Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2022 Sep 28;12(11):296. doi: 10.1007/s13205-022-03374-1

Production of fructan synthesis/hydrolysis of endophytic bacteria involved in inulin production in Jerusalem artichoke

Sumolnat Khamwan 1, Sophon Boonlue 1, Wiyada Mongkolthanaruk 1,✉
PMCID: PMC9519817  PMID: 36276462

Abstract

Endophytic bacteria refer to bacteria which promote plant growth via direct and indirect mechanisms. Three endophytic bacteria isolated from Jerusalem artichoke exhibited plant growth induction and inulin production. These bacteria had functions of fructan degradation and synthesis from inulinase and levansucrase, respectively. Rossellomorea aquimaris 3.13 and Priestia megaterium 3.5 obtained inulinase/levanase enzyme with inulin and levan as substrates; enzyme production showed the optimum conditions in 1% inulin medium of 35 °C, pH 7.0. Bacillus velezensis 5.18 and Priestia megaterium 3.5 had inulosucrase/levansucrase enzyme with sucrose as a major carbon source; the enzyme had optimum temperature and pH conditions of 30 °C and pH 7.0, respectively. A combination of carbon sources had effect on decreasing enzyme activity; in addition, co-inoculation of bacteria showed a slight difference in enzyme production compared with single inoculation. The inulosucrase/levansucrase was produced earlier in co-culture containing bacteria with inulinase activity. Plant fructan synthesis was involved in 1-SST and 1-FFT, while 1-FEH encoded inulin degradation; these genes were evaluated in Jerusalem artichoke inoculated with the endophytic bacteria to quantify gene expression level using qPCR. All genes expressed in low levels at early stage of growth, responding to all endophytic bacteria. Significantly, Bacillus velezensis 5.18 induced all genes of the plant at 65 days of inoculation; Rossellomorea aquimaris 3.13 induced 1-FFT while Priestia megaterium 3.5 induced 1-SST.

Keywords: Inulinase, Inulosucrase, Levanase, Levansucrase

Introduction

Inulin type fructans are β-(2,1)-linked fructose oligomers and polymers synthesized mostly by plants. Inulin presents in tubers of Jerusalem artichoke and functions as a reserve carbohydrate (Pandey et al. 1999). Pure inulin and fructooligosaccharides are processed in a number of different ways for health food markets as they have a role as prebiotics and promote beneficial gut microbiota, such as Bifidobacterium, Lachnospiraceae (Valcheva et al. 2019). Moreover, inulin strengthens the immune system and helps to prevent infection and cancer (Man et al. 2021). In plants, groups of enzymes induce fructan synthesis with transglycosylating activities, such as sucrose:sucrose 1-fructosyltransferases (1-SST, EC 2.4.1.99), fructan:fructan 1-fructosyltransferase (1-FFT, EC 2.4.1.100), sucrose:fructan 6-fructosyltransferase (6-SFT, EC 2.4.1.10), fructan:fructan 6G-fructosyltransferase (6G-FFT, EC 2.4.1.243). Another group of enzymes involved in fructan degradation are fructan β-(2,1)-fructosidase/1-exohydrolase (1-FEH, EC 3.2.1.153) or fructan β-(2,6)-fructosidase/6-exohydrolases (6-FEH, EC 3.2.1.154). Fructan synthesis occurs when sucrose in the plant vacuole combines with SST and FFT as an energy resource for survival in stress conditions. In contrast, fructan metabolism is involved in FEH, which is related to energy consumption (Yoshida 2021).

Many microorganisms have been reported to produce inulinase in both types, exo-inulinase and endo-inulinase. Reports of bacterial inulinase involved Xanthomonas spp., Bacillus spp., Clostridium spp., Staphylococcus spp., and Pseudomonas spp.; however, some bacteria also produced levanase for fructan degradation leading to fructooligosaccharide (used as prebiotics) and fructose syrup (used in the food industry and for energy production). The exo-inulinase hydrolyzed sucrose, raffinose, and many fructans nonspecifically, while endo-inulinase and endo-levanase could hydrolyze internal linkage in inulin and levan (Shi et al. 2019). Inulin was produced from inulosucrase and levan from levansucrase. Traditionally, levan is produced from microorganisms, such as Lactobacillus spp., Bacillus spp., by levansucrase; a few gram-positive bacteria are able to produce inulosucrase (Öner et al. 2016). The endophytes were able to produce inulinase, which was studied for enzyme characterization, cloning and sequencing of inulinase gene; this enzyme has potential application in inulin degradation, creating very-high-fructose syrup (Zhang et al. 2010).

The aim of this work was to demonstrate evidence of endophytic bacteria related to yield (inulin) in Jerusalem artichoke involved in fructan synthesis and degradation process. From previous reports, endophytic bacteria were able to promote plant growth and high inulin levels in tubers of Jerusalem artichoke. To explain the roles of endophytic bacteria in plant inulin synthesis, enzyme activity and the genes of inulinase and levansucrase were investigated in the bacteria. Moreover, the effects of carbon sources, temperature and pH on endophytic bacteria enzyme production in vitro were determined. The gene response of Jerusalem artichoke for inulin synthesis was evaluated, examining the expression level in plants inoculated with endophytic bacteria by quantitative PCR (qPCR) to demonstrate the relationship between plant and bacteria.

Methods

Endophytic bacteria

The three endophytic bacteria isolated from Jerusalem artichoke (Helianthus tuberosus L.) were identified by 16S rRNA gene and reconstructed to new genus and new species as follows Rossellomorea aquimaris 3.13 (MH973229), Priestia megaterium 3.5 (MH973228) and Bacillus velezensis 5.18 (MH973231). Each strain showed the promotion of inulin accumulation in the tubers of Jerusalem artichoke (Namwongsa et al. 2019). These bacteria were chosen to determine gene and activity of inulin degradation and synthesis in this study. The bacteria were grown in Luria broth (LB) medium and incubated at 30 °C with agitation at 180 rpm.

Determination of inulinase and inulosucrase gene using degenerated primers

The bacterial cells grown in LB were harvested up to 2 × 109 CFU/ml in a 1.5 ml microtube. The supernatant was discarded and the cell pellet was broken following the manufacturer’s instructions (GeneJET genomic DNA purification kit, Thermo Fisher Scientific). Primers of inulin synthesis and inulin degradation gene were designed based on the conserved amino acid residues of inulinase and inulosucrase from several bacterial strains. Nucleotide sequence alignment of these residues was performed using the Bioedit program to design degenerated primers which were then checked for compatible primers by IDT oligo analysis tool (http://sg.idtdna.com/calc/analyzer). Four degenerated primers named EI_F, EI_R, Ins_F and Ins_R are shown in Table 1.

Table 1.

Primers used for the detection of different gene and gene expression in the real-time PCR assay

Name Gene Sequence (5’-3’) Tm (°C) References
EI_F Inulinase TGGATGAAYGAYCCVAACG 54 This study
EI_R ACTTTNGGATCSCGRAAATC 53 This study
Ins_F Inulosucrase CAAGAATGGTCDGGRTCWGCK 57 This study
Ins_R NGGRACWGCRTAATAWGAATAWGT 52 This study
18S_F 18S rRNA GGCGACGCATCATTCAAAT 54 Flavio et al. (2015)
18S_R TCCGGAATCGAACCCTAAT 53 Flavio et al. (2015)
1_SST_F SST TACCATTTTCAACCCGATAAGAAT 52 This study
1_SST_R CATGCTCTACACTGGCAACG 56 This study
1_FFT_F FFT TGCGATTACGGAAGGTTCTT 54 Flavio et al. (2015)
1_FFT_R CAACATTATAGATTGTAGCCCATCC 53 Flavio et al. (2015)
1_FEH_F FEH GGCGGATGTTACAATTTCGT 53 Flavio et al. (2015)
1_FEH_R AAACCAACTTGGGCGATA 51 Flavio et al. (2015)
Open in a new tab

Y: C, T; V: A, C, G; N: A, T, C, G; S: C, G; R: A, G; D: G, A, T; W: A, T; K: G, T

PCR was performed on DNA of the endophytic bacteria as templates under reaction mixture (50 µl) containing 1X PCR buffer, 2 mM MgCl2, 0.2 mM each deoxynucleotide triphosphate (dNTP), 1 µl each primer (5 pmol/µl), 1.25 U Taq polymerase (Thermo Fisher Scientific), and 2 µl purified DNA (1 ng). The PCR profile was set at an initial denaturation at 95 °C for 3 min, then 35 cycles of template denaturation at 95 °C for 60 s, primer annealing at 44 °C for inulinase gene (EI_F and EI_R) and 48 °C for inulosucrase gene (Ins_F and Ins_R) for 60 s, primer extension at 72 °C for 3 min with a final extension at 72 °C for 12 min. The PCR products were analyzed on 1% agarose gel with the expected size of inulinase gene and inulosucrase gene being 350–450 bp and 750–850 bp, respectively.

Verification of gene fragments by sequencing

The expected PCR products were purified by GeneJET PCR Purification Kit (Thermo Fisher Scientific) and then cloned into TA cloning vector kit containing T4 ligase, vector and buffers (RBC Bioscience, Taiwan). The vector was transformed into E. coli TOP10 electrocompetent cells. The E. coli cell culture grown in 150 ml of LB (OD600 = 0.4) was placed on ice for 30 min and then centrifuged at 9700g for 15 min at 4 °C. The bottle of pellet cells was kept on ice all the time, suspended in 150 ml of ice-cold H2O. The supernatant was separated by centrifugation at 9700g, 15 min at 4 °C. The pellet was suspended with 75 ml of ice-cold H2O and the supernatant discarded. Finally, the pellet was suspended in 3 ml of ice-cold 10% glycerol and then centrifuged at 11400g for 15 min at 4 °C to remove the supernatant. The competent cell was suspended with 0.75 ml of ice-cold 10% glycerol and then in aliquot to store at − 80 °C. The transformation was run by electroporation (Electro Cell Manipulator® ECM 630) at a voltage 2.5 kv, resistance 200 Ω, capacitance 25 µF, 4.5 ms in 2 mm BTX Disposable Cuvettes Plus. The transformants were selected on LB agar supplemented with 100 µg/ml ampicillin and 100 mM IPTG and 50 mg/ml X-gal for blue/white colony screening. The plasmid of positive clones was extracted, and the inserted fragment checked using HindIII digestion. The sequencing of the inserted fragment was performed using M13 (− 40) universal primer by 1st BASE company (Malaysia).

Effects of culture conditions on enzyme production

The effect of carbon sources on enzyme production was determined by inoculation of bacteria in LB broth supplemented with different carbon sources (1%), such as glucose, sucrose, fructose, L-arabinose, and inulin; the medium was incubated at 30 °C for 20 h. The bacteria were grown in LB broth with a suitable carbon source and then incubated at 15, 20, 25, 30, 35, 40, 45, 50 °C for 20 h to determine an optimum temperature. The growth and enzyme activity were measured. The production medium was adjusted from initial pH at 6, 7, 8, and then inoculated with bacteria. The culture was incubated at the optimum temperature for 20 h. The enzyme activity was measured after incubation to determine the optimum pH for the culture medium.

Co-cultures of the endophytic bacteria were examined for enzyme activity in LB medium containing 1% of inulin and sucrose, adjusted at pH 7, and incubated at 35 °C. In parallel, a single culture experiment was performed in the same medium, and enzyme activity compared.

Inulinase activity

The culture broth was centrifuged at 6,800×g for 5 min, and the supernatant was recovered as crude enzymes. The reaction mixture containing 0.1 ml of the crude enzyme, 0.9 ml of phosphate buffer (0.1 M PBS, pH6.0), and 1% (w/v) inulin from chicory (Sigma) was incubated at 60 °C for 60 min. The reaction was terminated at 100 °C for 10 min. The free fructose was analyzed by mixing an aliquot of the reaction (150 µl) with 20 mM citrate buffer pH6.0 (5 ml), 10 mM sodium periodate reagent (100 µl), and water (4.60 ml). After 5 min, 100 mM potassium iodide (150 µl) was added, and the mixture was left for an additional 5 min (Fang et al. 2008; Saengkanuk et al. 2011). Solution absorbance was subsequently measured at 350 nm using a UV–Vis spectrophotometer. One inulinase unit (U) is defined as the amount of enzyme releasing 1 µmol of reducing sugar per minute. Following enzyme activity determination, the specific substrates were determined by crude inulinase enzyme incubated with 1% of different substrates, e.g., inulin (from chicory), levan, raffinose.

Inulosucrase activity

The culture broth was centrifuged at 6800×g for 5 min, and the supernatant was recovered as crude enzymes. The reaction was measured at 60 °C containing 0.1 ml of the crude enzyme in 50 mM phosphate buffer (pH6.5) with the presence of 293 mM sucrose for 60 min. The reaction was terminated in boiling water at 100 °C for 10 min. The free fructose was analyzed using the method described above. The total fructose was measured by acidified supernatant with 0.2 mL−1 HCl in a final volume of 50 ml, and subjected to acid hydrolysis at 97 ± 2 °C for 45 min. The solution was then adjusted to pH 7.0 with NaOH before dilution with water to 50 ml (Saengkanuk et al. 2011). The neutral hydrolysate (150 µl) was analyzed by spectrophotometer, the same procedure as used for free fructose analysis. One inulosucrase unit (U) is defined as the amount of enzyme that released 1 μmol of fructose per minute.

Plant materials and inoculation with endophytic bacteria

Seedlings (7 day-old) of Jerusalem artichoke either noninoculated (control) or inoculated with bacteria were transplanted into individual pots (one seedling per pot). The culture of positive strains carrying inulinase or inulosucrase was grown in LB medium and incubated with suitable conditions for enzyme activity. After that, the bacterial suspension (108 CFU/ml), prepared in phosphate buffer saline (PBS, pH 7.4) in total volume of 5 ml, were inoculated into the seedling. The experiment was performed with a random complete block design (RCBD) with 3 replicates for each treatment. The plants were collected at 35, 42, and 65 days after bacterial inoculation. Leaves were separated and washed by surface disinfection with 10% Clorox for 5 min and 3 times with water. The samples were frozen immediately in liquid nitrogen and stored at − 80 °C until use.

RNA extraction and real-time PCR analysis

The total RNA was extracted from the leaves of plants either noninoculated or inoculated with endophytic bacteria. The procedure was followed by Purelink RNA mini kit (Invitrogen), after which the RNA sample was treated with DNaseI (Invitrogen). The RNA was assessed by nanodrop spectrophotometer (Maestrogen) at OD260 and OD260/280 for quantity and quality, respectively, and was also checked by 1% agarose gel electrophoresis. cDNA synthesis was performed using Transcriptor First Strand cDNA synthesis Kit (Roche) and assessed by nanodrop spectrophotometer (Maestrogen). The cDNA of transgenic plants was examined for expression of genes for inulin synthesis and degradation of Jerusalem artichoke with SST, FFT, FEH, and 18S gene primers (Table 1) by Light Cycler 480 (Roche). The reaction mixture was 3 µl of water, PCR grade (Roche), 10 µl of master mix (Roche), 5 µl of cDNA template (1 µg) and 2 µl of primers. Real-time PCR condition was employed with a thermal cycler for initial preincubation at 95 °C for 5 min, then 45 cycles of amplification at 46 °C for every gene for 45 s, primer extension at 72 °C for 30 s, melting curve at 95 °C for 5 s and cooling at 40 °C for 10 s. The data were analyzed for gene expression by ΔΔCT method and the real-time PCR product was determined by gel electrophoresis and confirmed by sequencing. The experiments were repeated three times.

Results

Investigation of inulinase and inulosucrase gene from endophytic bacteria using degenerated primers

Three endophytic bacteria of Jerusalem artichoke promoting growth and inulin production (Namwongsa et al. 2019) were determined to possess inulinase and inulosucrase genes which might be involved with inulin accumulation in tubers of Jerusalem artichoke. Using EI_F and EI_R primers, R. aquimaris 3.13 obtained PCR products at 423 bp and 1107 bp fragments; another strain, P. megaterium 3.5, obtained a size of PCR fragment at 423 bp. Each amplicon was cloned and sequenced to verify inulin degradation gene. The nucleotides of each fragment were translated to amino acids (Fig. 1) and blastp search with nonredundant protein sequence from NCBI. The PCR product of R. aquimaris 3.13 involved 2 fragment sizes, 423 bp fragment encoded 135 amino acids (3.13IES) and 1107 bp fragment encoded 215 amino acids (3.13IEL). The translated protein of both fragments was identified as a glycoside hydrolase family 32 protein of Bacillus sp. JRC01 (MBV6685193) with 99% identity. To specific fructan hydrolysis, the 3.13IES showed 72% similarity to exo-inulinase of Pseudomonas mucidolens (AAF44125) and the 3.13IEL had 96% similarity with levanase of Bacillus marisflavi (WP053429789). P. megaterium 3.5 showed translated protein of 114 amino acids (3.5 IE) with 100% identity of levanase from Priestia (Bacillus) aryabhattai (KZE15556), while no PCR product was detected in B. velezensis 5.18. Therefore, R. aquimaris 3.13 and P. megaterium 3.5 obtained the fructan degradation enzyme, named levanase or inulinase. In addition to specific substrate, the crude enzyme of R. aquimaris 3.13 and P. megaterium 3.5 were incubated with substrates (levan, inulin and raffinose); the hydrolysis activity was shown as specific to inulin in both strains, giving 284 and 245 U/ml, respectively. However, R. aquimaris 3.13 was able to degrade levan and raffinose with 138 and 47 U/ml, respectively; while P. megaterium 3.5 showed the activity of levan degradation at 57 U/ml. Thus, these bacteria produced an inulin degradation enzyme, called inulinase.

Fig. 1.

Fig. 1

Open in a new tab

Amino acid regions of the positive PCR fragments of R. aquimaris 3.13 with 423 nucleotides (3.13IES) and 1107 nucleotides (3.13IEL) which were translated into 2 fragments. The first fragment (462 bp.) showed noncoding protein; second fragment (645 bp) encoded levanase protein. The positive fragment of P. megaterium 3.5 with 126 amino acids of levanase (3.5 IE). Underline amino acids indicate translated amino acid of forward and reverse primers. Bold amino acids represent conserved region found in all fragments

Determining inulosucrase using Ins_F and Ins_R primers, the expected size of PCR product was 750–850 bp which was observed in 2 strains of the endophytic bacteria. P. megaterium 3.5 and B. velezensis 5.18 contained only one fragment, approximately 800 bp; the sequence of 774 nucleotides encoded 258 amino acids (Fig. 2) that had a specific hit with glycosyl hydrolase family 68 (GH68). The translated protein of both strains shared 96% of its identity with levansucrase of Bacillus megaterium (WP014460798). The results implied that R. aquimaris 3.13 contained fructan degradation enzyme and B. velezensis 5.18 contained fructan synthesis enzyme; while P. megaterium 3.5 carried both enzymes.

Fig. 2.

Fig. 2

Open in a new tab

Amino acid regions of the positive PCR fragments of levansucrase from P. megaterium 3.5 (3.5Ins) and B. velezensis 5.18 (5.18Ins) with 258 amino acids between primers region. Underline amino acids indicate translated amino acid of forward and reverse primers

Effect of carbon sources, pH and temperature on enzyme production

The inulinase enzyme exhibited high activity in medium containing 1% of inulin and arabinose for R. aquimaris 3.13 and P. megaterium 3.5 (Fig. 3a), while they did not produce inulinase in the medium with other sugars. However, the enzyme was detected in LB medium containing 1% inulin and either 0.5% of glucose, fructose and sucrose. Surprisingly, no enzyme was detected in the medium with a mixture of inulin and L-arabinose (Fig. 3b). It is clear that inulinase production was triggered using inulin as a major substrate or inducer. These bacteria might use arabinose to induce an operon involved in inulinase production. Inulinase activity was detected in B. velezensis 5.18 when grown in sucrose or fructose; this may be caused by the hydrolysis activity of inulosucrase or levansucrase which hydrolyze sucrose to glucose and fructose in order to produce long chain polymerization (Porras-Domínguez et al. 2015). The optimum pH and temperature of both strains were pH 7.0 and 35 °C, factors associated with their growth.

Fig. 3.

Fig. 3

Open in a new tab

Inulin degradation activity in various culture conditions of three endophytic bacteria (a) carbon sources, (b) mixed carbon sources (c) pH and (d) temperature

The inulosucrase activity was outstanding in medium with sucrose as a carbon source of P. megaterium 3.5 and B. velezensis 5.18 (Fig. 4). This activity was not detected in R. aquimaris 3.13. A combination of sucrose and other substrates reduced the inulosucrase; this implies that other sugars inhibit enzyme production. The culture conditions of both strains were at pH 7.0 and 30 °C, which related to growth. While low temperatures prevented growth, P. megaterium 3.5 gave high activity at 25–35 °C. Only B. velezensis 5.18 grown at 50 °C and could produce the enzyme. Comparison of enzyme activity between original culture (LB medium) and optimum condition showed a significant increase of more than threefold in inulinase of R. aquimaris 3.13 and more than twofold in inulosucrase of P. megaterium 3.5 and B. velezensis 5.18. This result indicated the significant effects of temperature, carbon source and pH on enzyme production and may support the possibility that endophytic bacteria respond to the environment of plant tissue.

Fig. 4.

Fig. 4

Open in a new tab

Inulin synthesis activity in various culture conditions of endophytic bacteria (a) carbon sources, (b) mixed carbon sources (c) pH and (d) temperature

Enzyme activity in the mixed substrates of co-cultural bacteria

The inulinase activity of P. megaterium 3.5 started at 12 h and decreased after 24 h; while inulosucrase activity began at 24 h and showed increase at 36 h (Fig. 5a). Regarding the 2 substrates and 2 enzymes, P. megaterium 3.5 used inulin as a substrate of inulin-degradation initially, producing fructose; it used sucrose including fructose for inulin-synthesis later on. R. aquimaris 3.13 (contained inulinase activity) produced the enzyme over time from 12 h, giving the highest activity at 24 h. The inulosucrase activity of B. velezensis 5.18 presented high inulosucrase activity at 24 and 36 h, with low levels of inulinase activity over the same time frame.

Fig. 5.

Fig. 5

Open in a new tab

Effect of enzyme production in medium containing mixed inulin and sucrose (a) single culture of P. megaterium 3.5 (3.5), R. aquimaris 3.13 (3.13) and B. velezensis 5.18 (5.18); (b) co-culture of 3.5 and 3.13; (c) co-culture of 3.5 and 5.18; (d) co-culture of 3.13 and 5.18. The culture grew at 35 °C for 12, 24, and 36 h

The co-culture between P. megaterium 3.5 with either R. aquimaris 3.13 and B. velezensis 5.18 exhibited similar results with high inulinase activity for the former and high inulosucrase activity for the latter pairing. Inulinase activity started earlier in the co-culture, producing intermediates for inulosucrase which appeared after 12 h of incubation (Fig. 5b–d). It is likely that the bacteria grew individually and that enzyme activity depended on the consumption of substrates in the medium. Moreover, the co-culture of R. aquimaris 3.13 and B. velezensis 5.18 showed individual activity for each strain. High inulinase levels had small effects on inulosucrase activity (Fig. 5d), evident with inulosucrase at 12 h in co-culture.

Expression level of genes related fructan synthesis in Jerusalem artichoke inoculated with the endophytic bacteria

Three endophytic bacteria were investigated for their relationship to inulin synthesis (1-SST, 1-FFT) and inulin degradation (1-FEH) in Jerusalem artichoke by real-time PCR technique with 18S rRNA as a reference gene (Hellemans et al. 2007). The melting curve analysis revealed that all primer pairs amplified a single PCR product with the expected sizes and PCR products confirmed by sequencing. The 1-SST gene showed melting curve at 76 °C; the 1-FFT gene showed melting curve at 76–79 °C and the 1-FEH gene showed melting curve at 77 °C. The gene expression of 1-SST and 1-FEH was observed at similar levels in all bacterial treatments at 35 and 42 days of inoculation; an exception was on 65 days, when plants inoculated with B. velezensis 5.18 showed the highest levels of 1-SST and 1-FEH gene expression (Fig. 6). Moreover, the 1-FFT was expressed highest in plants inoculated with R. aquimaris 3.13 and B. velezensis 5.18 at 45 days and 65 days, respectively. Despite this, the level of 1-FFT gene expression was lower than the other 2 genes which implied that the major genes were 1-SST for inulin synthesis and 1-FEH for inulin degradation. This study concluded that R. aquimaris 3.13 encoded the inulinase gene, which had an effect on 1-FFT, while B. velezensis 5.18 showed induction of gene expression in all 3 genes.

Fig. 6.

Fig. 6

Open in a new tab

The relative expression level of 1-SST, 1-FFT, and 1-FEH in Jerusalem artichoke leaf tissue at 35, 42, and 65 days after inoculation of P. megaterium 3.5 (3.5), R. aquimaris 3.13 (3.13) and B. velezensis 5.18 (5.18). The expression profiles are calculated from delta/deltaCT (ΔΔCT method) using reference genes (18S rRNA) and each specific gene (control) for amplification efficiency. (*) represent significant level of gene expression at p > 0.95

Discussion

The term endophytes simply mean the microorganisms in types of fungi and bacteria that colonize plants (intercellular or intracellular tissues) with their complex interactions of mutualism. They are important for plant health and survival in different environments (Hardoim et al. 2015). The main benefits of endophytes are the production of bioactive compounds which induce plant growth and the development of an immune response against pathogens. The endophytic bacteria used in this work demonstrated properties of promoting growth and boosting inulin yield in Jerusalem artichoke with 1-aminocyclopropane-1-carboxylate (ACC) deaminase production. High levels of inulin accumulation in the tubers of Jerusalem artichoke were observed in the plant inoculated with Rossellomorea (Bacillus) aquimaris 3.13 and Bacillus velezensis (amyloliquefaciens) 5.18 in both well watering and drought conditions compared with the control without bacterial inoculation (Namwongsa et al. 2019). Therefore, these endophytic bacteria were investigated to better understand the relationship of inulin synthesis and degradation between plant and bacteria. The bacterial genes were detected using PCR with the degenerated primers; the results indicated that R. aquimaris 3.13 and P. megaterium 3.5 obtained fructan degradation in a glycoside hydrolase family 32 (GH32) comprising enzymes that hydrolyze fructose of polysaccharides, such as invertase (EC 3.2.1.26), inulinases (EC 3.2.1.7), exo-inulinases (EC 3.2.1.80), levanases (EC 3.2.1.65), β-2,6-fructan 6-levanbiohydrolases (EC 3.2.1.64). The enzyme activity of R. aquimaris 3.13 and P. megaterium 3.5 was specific to inulin substrate and R. aquimaris 3.13 was able to digest levan and raffinose, while P. megaterium 3.5 could digest levan, but not raffinose. Levan and raffinose contain β-2,6 glycosidic bond link and α-D-glucose glycosidic link which are digested by levanase and invertase (Waterhouse and Chatterton 1993). Exo-inulinase results from hydrolytic activity releasing fructose from various substrates, such as sucrose, raffinose, nystose, and inulin (Shen et al. 2015). This means that exo-inulinase has invertase activity coupled with inulinase; while endo-inulinase lacks invertase activity (Das et al. 2019). Based on the substates, it is presumably the inulinase enzyme in both strains. Another enzyme for fructan production found in P. megaterium 3.5 and B. velezensis 5.18 with specific degenerated primers, called levansucrase (EC 2.4.1.10), is in the glycoside hydrolase family 68 (GH68), which includes inulosucrase (EC 2.4.1.9). The majority of fructan from bacteria is levan type, particularly in Bacillus, which is produced by levansucrase; meanwhile inulosucrase enzymes are present in lactic acid bacteria. Levansucrase is able to catalyze both sucrose hydrolysis and levan polymerization into levan, which is much longer than plant fructans (Han 1990). Thus, P. megaterium 3.5 and B. velezensis 5.18 were assume to produce levansucrase as the product of the enzyme was levan. The enzymes of R. aquimaris 3.13, P. megaterium 3.5 and B. velezensis 5.18 should be further studied in functions and structures.

Inulin proved the optimal carbon source of fungal and yeast strains producing inulinase, while the presence of simple sugar inhibited inulinase (Derycke and Vandamme 1984). Similarly, R. aquimaris 3.13 and P. megaterium 3.5 achieved the highest inulinase activity in 1% inulin medium. According to the results of carbon source analysis, these bacteria required inulin and arabinose for inulinase production; arabinose might activate the operon involved in oligosaccharide degradation including inulin. However, as inulinase activity decreased in mixed carbon medium of inulin and arabinose, this is still not clear. The possibility of inulinase repression may be a feedback inhibition or catabolic suppression in the presence of sugars (Prabhjot et al. 2003). In this work, the optimum pH for inulinase activity was pH 7.0. Moreover, inulinase activity was observed at pH 8.0. The optimum temperature was 35 °C, with enzyme activity decreasing at 40–45 °C; there was no observed enzyme activity at 15 °C and 50 °C, with no growth recorded. Similar to other bacteria, Streptomyces rochei E87 showed the optimal temperature of inulinase for the greatest production at 32 °C (Yokota et al. 1995); Xanthomonas campestris pv phaseoli also had optimum pH and temperature at pH 7.0 and 37 °C (Ayyachamy et al. 2007) but Arthrobacter was observed at acidic pH (Elyachioui et al. 1992).

Levansucrase and inulosucrase, belong to the same family of glycoside hydrolases 68. These enzymes have 2 functions: to catalyze hydrolysis of sucrose to free fructose and to transfer fructose residues to another, leading to kestose formation (glucosyl-1,2 fructosyl-1,2 fructose) (Araya et al. 2011). In this study, the sole carbon source of levansucrase production was sucrose, while inulin was the substrate for levansucrase production. This indicated that the enzyme required fructose as an intermediate compound. A mixed carbon source did not enhance enzyme production. The maximum levansucrase activity was observed at pH 7.0 and 30 °C for P. megaterium 3.5 and B. velezensis 5.18. The results differed from other bacteria producing levansucrase (fructosyltransferases) which had optimum conditions at pH 5.0–6.5 and 40–60 °C (Olivares-Illana et al. 2002). Inulosucrase has previously been reported in lactic acid bacteria, such as Lactobacillus johnsonii NCC 533, with optimum conditions at pH 4.5–7.0 and 55 °C (Anwar et al. 2008) Lactobacillus gasseri, Leuconostoc citreum CW28 and Lactobacillus reuteri (Peña-Cardeña et al. 2015). While levansucrase has been reported in Bacillus licheniformis, Bacillus subtilis, Brenneria goodwinii, Bacillus amyloliquefaciens, Bacillus velezensis and Clostridium acetobutylicum (Xu et al. 2021).

The experiments on endophytic bacteria co-inoculation indicated that inulinase digested inulin, breaking it into small units of fructooligosaccharides and monosaccharide (fructose); while levansucrase displayed hydrolysis activity of sucrose in an initial step and continuously demonstrated transfructosylation for polysaccharide production, e.g., inulin or levan. Inulinase produced the substrate (fructose) for levansucrase; thus, levansucrase could play a role in the function of transfructosylation, as evidenced by the enzyme detection at 12 h in all co-culture compared with single culture (Fig. 5). The product of levansucrase (levan) was a substrate of inulinase, resulting in high activity at 36 h in co-culture (Fig. 5b, d). The results could explain the relative functions between inulinase and inulosucrase (levansucrase) which were formed in plants for inulin production.

Fructans are used as reserve carbohydrate in plants, stored in cell vacuoles; their production is induced under a biotic stress via, high light, cold and drought (Hernandez and Banguela 2006). The pathway of inulin synthesis involves in 1-SST (sucrose:sucrose 1-fructosyltransferases, EC 2.4.1.99) 1-FFT (fructan:fructan 1-fructosyltransferase, EC 2.4.1.100) and 1-FEH (fructan 1-exohydrolases or inulinase, EC 3.2.1.153). Moreover, fructans in the levan and graminan form produced by these enzyme groups have a specific linkage of polymer (Van den Ende et al. 2004). Jerusalem artichoke first produces inulin in the leaves and stem and it subsequently accumulates in the tuber under normal conditions, with less inulin produced under drought. The 1-SST produced 1-ketoses from sucrose received from carbohydrate transport metabolites or 1-FEH product. During 1-ketoses synthesis, 1-FFT utilised 1-ketoses to produce linear fructans type (Beck 2017). The 1-FEH hydrolyzed terminal fructose from fructans which might be in the plant stem or node to generate sucrose for 1-SST (Roy et al. 2007). In this study, the relative quantification of gene expression in Jerusalem artichoke was determined in leaves during 65 days of planting (half of harvest time) to evaluate gene induction from the endophytic bacteria compared with control, without inoculation. The results showed that the 1-FFT genes expressed constitutively in an early state of the plant as the expression was low, indicating slight difference from the control. However, R. aquimaris 3.13 and B. velezensis 5.18 induced the 1-FFT gene at 42 and 65 days of inoculation; this may have led to plant growth promotion. The 1-SST and 1-FEH expressed at the early stage and were induced by B. velezensis 5.18 at 65 days of inoculation. It is possible that the endophytic bacteria performing inulin synthesis (inulosucrase or levansucrase) may have roles in producing intermediate metabolites, such as sucrose, fructose or levan which were inducers to induce the major genes for an inulin synthesis pathway in the plant. 1-FEH, as inulinase, degraded oligosaccharides to small units of saccharides for growth and responded to environments; this led to plant growth promotion under normal condition and drought. This work showed evidence of endophytic bacteria with functions to promote plant growth, especially inducing yield (inulin) via functions of inulinase and inulosucrase between plants and bacteria. The advantages of these endophytic bacteria are plant growth-promoting bacteria for fructan production; another is their enzyme production which can use in fructose production from inulinase (Prangviset et al. 2018), fructooligosaccharide as prebiotics from levansucrase (Phengnoi et al. 2020).

Acknowledgements

This work was supported by Office of National Higher Education Science Research and Innovation Policy Council under Program Management Unit-B (Project B05F630053); and also, was supported by Salt-tolerant Rice Research Group, Khon Kaen University, Thailand.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest in the publication.

Contributor Information

Sumolnat Khamwan, Email: togreatter@hotmail.com.

Sophon Boonlue, Email: bsopho@kku.ac.th.

Wiyada Mongkolthanaruk, Email: wiymon@kku.ac.th.

References

  1. Anwar MA, Kralj S, van der Maarel MJEC, Dijkhuizen L. The probiotic Lactobacillus johnsonii NCC 533 produces high-molecular-mass inulin from sucrose by using an inulosucrase enzyme. Appl Environ Microbiol. 2008;74:3426–3433. doi: 10.1128/AEM.00377-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ayyachamy M, Khelawan K, Pillay D, Permaul K, Singh S. Production of inulinase by Xanthomonas campestris pv phaseoli using onion (Allium cepa) and garlic (Allium sativum) peels in solid state cultivation. Lett Appl Microbiol. 2007;45:439–444. doi: 10.1111/j.1472-765X.2007.02222.x. [DOI] [PubMed] [Google Scholar]
  3. Beck RHF. Statistic thermodynamic analysis of fructans—Part 4: modeling inulin biosynthesis as anon-equilibrium thermodynamic process. Sugar Ind. 2017;142:206–211. doi: 10.36961/si18245. [DOI] [Google Scholar]
  4. Das D, Bhat MR, Selvaraj R. Review of inulinase production using solid-state fermentation. Ann Microbiol. 2019;69:201–209. doi: 10.1007/s13213-019-1436-5. [DOI] [Google Scholar]
  5. Derycke DG, Vandamme EJ. Production and properties of Aspergillus niger inulinase. Chem Technol Biotechnol. 1984;34:45–51. doi: 10.1002/jctb.280340108. [DOI] [Google Scholar]
  6. Elyachioui M, Horeiz JP, Taillez R. General properties of extracellular bacterial inulinase. J Appl Bacteriol. 1992;73:514–519. doi: 10.1111/j.1365-2672.1992.tb05014.x. [DOI] [Google Scholar]
  7. Fang G, Tong Z, Zhenming C, Jun S, Jing L, Xianghong W. Purification and characterization of extracellular inulinase from a marine yeast Pichia guilliermondii and inulin hydrolysis by the purified inulinase. Biotechnol Bioproc E. 2008;13:533–539. doi: 10.1007/s12257-007-0177-7. [DOI] [Google Scholar]
  8. Flavio T, Vanessa FO, Maria AMC, Marilia G. Effects of different carbohydrate sources on fructan metabolism in plants of Chrysolaena obovata grown in vitro. Front Plant Sci. 2015;6:1–13. doi: 10.3389/fpls.2015.00681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Han YW. Microbial levan. Adv Appl Microbiol. 1990;35:171–194. doi: 10.1016/s0065-2164(08)70244-2. [DOI] [PubMed] [Google Scholar]
  10. Hardoim PR, van Overbeek LS, Berg G, Pirttilä AM, Compant S, Campisano A, et al. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol Mol Biol Rev. 2015;79:293–320. doi: 10.1128/MMBR.00050-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hellemans J, Mortier G, Paepe AD, Speleman F, Vandesompele J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007;8:R19. doi: 10.1186/gb-2007-8-2-r19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Man S, Taohua L, Yuan Y, Yingying L, Long M, Fuping L. The roles of inulin-type fructans. Carbohyd Polym. 2021;252:117–155. doi: 10.1016/j.carbpol.2020.117155. [DOI] [PubMed] [Google Scholar]
  13. Namwongsa J, Jogloy S, Vorasoot N, Boonlue S, Riddech N, Mongkolthanaruk W. Endophytic bacteria improve root traits, biomass and yield of Helianthus tuberosus L. under normal and deficit water conditions. J Microbiol Biotechnol. 2019;29:1777–1789. doi: 10.4014/jmb.1903.03062. [DOI] [PubMed] [Google Scholar]
  14. Olivares-Illana V, Wacher-Rodarte C, Le Borgne S. Characterization of a cell-associated inulosucrase from a novel source: A Leuconostoc citreum strain isolated from Pozol, a fermented corn beverage of Mayan origin. J Ind Microbiol Biot. 2002;28:112–117. doi: 10.1038/sj/jim/7000224. [DOI] [PubMed] [Google Scholar]
  15. Öner ET, Hernández L, Combie J. Review of levan polysaccharide: from a century of past experiences to future prospects. Biotechnol Adv. 2016;34:827–844. doi: 10.1016/j.biotechadv.2016.05.002. [DOI] [PubMed] [Google Scholar]
  16. Pandey A, Soccol CR, Selvakumar P, Soccol VT, Krieger N, Jose D. Recent developments in microbial inulinases, its production, properties and Industrial applications. Appl Biochem Biotech. 1999;81:35–52. doi: 10.1385/abab:81:1:35. [DOI] [PubMed] [Google Scholar]
  17. Peña-Cardeña A, Rodríguez-Alegría ME, Olvera C, Munguía AL. Synthesis of fructooligosaccharides by IslA4, a truncated inulosucrase from Leuconostoc citreum. BMC Biotechnol. 2015;15:2. doi: 10.1186/s12896-015-0116-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Phengnoi P, Charoenwongpaiboon T, Wangpaiboon K, Klaewkla M, Nakapong S, Visessanguan W, Ito K, Pichyangkura R, Kuttiyawong K. Levansucrase from Bacillus amyloliquefaciens KK9 and Its Y237S variant producing the high bioactive levan-type fructooligosaccharides. Biomolecules. 2020;29:692. doi: 10.3390/biom10050692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Porras-Domínguez JR, Ávila-Fernández A, Miranda-Molina A, Rodríguez-Alegría ME, Munguía AL. Bacillus subtilis 168 levansucrase (SacB) activity affects average levan molecular weight. Carbohyd Polym. 2015;132:338–344. doi: 10.1016/j.carbpol.2015.06.056. [DOI] [PubMed] [Google Scholar]
  20. Prabhjot KG, Arun DS, Rajesh KH, Prabhjeet S. Effect of media supplements and culture conditions on inulinase production by an actinomycete strain. Bioresour Technol. 2003;87:359–362. doi: 10.1016/S0960-8524(02)00262-6. [DOI] [PubMed] [Google Scholar]
  21. Prangviset K, Songpim M, Yodsuwan N, Wannawilai S, Dejsungkranont M, Changlek P, Sirisansaneeyakul S. Fructose production from Jerusalem artichoke using mixed inulinases. Agric Nat Resour. 2018;52:132–139. doi: 10.1016/j.anres.2018.08.001. [DOI] [Google Scholar]
  22. Roy KL, Vergauwen R, Cammaer V, Yoshida M, Kawakami A, et al. Fructan 1-exohydrolase is associated with flower opening in Campanula rapunculoides. Funct Plant Biol. 2007;34:972–983. doi: 10.1071/FP07125. [DOI] [PubMed] [Google Scholar]
  23. Saengkanuk A, Nuchadomrong S, Jogloy S, Patanothai A, Srijaranai S. A simplified spectrophotometric method for the determination of inulin in Jerusalem artichoke (Helianthus tuberosus L.) tubers. Eur Food Res Technol. 2011;233:609–616. doi: 10.1007/s00217-011-1552-3. [DOI] [Google Scholar]
  24. Shen J, Zhang R, Li J, Tang X, Li R, Wang M, et al. Characterization of an exo-inulinase from Arthrobacter: a novel NaCl-tolerant exo-inulinase with high molecular mass. Bioengineered. 2015;6:99–105. doi: 10.1080/21655979.2015.1019686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shi Q, Hou Y, Xu Y, Mørkeberg Krogh KBR, Tenkanen M. Enzymatic analysis of levan produced by lactic acid bacteria in fermented doughs. Carbohyd Polym. 2019;208:285–293. doi: 10.1016/j.carbpol.2018.12.044. [DOI] [PubMed] [Google Scholar]
  26. Valcheva R, Koleva P, Martinez I, Walter J, Ganzle MG, Dieleman LA. Inulin-type fructans improve active ulcerative colitis associated with microbiota changes and increased short-chain fatty acids levels. Gut Microbes. 2019;10:334–357. doi: 10.1080/19490976.2018.1526583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Van den Ende W, De Coninck B, Van LA. Plant fructan exohydrolases: a role in signaling and defense? Trends Plant Sci. 2004;9:523–528. doi: 10.1016/j.tplants.2004.09.008. [DOI] [PubMed] [Google Scholar]
  28. Waterhouse AL, Chatterton NJ. Glossary of fructan terms. In: Suzuki M, Chatterton JN, editors. Science and technology of fructans. Boca Raton: CRC Press; 1993. pp. 1–7. [Google Scholar]
  29. Xu M, Zhang L, Zhao F, Wang J, Zhao B, Zhou Z, Han Y. Cloning and expression of levansucrase gene of Bacillus velezensis BM-2 and enzymatic synthesis of levan. Processes. 2021;9(2):317. doi: 10.3390/pr9020317. [DOI] [Google Scholar]
  30. Yokota A, Yamauchi O, Tomita F. Production of inulotriose from inulin by inulin degrading enzyme from Streptomyces rochei. Lett Appl Microbiol. 1995;21:330–333. doi: 10.1111/j.1472-765X.1995.tb01072.x. [DOI] [Google Scholar]
  31. Yoshida M. Fructan structure and metabolism in overwintering plants. Plants. 2021;10:933. doi: 10.3390/plants10050933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang T, Chi Z, Zhao CH, Chi ZM, Gong F. Bioethanol production from hydrolysates of inulin and the tuber meal of Jerusalem artichoke by Saccharomyces sp. Bioresource Technol. 2010;101:8166–8170. doi: 10.1016/j.biortech.2010.06.013. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES