex-PCR. This method also has high sensitivity and specificity, cost-effective, and time-consuming with low LOD compared to other methods.
Acknowledgments
The authors would like to thank the staff of the Department of Microbiology, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran. This research was funded by a grant (no. 91274) from the Student Research Center, School of Medicine, Kermanshah University of Medical Sciences, Kermanshah, Iran.
Data Availability
All the data supporting the findings are contained within the manuscript.
Conflicts of Interest
The authors declare no competing interests.
Authors' Contributions
Design was made by AA, MA, HM, and HH. Methodology was contributed by AA, MA, HM, HH, and RA. Writing-original draft was made by MA, HM, HH, MK, KA, and JM. Writing-review and editing was made by AA, RA, HH, and HM. Mohsen Azizi, Hamid Motamedi, and Hadi Hossainpour equally contributed to this work.
References
- 1.Sadowsky M. J., Whitman R. L. The Fecal Bacteria . American Society for Microbiology Press; 2010. [DOI] [Google Scholar]
- 2.Ramos S., Silva V., Dapkevicius M. L. E., Igrejas G., Poeta P. Enterococci, from harmless bacteria to a pathogen. Microorganisms . 2020;8(8, article 1118) doi: 10.3390/microorganisms8081118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ahmed M. O., Baptiste K. E. Vancomycin-resistant enterococci: a review of antimicrobial resistance mechanisms and perspectives of human and animal health. Microbial Drug Resistance . 2018;24(5):590–606. doi: 10.1089/mdr.2017.0147. [DOI] [PubMed] [Google Scholar]
- 4.Faron M. L., Ledeboer N. A., Buchan B. W. Resistance mechanisms, epidemiology, and approaches to screening for vancomycin-resistant Enterococcus in the health care setting. Journal of Clinical Microbiology . 2016;54(10):2436–2447. doi: 10.1128/JCM.00211-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Grayson M., Eliopoulos G., Wennersten C., et al. Increasing resistance to beta-lactam antibiotics among clinical isolates of Enterococcus faecium: a 22-year review at one institution. Antimicrobial Agents and Chemotherapy . 1991;35(11):2180–2184. doi: 10.1128/AAC.35.11.2180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Galloway-Peña J. R., Nallapareddy S. R., Arias C. A., Eliopoulos G. M., Murray B. E. Analysis of clonality and antibiotic resistance among early clinical isolates of Enterococcus faecium in the United States. The Journal of Infectious Diseases . 2009;200(10):1566–1573. doi: 10.1086/644790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Leclercq R., Derlot E., Duval J., Courvalin P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. New England Journal of Medicine . 1988;319(3):157–161. doi: 10.1056/NEJM198807213190307. [DOI] [PubMed] [Google Scholar]
- 8.Guzman Prieto A. M., van Schaik W., Rogers M. R., et al. Global emergence and dissemination of enterococci as nosocomial pathogens: attack of the clones? Frontiers in Microbiology . 2016;7:p. 788. doi: 10.3389/fmicb.2016.00788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mühlberg E., Umstätter F., Kleist C., Domhan C., Mier W., Uhl P. Renaissance of vancomycin: approaches for breaking antibiotic resistance in multidrug-resistant bacteria. Canadian Journal of Microbiology . 2020;66(1):11–16. doi: 10.1139/cjm-2019-0309. [DOI] [PubMed] [Google Scholar]
- 10.Rios R., Reyes J., Carvajal L. P., et al. Genomic epidemiology of vancomycin-resistant enterococcus faecium (VREfm) in Latin America: revisiting the global VRE population structure. Scientific Reports . 2020;10(1):1–12. doi: 10.1038/s41598-020-62371-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Badparva E., Javadi Mamaghani A., Kheirandish F., Ebrahimzadeh F., Fallahi S. Development and evaluation of a loop-mediated isothermal amplification (LAMP) technique for rapid, accurate, and specific detection of Blastocystis spp. in AIDS patients. Infection . 2022;11:1–8. doi: 10.1007/s15010-022-01818-7. [DOI] [PubMed] [Google Scholar]
- 12.Vural Kaymaz S., Ergenç A. F., Aytekin A. Ö., Lucas S. J., Elitas M. A low-cost, portable, and practical LAMP device for point-of-diagnosis in the field. Biotechnology and Bioengineering . 2022;119(3):994–1003. doi: 10.1002/bit.28025. [DOI] [PubMed] [Google Scholar]
- 13.Mahon C. R., Lehman D. C., Manuselis G. Textbook of diagnostic microbiology-e-book . Elsevier Health Sciences; 2018. [Google Scholar]
- 14.Patel J. B., Cockerill F., Bradford P. A. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fifth Informational Supplement. Clinical and Laboratory Standards Institute . 2015;35(3):29–50. [Google Scholar]
- 15.CLSI C. Performance standards for antimicrobial susceptibility testing. Clinical Lab Standards Institute . 2016;35(3):16–38. [Google Scholar]
- 16.Kashani S., Alvandi A. H., Abiri R. Diagnostic values of multiplex loop-mediated isothermal amplification and multiplex polymerase chain reaction for detection of methicillin-resistant Staphylococcus aureus. Journal of Microbiology . 2020;13(6) doi: 10.5812/jjm.96682. [DOI] [Google Scholar]
- 17.Huang Q.-Q., Liu B.-B., Zhu H.-F., et al. Rapid and sensitive detection of the vanA resistance gene from clinical Enterococcus faecium and Enterococcus faecalis isolates by loop-mediated isothermal amplification. Journal of Global Antimicrobial Resistance . 2019;16:262–265. doi: 10.1016/j.jgar.2018.10.012. [DOI] [PubMed] [Google Scholar]
- 18.Wang Y., Li H., Wang Y., Zhang L., Xu J., Ye C. Loop-mediated isothermal amplification label-based gold nanoparticles lateral flow biosensor for detection of Enterococcus faecalis and Staphylococcus aureus. Frontiers in Microbiology . 2017;8 doi: 10.3389/fmicb.2017.00192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Deshpande L. M., Fritsche T. R., Moet G. J., Biedenbach D. J., Jones R. N. Antimicrobial resistance and molecular epidemiology of vancomycin-resistant enterococci from North America and Europe: a report from the SENTRY antimicrobial surveillance program. Diagnostic Microbiology and Infectious Disease . 2007;58(2):163–170. doi: 10.1016/j.diagmicrobio.2006.12.022. [DOI] [PubMed] [Google Scholar]
- 20.Moosavian M., Ghadri H., Samli Z. Molecular detection of vanA and vanB genes among vancomycin-resistant enterococci in ICU-hospitalized patients in Ahvaz in southwest of Iran. Infection and Drug Resistance . 2018;11:2269–2275. doi: 10.2147/IDR.S177886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Weng P. L., Ramli R., Shamsudin M. N., Cheah Y.-K., Hamat R. A. High genetic diversity of Enterococcus faecium and Enterococcus faecalis clinical isolates by pulsed-field gel electrophoresis and multilocus sequence typing from a hospital in Malaysia. BioMed Research International . 2013;2013:6. doi: 10.1155/2013/938937.938937 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Mato R., Almeida F., Pires R., Rodrigues P., Ferreira T., Santos-Sanches I. Assessment of high-level gentamicin and glycopeptide-resistant Enterococcus faecalis and E. faecium clonal structure in a Portuguese hospital over a 3-year period. European Journal of Clinical Microbiology & Infectious Diseases . 2009;28(7):855–859. doi: 10.1007/s10096-009-0704-x. [DOI] [PubMed] [Google Scholar]
- 23.Jureen R., Top J., Mohn S. C., Harthug S., Langeland N., Willems R. J. Molecular characterization of ampicillin-resistant Enterococcus faecium isolates from hospitalized patients in Norway. Journal of Clinical Microbiology . 2003;41(6):2330–2336. doi: 10.1128/JCM.41.6.2330-2336.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Peel T., Cheng A., Spelman T., Huysmans M., Spelman D. Differing risk factors for vancomycin-resistant and vancomycin-sensitive enterococcal bacteraemia. Clinical Microbiology and Infection . 2012;18(4):388–394. doi: 10.1111/j.1469-0691.2011.03591.x. [DOI] [PubMed] [Google Scholar]
- 25.Nasaj M., Mousavi S. M., Hosseini S. M., Arabestani M. R. Prevalence of virulence factors and vancomycin-resistant genes among Enterococcus faecalis and E. faecium isolated from clinical specimens. Iranian Journal of Public Health . 2016;45(6):806–813. [PMC free article] [PubMed] [Google Scholar]
- 26.Emaneini M., Hosseinkhani F., Jabalameli F., et al. Prevalence of vancomycin-resistant Enterococcus in Iran: a systematic review and meta-analysis. European Journal of Clinical Microbiology & Infectious Diseases . 2016;35(9):1387–1392. doi: 10.1007/s10096-016-2702-0. [DOI] [PubMed] [Google Scholar]
- 27.Benadof D., San Martín M., Aguirre J., et al. A new multiplex PCR assay for the simultaneous detection of vancomycin-resistant enterococci from rectal swabs. Journal of Infection . 2010;60(5):354–359. doi: 10.1016/j.jinf.2010.02.011. [DOI] [PubMed] [Google Scholar]
- 28.Jackson C. R., Fedorka-Cray P. J., Barrett J. B. Use of a genus-and species-specific multiplex PCR for identification of enterococci. Journal of Clinical Microbiology . 2004;42(8):3558–3565. doi: 10.1128/JCM.42.8.3558-3565.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chan K.-W., Liu P.-C., Yang W.-C., Kuo J., Chang C.-T., Wang C.-Y. A novel loop-mediated isothermal amplification approach for sex identification of Columbidae birds. Theriogenology . 2012;78(6):1329–1338. doi: 10.1016/j.theriogenology.2012.05.034. [DOI] [PubMed] [Google Scholar]
- 30.Fischbach J., Frohme M., Glökler J. Hinge-initiated primer-dependent amplification of nucleic acids (HIP)–a new versatile isothermal amplification method. Scientific Reports . 2017;7(1):1–11. doi: 10.1038/s41598-017-08067-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All the data supporting the findings are contained within the manuscript.
