β-Klotho inhibits CSF-1 secretion and delays the development of endometrial cancer

ABSTRACT

Senescent cells can drive tumors development by promoting chronic inflammation. There is a significant correlation between β-Klotho expression profiles and endometrial cancer (EC). However, how β-Klotho regulates the occurrence and development of uterine EC remains to be further studied. Our research found that compared with normal endometrial tissues, β-Klotho expression levels in EC tissues were significantly reduced; overexpression of β-Klotho significantly inhibited aging, proliferation and migration but promoted apoptosis of EC cells cultured in vitro. In normal endometrial cells, results confirmed that reduced levels of β-Klotho promoted CSF-1 secretion, and the migration ability of macrophages was significantly enhanced when co-cultured with normal endometrial cells. In contrast, the expression of CSF-1 was significantly reduced after overexpression of β-Klotho in EC cells, and the macrophage migration ability is significantly weakened when co-cultured with EC cells. Therefore, we believe that β-Klotho influences macrophage migration by regulating the expression of CSF-1, thereby interfering with the progression of EC. We investigated in depth the mechanism of β-Klotho regulating CSF-1 secretion and found that β-Klotho inhibits the phosphorylation of p65, which blocked the nuclear translocation of p65, thereby inhibiting the secretion of CSF-1 by EC cells. The above results indicate that β-Klotho-mediated inhibition of CSF-1 secretion reduces the migration of macrophages to tumor tissue and delays the progression of EC.

Introduction

Uterine endometrial cancer (EC) is the most common tumor of the female reproductive organs, accounting for approximately 50% of all gynecological cancers. Cell senescence induces cell cycle arrest in the G0/G1 phase, thereby losing proliferation ability. Cell senescence was considered to be an effective tumor suppression mechanism in the past; however, recent research has shown that senescent sertoli cells may promote the occurrence and progression of tumors by promoting chronic inflammation. The klotho gene was identified as an anti-aging gene in 1997. Klotho can prolong lifespan when overexpressed but might be a risk factor for premature aging syndromes when its expression is reduced. Many factors related to aging also promote tumor occurrence (gene mutations and oxidative stress, etc.) [1]. In addition, the probability of cancer development is greatly increased when there are a large number of aging cells in the tissue [2]. Most previous studies have shown that aging can inhibit tumor occurrence, and thus the idea of promoting tumor cell senescence to clear tumor cells was proposed [3]. However, with the deepening of research, many experiments have proven that aging promotes tumor occurrence, and there is a correlation between the molecular mechanism of aging and tumor occurrence [4]. The klotho gene comprises 5 exons and encodes a type I single-pass transmembrane glycoprotein (1014 amino acids in mice; 1012 amino acids in humans) located in the plasma membrane and Golgi apparatus. The intracellular domain of Klotho is very short (approximately 10 amino acids). The extracellular domain has two internal repeating sequences, KL1 and KL2, which have amino acid sequence homology with glycosidase family proteins that hydrolyze β-glycosidic bonds in sugars, glycoproteins and glycolipids [5,6]. In 2000, the beta klotho gene (KLB), encoding a single transmembrane protein, was discovered as a homologue of the mouse alpha klotho gene [7]. The KLB gene comprises 5 exons and 4 introns, the molecular weight of the transmembrane protein β-Klotho is 119.8 kD, and the structure of the β-Klotho protein consists of a C-terminal extracellular domain, a transmembrane domain and a short cell qualitative domain [8,9]. β-Klotho interacts with the fibroblast growth factor (FGF) 21 and FGF receptor 1 (FGFR1), which transmit biological cell responses through FGFRs. Klotho^−/− mice can show signs of aging-related diseases such as shortened life span, dementia, atherosclerosis, skin atrophy, decreased hearing and immune function, sexual dysfunction, cataract formation, and osteoporosis. Overexpression of Klotho can significantly extend the lifespan of mice [10]. A 2008 study found that Klotho acted as a tumor suppressor and inhibited the occurrence and development of breast cancer [11], and subsequent further studies confirmed that Klotho is an independent risk factor for the occurrence of multiple tumors [12].

Recent studies have shown that there is a significant correlation between the expression level of the KLB gene and the clinical FIGO stage of EC, the degree of histological differentiation and the degree of lymph node metastasis. Higher levels of KLB gene expression were positively correlated with a lower degree of clinical stage, and higher levels of KLB gene expression were also positively correlated with highly differentiated EC (G1) and the absence of lymph node metastasis. Our research found that β-Klotho is expressed at low levels in EC tissues, overexpression of β-Klotho can inhibit cultured EC cell proliferation and migration. We also found that the secretion of colony-stimulating factor-1 (CSF-1) in EC cells overexpressing β-Klotho was significantly reduced; therefore, we speculate that the anti-aging gene β-Klotho plays a key role in the development of EC.

Materials and methods

Hematoxylin-eosin staining and immunofluorescence staining

Normal human endometrial tissue and EC tissue samples were used in this study (all participants signed informed consent forms, and ethical approval was obtained). The inclusion criteria were as follows: age 35–65 years, no hormone therapy in the past three months. Patients with non-endometrioid carcinoma (clear cell carcinoma and serous adenocarcinoma) and patients receiving preoperative chemotherapy were excluded. The paraffin-embedded tissue sections were immersed in xylene I (Beyotime, China) for 20 min and xylene II for 20 min and rinsed with tap water. The sections were then hydrated in decreasing ethanol concentrations (Beyotime, China) and rinsed with tap water. The sections were then incubated in hematoxylin (Beyotime, China) for 1 min and rinsed with tap water. Next, the sections were stained with 0.5% eosin (Beyotime, China) for 5 min. After rinsing with water, the sections dehydrated with an ethanol gradient series (75%, 95%, and 100% ethanol for 5 min). Finally, the sections were placed in xylene I for 5 min and xylene II for 5 min transparently, sealed with neutral gum (Beyotime, China) and photographed under an optical microscope (Olympus, Japan).

All steps before hydration of immunofluorescence staining were performed with reference to HE staining protocols. After hydration, the sections were placed on a metal rack in a beaker containing sodium citrate antigen repair solution (Beyotime, China) and heated at 95°C for 15 min. After cooling to room temperature, the sections were washed with 0.01 M PBS (Beyotime, China), 5 min × 3 times. Tissues were incubated with blocking solution (Beyotime, China) containing 5% normal goat serum (Beyotime, China) for 30 min at room temperature, and mouse β-Klotho and CD68 antibodies (Abcam, USA) were diluted 1:100, mixed and dropped on the surface of the tissue; tissues were then incubated at 4°C overnight and washed with 0.01 M PBS, 10 min × 3 times. Goat anti-rabbit 555 secondary antibody (Invitrogen, USA) was diluted 1:500, added dropwise to the tissue surface, and tissues were incubated at 37°C for 1 hour at room temperature and washed with 0.01 M PBS, 10 min × 3 times. DAPI staining solution (Beyotime, China) was added dropwise to the tissue sections, the coverslips were placed, and the staining was observed under an upright fluorescence microscope (Olympus, Japan).

Cell culture

T-HESC and HEC-1A cell lines (Chinese Academy of Sciences Cell Bank) were cultured using complete DMEM + 10% FBS (Thermo Scientific, USA). The β-Klotho knockdown and overexpression viruses were purchased from Santa Cruz (USA) (the knockdown and overexpression vector sequences were not provided). When the cell density in a 10 cm culture dish reached more than 90%, 400 μl virus infection enhancement solution HitransGA and 100 μl lentivirus or a negative control with a titer of 1 × 10⁸ TU/ml were added. The culture medium was replaced with fresh medium after 24 hours, after which the medium was changed every other day. The infection efficiency was confirmed by quantifying the number of GFP-positive cells approximately 72 hours after infection. The final concentration of the IκB kinase (IKK) inhibitor AZD3264 (MCE, USA) was 10 μM, and the final concentration of the p65 inhibitor PTD-p65-P1 peptide (MCE, USA) was 100 μg/ml. AZD3264 or PTD-p65-P1 was added to cells with a stable knockdown or overexpression of β-Klotho. The CSF-1 level in the cell culture supernatant was examined after 24 hours, and the cells were fixed with 10% paraformaldehyde. p-p65 immunofluorescence staining was performed. The p-p65 primary antibody (CST, USA) concentration was 1:100, the goat anti-mouse 488 secondary antibody (Invitrogen, USA) concentration was 1:500, and a laser confocal microscope (Leica, Germany) was used to observe p-p65 nucleation.

Real-time PCR assay

After RNA extraction from tissues and cells, a reverse transcription reaction was performed to generate cDNA from the RNA for fluorescence quantitative PCR. Real-time PCR was performed with the TAKARA TB Green Premix Ex Taq II (Tli RNaseH Plus) kit in a 20 μl reaction, following the manufacturer’s directions. Two-step PCR amplification was performed according to the following procedure: 95°C for 30 seconds (1 cycle), 95°C for 5 seconds, 60°C for 30 seconds (40 cycles), and storage at 4°C. GAPDH was used as an internal reference, and the corresponding results were analyzed by the 2^−ΔΔCT method. The required primers are described in Table 1.

Table 1.

Primers for real-time PCR.

Gene name	Forward primer (5’-3’)	Reverse primer (5’-3’)
β-kloth	TTCTGGGGTATTGGGACTGGA	CCATTCGTGCTGCTGACATTTT
csf-1	TGTGGTTTGTGGGAAAGCAG	CTTCAGGCTCCTCTCTCTGG
tnf-α	GGTTCATGTTAACCAGGCCA	CCCTCCAGAAAAGACACCATG
il-1β	ACGGACCCCAAAAGATGAAG	TTCTCCACAGCCACAATGAG
il-6	CAAAGCCAGAGTCCTTCAGAG	GTCCTTAGCCACTCCTTCTG
gapdh	CTTTGTCAAGCTCATTTCCTGG	TCTTGCTCAGTGTCCTTGCCTG

Western blot assay

BCA protein quantification (Beyotime, China) was performed after protein extraction from tissues and cells. After performing SDS-PAGE on the quantified protein, the protein was transferred to a PVDF membrane (Millipore, USA). After blocking the membrane with 2% bovine serum albumin (Sigma, USA), rabbit primary antibodies against β-Klotho (1: 2000, CST, USA), p65 (1: 2000, CST, USA), and p-p65 (1: 2000, CST, USA) were separately added to the membrane and incubated at 4°C with slow shaking overnight. The membrane was washed 3 times with washing solution at room temperature for 15 min, secondary antibody (goat anti-rabbit, 1: 2000, CST, USA) was added, and the membranes were incubated at room temperature for 2 hours. After the PVDF membrane was washed, an ECL working solution (Beyotime, China) was used to detect the protein level, and the PVDF membrane was placed on the gel imager (Thermo Scientific, USA). The imaging time was adjusted according to the depth of the displayed band. ImageJ software was used to measure the gray value and quantitatively analyze the data.

β-Galactosidase staining

β-gal staining fixative solution was used for cell fixation at room temperature for 15 min after the cell culture fluid was discarded; β-Gal-staining working solution was then used to detect cell senescence after fixation. The cells were incubated at 37°C for 4 hours or overnight under tin foil to protect them from light, and the cell staining was observed under an ordinary light microscope. If it was not possible to take the photos and count the cells immediately, the staining solution was removed, 2 ml 0.1 M PBS was added to the cell culture plate, and the plate was stored at 4°C for imaging at a later date.

Cell proliferation assay

Cells were seeded into 24-well plates at a density of 1 × 10⁴ cells/well. After treatment, the cells were fixed with 4% paraformaldehyde, washed with PBS, blocked in blocking solution (Beyotime, China) for 30 minutes at room temperature, and incubated with Ki67 rabbit polyclonal antibody (1:1000, Beyotime, China) at 4°C overnight. The cells were incubated with goat anti-rabbit Alexa Fluor 546 (Invitrogen, USA) secondary antibody at 37°C in the dark for 60 minutes, washed 3 times with PBS, and incubated with DAPI (Beyotime, China) for 1 minute at room temperature. After the cells were washed with PBS, they were observed under a fluorescence microscope, and the number of positively stained cells was counted.

A CCK-8 kit (Beyotime, China) was also used to detect cell proliferation. U937 cells (1 × 10⁴ cells/well) were seeded in 96-well plates to detect cell proliferation separately, or U937 cells (5 × 10⁴ cells/well) were seeded into the upper chamber of a 24-well Transwell plate (Corning Inc., USA). T-HESC (5 × 10⁴ cells/well) or HEC-1A (5 × 10⁴ cells/well) cells were seeded into the lower chamber of a 24-well Transwell plate separately. After different concentrations of CSF-1 (10, 50, 100, 250 and 500 U/ml) and 10 μM PLX3397 were separately added into the culture medium in the upper chamber, 80 μl CCK-8 was added to the cells in the lower chamber and incubated at 37°C for 1 hour. A microplate reader (Molecular Devices, USA) was used to analyze the cell proliferation or growth rate to determine the absorbance at 450 nm.

Transwell assay

Chemotactic migration of U937 cells was measured using a Transwell chamber (Corning Inc. USA) with a 6.5 mm polycarbonate membrane (pore size 8 μm). U937 cells (10 μl M PLX3397 or 100 U/ml CSF-1 in culture medium) (5 × 10⁴ cells/well) were seeded in the upper chamber; HEC-1A or T-HESC cells (5 × 10⁴ cells/well) that overexpressed, downexpressed β-Klotho, or expressed the negative control plasmid (siNeg) were seeded in the lower chamber, and the cells were incubated for approximately 16 hours in a cell incubator. Cells were fixed with 4% paraformaldehyde for 15 minutes and stained with crystal violet for 10 minutes at room temperature. A cotton swab was used to remove non-migrating cells on the upper surface of the polycarbonate membrane. A bright-field microscope was used to count the number of cells that migrated to the submembrane surface and take the average value (randomly select 10 fields). The assay was used to observe the chemotaxis of EC cells to macrophages after interfering with the CSF-1 effect.

TUNEL assay

Cells were seeded in a 24-well plate and fixed with 4% paraformaldehyde for 15 min after the culture solution was discarded. PBS containing 0.3% Triton X-100 (Beyotime, China) was added to the cells and incubated for 5 min at room temperature. Then, 50 μl TUNEL detection solution (Beyotime, China) was added to the cells, and the cells were incubated at 37°C in the dark for 60 minutes. The cells were observed with a fluorescence microscope after mounting with an anti-fluorescence quenching mounting solution.

Enzyme-linked immunosorbent assay

The endometrial tissues (50 mg/piece) of 10 patients with benign endometrial lesions and 10 patients with EC were collected. The supernatant of 20 endometrial tissue samples (PBS and protease inhibitors were added, and the supernatant was obtained with a tissue homogenizer and ultrasound system) and T-HESC and HEC-1A cell culture supernatants were used for ELISA experiments. In this study, Abcam’s ELISA test kit was used to detect CSF-1, tumor necrosis factorα (TNF-α), Interleukin 1β (IL-1β) and IL-6 levels. A microplate reader (Molecular Devices, USA) was used to read the OD value at 450 nm, and the sample concentration was calculated based on the OD value of the standard and the sample.

Statistical analysis

All experiments in this study were repeated 6 times or more. SPSS 18.0 software was used for statistical analysis of the experimental data. The measurement data are expressed as the mean ± SD; the comparison between the mean of two independent samples was performed by t-test, and the comparison of data between multiple groups was performed by one-way ANOVA, with P< 0.05, indicating that the difference was statistically significant.

Results

Expression of β-Klotho in normal endometrial tissue and EC tissue

First, HE staining was used to identify normal endometrial tissue (control) and EC tissue (EC-1, EC-2). The results showed that the basal layer cells and proliferating cells in the control group showed a high nuclear-to-cytoplasm ratio, the nucleus was deeply stained and had a long shape, the nucleolus was not obvious, the cytoplasm was scarce, the cells were in the proliferation phase, the cells in the functional layer gland were commonly divided by the nucleus, showing a pseudostratified arrangement, and most of them were secretory cells with vacuoles. The histological morphology of the EC-1/EC-2 group was similar to that of the endometrial glands in the hyperplasia period of endometrioid adenocarcinoma. The glands or the papillary layer were lined with monolayer or stratified high columnar cells, the long axis was perpendicular to the basement membrane, and the top edge of the cell was smooth and flat (Figure 1(a)). After clarifying the tissue and pathological type of the samples, the expression of β-Klotho in the control group and the EC-1/EC-2 group was observed by immunofluorescence staining. The results showed that β-Klotho stained positively in normal endometrial tissues, and the positive cell number was significantly greater than that in EC tissues. That is, β-Klotho showed high expression in normal endometrial tissue, while β-Klotho showed low expression in EC tissue (Figure 1(b)). Real-time PCR and western blotting were used to detect the expression of β-Klotho in normal endometrial tissues and EC tissues. The results showed that compared with the control group, β-Klotho expression was significantly reduced in the EC-1/EC-2 group not only at the mRNA level (Figure 1(c)) but also at the protein level (Figure 1(d)), indicating that the expression of β-Klotho in EC tissues was significantly lower than that in normal endometrial tissues (P < 0.01).

Figure 1.

The expression of β-Klotho in normal endometrial tissues and EC tissues. (a). HE staining identifies normal endometrial tissue (control) and EC tissue (EC-1, EC-2). (b). Immunofluorescence staining was used to detect the expression of β-Klotho in normal endometrial tissue (control) and EC tissue (EC-1, EC-2); the results showed that β-Klotho expression in normal endometrial tissue was significantly higher than that in EC tissues. (c). Real-time PCR was used to detect the mRNA levels of β-Klotho in normal endometrial tissue (control-1, control-2) and EC tissue (EC-1, EC-2). (d). Western blot analysis was used to detect β-Klotho protein expression in normal endometrial tissue (control-1, control-2) and EC tissue (EC-1, EC-2). The results showed that the expression of β-Klotho in EC tissues was significantly lower than that in normal endometrial tissues at both the mRNA and protein levels. N (number of samples) = 6; **: P < 0.01. Scale bar: 10 μm or 20 μm.

β-Klotho inhibits aging, proliferation and migration of EC cells while promoting apoptosis

We next investigated whether the low expression of β-Klotho in EC affects the function of EC cells. First, β-gal staining was used to observe the number of senescent normal endometrial cells (T-HESCs) and EC cells (HEC-1A). The results showed that the number of β-gal-positive senescent cells in T-HESC cultures was lower, and the stained cells were lighter blue, while the number of β-gal-positive senescent cells in HEC-1A cell cultures was higher, and the stained cells were darker blue. Statistical analysis showed that the number of senescent cells positively stained with β-gal in HEC-1A cell cultures was significantly higher than that in T-HESC cultures (P < 0.01), indicating that the number of senescent cells in EC tissues was significantly higher than that in normal endometrial tissues. We then observed whether β-Klotho overexpression inhibits the aging of EC cells. The results showed that overexpression of β-Klotho in T-HESCs did not affect the number of senescent cells positively stained with β-gal. Overexpression of β-Klotho in HEC-1A cells significantly reduced the number of β-gal-positive cells (P < 0.01), indicating that β-Klotho can significantly inhibit the aging of EC cells (Figure 2(a)).

Figure 2.

β-Klotho inhibits aging, proliferation and migration of EC cells and promotes apoptosis. (a). β-gal staining shows cell senescence. (b). Ki67 staining shows cell proliferation. (c). Transwell experiment shows cell migration. (d). Tunel staining shows apoptosis. N (number of samples) = 6/group; **: P < 0.01. Scale bar: 20 μm or 50 μm.

Ki67 immunofluorescence staining was next used to detect the proliferation of T-HESCs and HEC-1A cells before and after overexpression of β-Klotho. The results showed that the number of normal T-HESC Ki67 immunofluorescence-positive cells was lower, while the number of HEC-1A Ki67-positive fluorescence-stained cells was relatively large. Statistics showed that the number of proliferating HEC-1A cells with Ki67 staining was significantly higher than the number of proliferating T-HESC cells (P < 0.01), indicating that the number of proliferating cells in EC tissues was significantly greater than that in normal endometrial tissue. We overexpressed β-Klotho in the above cells to observe whether β-Klotho inhibits the proliferation of EC cells. The results showed that β-Klotho reduced the number of Ki67 immunofluorescence-positive proliferating HEC-1A cells (P < 0.01), indicating that β-Klotho could significantly inhibit EC cell proliferation (Figure 2(b)). Transwell experiments were used to detect the migration of T-HESCs and HEC-1A cells before and after overexpression of β-Klotho. The results showed that overexpression of β-Klotho in T-HESCs did not affect the number of migrating cells. After overexpression of β-Klotho in HEC-1A cells, the number of proliferating cells positively stained with crystal violet was significantly reduced (P < 0.01), indicating that β-Klotho can significantly inhibit EC cell migration (Figure 2(c)). Finally, TUNEL staining was used to detect the apoptosis of T-HESCs and HEC-1A cells before and after overexpression of β-Klotho, and the results showed that overexpression of β-Klotho in T-HESCs did not affect the number of apoptotic cells; however, after overexpression of β-Klotho in HEC-1A cells, the number of apoptotic cells significantly increased (P < 0.01), indicating that β-Klotho can promote apoptosis of EC cells (Figure 2(d)).

Expression of cytokines in normal endometrial tissues and EC tissues

We next investigated how β-Klotho inhibits aging, proliferation and migration simultaneously promotes apoptosis of EC cells. Studies have shown that senescent cells secrete aging-related proteins and participate in the regulation of cell aging. We investigated whether β-Klotho participates in the development of EC by regulating the expression of cytokines. Real-time PCR was used to detect the expression of related cytokines in normal endometrial tissues and EC tissues. The results showed that the mRNA expression levels of TNF-α, IL-1β, IL-6 and CSF-1 in uterine EC tissue were significantly higher than that in normal endometrial tissue (Figure 3(a)). ELISA was used to detect the expression of related inflammatory factors in normal endometrial tissues and EC tissues, and the results showed that the protein expression levels of TNF-α, IL-1β, IL-6 and CSF-1 in EC tissue were significantly higher than that in normal endometrial tissue (Figure 3(b)). The expression of CSF-1 in normal endometrial tissue and EC tissue showed the largest difference (P < 0.01). Our previous studies have shown that CSF-1 can promote the progression of EC by inducing chemotactic macrophage migration. Therefore, we further investigated whether β-Klotho affects the secretion of CSF-1 and whether this affects EC development.

Figure 3.

Cytokines are expressed in normal endometrial tissues and EC tissues. (a). Real-time PCR was used to detect the expression of related inflammatory factors in normal endometrial tissues and EC tissues. The results showed that the expression of TNF-α, IL-1β, IL-6 and CSF-1 was significantly increased at the mRNA level. (b). ELISA detects the expression of related inflammatory factors in normal endometrial tissues and EC tissues. The results showed that the expression of TNF-α, IL-1β, IL-6 and CSF-1 increased significantly at the protein level. N (number of samples) = 6/group; *: P < 0.05, **: P < 0.01.

β-Klotho affects macrophage migration by regulating CSF-1 expression

First, CD68 immunofluorescence staining was used to observe the distribution of macrophages in endometrial tissues and EC tissues. The results showed that compared with normal endometrial tissues, there were a large number of CD68-positive macrophages in EC tissues (Figure 4(a)). Then, real-time PCR and ELISA were used to detect the effect of β-Klotho knockdown on the expression of CSF-1 in normal endometrial cells. The results showed that the expression of CSF-1 increased significantly when β-Klotho was low expressed in normal endometrial cells, while the expression of CSF-1 decreased significantly when β-Klotho was overexpressed in EC cells, indicating that β-Klotho can significantly inhibit the expression of CSF-1 in endometrial cells (Figure 4(b)). A co-culture of T-HESCs and U937 cells was used to observe the changes in the migration ability of macrophages when β-Klotho was knocked down in normal endometrial cells. The results showed that macrophage migration was significantly increased when β-Klotho was knocked down in normal endometrial cells, and this effect was significantly decreased in the presence of the CSF-1 R antagonist PLX3397. This result indicated that β-Klotho inhibited the secretion of CSF-1 and that CSF-1 was the key cytokine promoting macrophage migration in endometrial tissues (Figure 4(c)). A co-culture of T-HESCs and U937 cells was used to observe the change in U937 cell migration ability when β-Klotho was overexpressed in EC cells. The results showed that the macrophage migration ability was significantly decreased by β-Klotho, and this effect was significantly reduced when CSF-1 was added to the culture system (Figure 4(d)). The results indicate that promoting the expression of β-Klotho can inhibit the expression of CSF-1 in EC cells, thereby inhibiting macrophage migration.

Figure 4.

β-Klotho affects macrophage migration by regulating CSF-1 expression. (a). Using CD68 immunofluorescence staining to observe the distribution of macrophages in endometrial tissues and EC tissues, the results showed that compared with normal endometrial tissues, there were a large number of CD68-positive macrophages in EC tissues. (b). Real-time PCR and ELISA were used to detect the expression of CSF-1 after knocking down β-Klotho in T-HESCs or overexpressing β-Klotho in HEC-1A cells. The expression of CSF-1 increased significantly when β-Klotho was knocked down in normal endometrial cells, and the expression of CSF-1 decreased significantly when β-Klotho was overexpressed in EC cells. (c). In the co-culture system of endometrial cells and macrophages, the migration ability of macrophages was significantly increased after β-Klotho was knocked down in normal endometrial cells, and the promotion effect was blocked by the CSF-1 R antagonist PLX3397. (d). In the co-culture system of EC cells and macrophages, the migration capacity of macrophages decreased significantly after overexpression of β-Klotho, and CSF-1 rescued the migration number of macrophages. N (number of samples) = 6/group, **: P < 0.01, scale bar: 20 μm or 25 μm.

β-Klotho regulates the expression of CSF-1 through the NF-κB pathway

Next, we investigated how β-Klotho regulates CSF-1 secretion. We examined the effect of β-Klotho on the phosphorylation of p65 in the NF-κB signaling pathway, the results showed that low expression of β-Klotho in EC cells promoted the phosphorylation of p65, while overexpression of β-Klotho inhibited the phosphorylation of p65 in EC cells (Figure 5(a)). Studies have shown that the NF-κB signaling pathway is involved in the regulation of CSF-1 expression; therefore, we added the IκBα kinase IKK inhibitor AZD3264 (when IκBα is phosphorylated by IKK, it dissociates from the complex formed by p65, which can be phosphorylated to allow it to enter the cell nucleus to regulate downstream gene expression) and the p65 phosphorylation inhibitor PTD-p65-P1 peptide (to inhibit the nuclear localization of p65) to observe whether β-Klotho affects the expression of CSF-1 through the NF-κB pathway. The results showed that the level of CSF-1 increased significantly compared with the control group when EC cells were treated with AZD3264, while overexpression of β-Klotho significantly inhibited the expression of CSF-1 promoted by AZD3264 (Figure 5(b)). Phosphorylated p65 immunofluorescence staining showed that knocking down β-Klotho in EC cells promoted the translocation of phosphorylated p65 into the nucleus. After adding AZD3264, the fluorescence staining of phosphorylated p65 in the nucleus of EC cells that overexpressed β-Klotho was lower than that in the nucleus of EC cells with β-Klotho knocked down (Figure 5(c)), indicating that β-Klotho can affect the expression of CSF-1 by regulating the NF-κB signaling pathway, inhibiting p65 phosphorylation, and preventing p65 from entering the nucleus.

Figure 5.

β-Klotho regulates the expression of CSF-1 through the NF-κB pathway. (a). Western blot analysis was used to detect p65 phosphorylation levels in EC cells after knockdown or overexpression of β-Klotho. (b). ELISA detected that β-Klotho affects CSF-1 expression through the NF-κB pathway (AZD3264 and PTD-p65-P1 peptide were added to EC cells with knocked down or overexpressed β-Klotho). (c). Phosphorylated p65 immunofluorescence staining showed that knocking down β-Klotho in EC cells promoted the phosphorylation of p65 into the nucleus and the fluorescence staining of phosphorylated p65 in the nucleus of EC cells overexpressing β-Klotho after the addition of AZD3264 was significantly lower than that of EC cells with β-Klotho knocked down. N (number of samples) = 6/group, **: P < 0.01, scale bar: 20 μm or 25 μm.

Discussion

Aging is a life process that all organisms generally experience. In multicellular organisms, aging is manifested by the gradual decline in the function of multiple cells and tissues [13], and in organisms with regenerative capabilities, the senescence of cells can cause abnormal cell proliferation, which can lead to tumors. The incidence and malignancy of tumors gradually increase with age. Most patients with new tumors are over 65 years old [14,15]. If aging is directly related to tumors, the aging process promotes, rather than inhibits, tumorigenesis. Studies have found that aging markers or related secreted phenotypes (such as β-Gal expression and identification of damaged DNA) exist in early-stage tumor tissues. However, as the malignancy of tumors gradually increases, some aging-related molecular expression levels are significantly reduced. In the pten^−/− mouse disease model, there were a large number of senescent cells in the early stage of the lesion. As the tumor gradually progresses, the number of senescent cells also gradually decreases [16]. The gradual decrease in senescent cells as a result of by K-Ras activation has also been confirmed in mouse models of lung cancer and pancreatic cancer [17]. Some studies have found that senescence-associated secretory phenotype (SASP) exerts a tumor-suppressive effect [18]; however, many other studies have confirmed that SASP plays a dual role, either promoting or inhibiting tumorigenesis [4,19]. However, whether the tumor is caused by oxidative stress, gene mutation, and abnormal DNA repair as a result of cell aging or whether the tumor cells have escaped the fate of cell aging needs to be further investigated.

Our previous research found that β-Klotho expression is downregulated in EC tissues, and overexpression of β-Klotho in EC cells can inhibit the proliferation, migration and invasion of EC cells. Therefore, we further studied the role of β-Klotho in the development of EC. EC is one of the three most common malignant tumors of the female reproductive system. The incidence of EC has increased in recent years, with increases in estrogen treatments, obesity, and dietary changes [20]. There is currently no effective treatment for patients with metastatic EC tumors. Standard treatments include primary hysterectomy and bilateral salpingo-oophorectomy, usually using minimally invasive methods (laparoscopic or robotic). The surgical strategy for lymph nodes depends on histological factors (subtype, tumor grade, lymphatic space involvement), disease stages (including myometrial invasion), patient characteristics (age and comorbidities), and national and international guidelines. Adjuvant therapy depends on histology and stage. Various classifications can be used to assess the risk of recurrence and determine the best postoperative management [21]. Therefore, an in-depth study of the role and mechanism of EC metastasis is very important for the effective treatment of EC. Tumor-associated macrophages (TAMs) have immunosuppressive functions and are an important part of the tumor microenvironment. TAMs regulate tumorigenesis, development and metastasis in various ways [22,23]. The proliferation of TAMs and the secretion of inflammatory factors promote type I EC development [24]. The density of TAMs in type II EC is almost twice that of type I EC. This difference may be due to the predominance of M1 macrophages in type II EC [25]. Chemokine (C-X-C motif) ligand 8 secreted by TAMs downregulates the expression of estrogen receptor-α in EC cells by acting on the homeobox B13 protein, which may be involved in cancer invasion [26]. TAMs are also involved in EC neovascularization and cancer cell infiltration of the myometrium [27]. In a study of 98 patients with primary EC with macrophage reactivity, approximately 40% of EC cells expressing CSF-1 experienced substantial macrophage infiltration, suggesting that the expression of CSF-1 promotes the recruitment of macrophages. CSF-1 levels are closely related to the malignant degree of the primary tumor and its corresponding lymph node metastasis [28].

CSF-1 binds to the CSF-1 receptor (CSF-1 R) expressed on the surface of macrophages, induces the proliferation and infiltration of TAMs, and participates in the proliferation, invasion and migration of tumor cells [29]. Previous studies have found that CSF-1 is highly expressed in many types of tumors, and the level of CSF-1 in the blood circulation can be used as a molecular marker for lung cancer, breast cancer, prostate cancer, and lymphoma [30]. Previous studies have reported that CSF-1 R inhibitors can significantly reduce the size of glioblastoma and reduce tumor invasion by inhibiting TAMs, indicating an inflammatory cytokine interaction between TAMs and glioblastoma [31]. Therefore, the overexpression of CSF-1 or CSF-1 R is positively correlated with the malignancy and poor prognosis of EC, and blocking CSF-1 or CSF-1 R may inhibit the progression of EC. However, the mechanism by which the CSF-1 and CSF-1 R pathways regulate tumor invasion, tumor immunity, and tumor angiogenesis is unclear. Our previous studies have demonstrated that inhibiting the expression of CSF-1 and blocking CSF-1 R plays a role in blocking macrophage migration and EC cell proliferation [32].

Secreted Klotho protein is widely present in organisms, but an increase in the level of secreted Klotho protein inhibits the growth of tumor cells. Klotho can participate in the occurrence of cervical cancer by regulating the Wnt/p-catenin signaling pathway. It has been confirmed that Klotho promoter methylation rarely occurs in early-stage cervical cancer, while substantial Klotho promoter methylation is found in mid-to late-stage cervical cancer. Researchers have also confirmed that Klotho expression is reduced in breast cancer, and its expression level is closely related to the insulin-like growth factor 1 (IGF-1) and FGF pathways [33]. In addition, the expression of Klotho has a significant correlation with the occurrence of lung cancer [34], colorectal cancer [35], and renal cell carcinoma [36]. At present, knowledge of the role and mechanism of Klotho in the development of tumors is not deep enough. Based on the above research and our previous results, we believe that β-Klotho could play a substantial role in the future treatment of tumors. Little research has been done on the role of Klotho in EC. Therefore, we conducted an in-depth study on the mechanism by which β-Klotho promotes the development of EC. We found that increased expression of CSF-1 in EC tissue was accompanied by the infiltration of a large number of macrophages. CSF-1 can significantly promote macrophage migration while knocking down CSF-1 in EC cells, or using CSF-1 R inhibitors, can significantly inhibit macrophage migration. We asked whether β-Klotho affects macrophage infiltration by affecting CSF-1 secretion and if macrophage infiltration affects the progression of EC. Overexpressing β-Klotho in EC cells significantly reduced CSF-1 expression, while in normal endometrial cells, CSF-1 expression was significantly increased when β-Klotho was knocked down. In addition, we found that high expression of CSF-1 promoted the migration of macrophages, while TAMs promoted EC development. Therefore, we believe that the expression of the anti-aging protein β-Klotho is substantially reduced in EC cells, resulting in a considerable increase in the ability of EC cells to secrete CSF-1. Increased secretion of CSF-1 promotes the migration of a large number of macrophages to the lesion area, and TAMs promote the expression of proliferating proteins associated with EC cells, thereby promoting the development of EC. Based on the above results, we hope to use RNA-seq experiments to observe the effect of β-Klotho on the gene expression regulation of EC cells to further understand the role of β-Klotho in the pathogenesis of endometrial cancer, which is a potential target for the treatment of endometrial cancer [37–39].

Funding Statement

The author(s) reported there is no funding associated with the work featured in this article.

Disclosure statement

No potential conflict of interest was reported by the author(s).