Identification and genetic diversity of Alternaria species recovered from the air of Ahvaz city, the Southwestern part of Iran

Abstract

The Alternaria genus has pathogenic, endophytic, and saprobic characteristics. Alternaria genus causes respiratory diseases, fungal allergenicity and the production of mycotoxin in food. Ahvaz city is one of the areas where the presence of dust and high humidity cause the growth and spread of fungal species in the air. Identification of Alternaria species is difficult based on morphology solely. For the first time in Ahvaz, the classification of this fungus was performed using ITS region, alta1 gene, and morphology. For the identification of Alternaria isolates in the Ahvaz city air using morphological and molecular characteristics, potato dextrose agar (PDA) media were used to culture 40 Alternaria isolates recovered from the Ahvaz city air. Afterward, the appearance of the colonies was examined. The DNAs of the isolates were extracted and amplified using the specific primers of the ITS and, Alt a1 regions. The amplified DNA products were sequenced. Then, they were compared with the sequences in the NCBI GeneBank. Based on the morphological results, the isolates included four different species and A. alternata had the highest frequency. Alt a1 gene was present in all the isolates of Alternaria species recovered in our research. Finally, identifying the varieties of Alternaria species based on morphological characteristics as well as ITS or Alt a1 regions is useful but difficult.

Introduction

Allergic rhinitis and bronchial asthma are very widespread nowadays [1-3]. Therefore, the asthma is the eighth cause of referring to doctors in the USA [4]. Various researches have demonstrated that fungi have a key role in respiratory diseases. Fungal spores are the major allergens for the development of asthma [5,6]. Fungi are the causes of 20 to 30% of type I sensitization reactions throughout the world [7]. It has been reported that fungal allergies have a prevalence range of 4.7-24% in Iran [8,9]. Airborne fungi including Cladosporium, Alternaria, Curvularia, Epicoccum, Penicillium, Fusarium, Botrytis, and Aspergillus are filamentous fungi which cause allergic respiratory diseases [10-12]. Alternaria species can be found in indoor and outdoor air [13]. This genus has a high variety of saprobic, endophytic, and pathogenic charectristics. Moreover, it has been reported that Alternaria is the most frequent cause of allergic asthma among patients in the third or fourth decade of life [9]. A few of the Alternaria species recovered from the air of Tehran are A. tenuissima, A. solani, A. alternata, A. porri, and A. brassicicola [14]. Taxonomy studies have organized different species of the genus Alternaria in several groups (such as the infectoria, the tenuissima, and the alternata groups) according to their sporulation pattern and conidium morphology [15]. However, the Alternaria complex is currently divided into twenty-six sections [16]. Previous studies have shown that Alternaria allergens are autonomous risk factors for asthma progress in children and young adults. In more severe cases, they are even associated with respiratory arrest [17,18]. It has also been found that the glycoprotein Alt a1 is a principal allergenic fraction of Alternaria and its molecular weight is 30 kDa (dimer). This glycoprotein has a unique β-barrel fold which is cysteine-linked and is detected in the cytoplasm of mycelia and spores. However, the role of Alt a1 in the cell has not been detrmined yet [19-21]. In more than 95% of Alternaria-sensitized individuals, Alt a1 results in IgE antibody responses [22].

Objectives

The first goal of the present study was to determine which Alternaria species exist in the indoor and outdoor air of Ahvaz city in the southwest of Iran by using morphological characteristics and sequencing the nuclear ribosomal DNA with the internal transcribed spacer (ITS) region. The second aim of the current study was to investigate the phylogenetic relationships as well as the molecular diversity of the Alternaria isolates in Ahvaz city by sequencing the Alt a1 gene.

Materials and methods

Alternaria isolates, morphological characterization, DNA extraction, PCR, nucleotide sequencing, and alignment

Air sampling was performed by Quick Take 30 (Quick Take 30, UK) in accordance with the method of kiasat et al. [23] After sampling, the Petri dishes containing Potato dextrose agar (PDA) media (Biolife, Italy) were closed and sent to the medical mycology laboratory at the Ahvaz Jundishapur University of Medical Sciences all Petri dishes were incubated at 25°C up to 7 days. after that, from suspected colonies to Alternaria sp, a direct smear was taken and recultured after confirmation of obtaining pure colonies. Re-culture was done until a pure colony of Alternaria sp was obtained. After purring, all Alternaria sp were stocked in sterile water vials and maintained at room temperature for further study. In the current research, forty Alternaria isolates were recovered from the air of five different locations in Ahvaz city. Afterward, they were confirmed according to their morphological features. Potato dextrose agar media were used to culture all the isolates [24] which were then incubated for seven days. The appearance of the colonies was investigated in terms of texture and color after incubation. Slide cultures were prepared to observe sporulation and conidium morphology (size, shape, septation, and ornamentation). Sabouraud dextrose agar (SDA) media (Merck, USA) were used to culture the isolates in order to identify their molecular structures at the species level. The phenol-chloroform method was used in order to extract the genomic DNAs of the isolates. All isolates were subcultured on SDA and incubated at 25°C for 7 days. Then, approximately, 300 mg of Fungal elements were poured into microtubes containing 300 μl of lysis buffer collected SDS with EDTA and 50 mg glass bead (Sigma-Aldrich, USA) and were put at -20°C for 24 h. After extracting the supernatant, add an equal amount of supernatant, phenol, and chloroform/isoamyl alcohol (Merck, Germany) in order to denature proteins. And next, to precipitate DNA adding an equal amount of supernatant, and isopropanol (Merck, Germany) were added and were put at -20°C for 10 Minutes. After centrifuging at 4°C for 10 Minutes, were exited isopropanol. And were washes of DNA with 150 microliters of ethanol (Merck, Germany). Finally, ethanol was removed, and DNA dried and then 50 microliters of sterile distilled water into a microtube containing DNA and was put at -20°C for further study. Universal primers ITS1 and ITS4 were employed to amplify the ITS1 and ITS2 regions of the isolates of Alternaria (Table 1). A C100 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA) was used for amplification. The total volume of a single reaction was 25 μL including 3 μL template DNA, 7.5 μL distilled water, 12.5 μL Master Mix (Sigma-Aldrich, St. Louis, MO, USA), and 1 μL of each primer. The PCR reaction was conducted with the following conditions: initial denaturation at 94°C for 5 min; 35 cycles including denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 45 s; and the final extension at 72°C for 7 min. 1% (w/v) agarose gel electrophoresis in 1 × TBE buffer (Sigma-Aldrich) was used to detect the PCR products. The genomic DNAs recovered from the Alternaria isolates were utilized as templates in order to detect the Alt a1 gene. The reaction mixtures comprised 12.5 μL Master Mix, 7.5 μL distilled water, 1 μL Alt-forward and Alt-reverse primers (Table 1), and 3 μL template DNA. The PCR procedure comprised an initial denaturation cycle at 95°C for 5 min, 30 cycles (including denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 5 min), and a final extension at 72°C for 5 min. 1% (w/v) agarose gel electrophoresis in 1 × TBE buffer was employed to analyze the PCR products. All the PCR products were delivered to CinnaGen Biotechnology company for sequencing. The Finch TV program was employed in order to edit the obtained nucleotide sequences. The genomic data of the NCBI GeneBank were used for comparing the sequence alignment. According to information recorded about the Alt a1 and ITS1 genes in the NCBI database, Sequences with high similarity (99-100%) were selected and the homology of the mentioned genes among Alternaria species was isolated using Molecular Evolutionary Genetics Analysis software version 6 (MEGA6) according to dendrogram drawing the result was studied and analyzed.

Table 1.

The primers utilized for PCR amplification

Amplified sequence	Primer name	Primer sequence (5’ > 3’)
ITS1/ITS2 region	ITS1	TCCGTAGGTGAACCTGCGG
	ITS4	TCCTCCGCTTATTGATATGC
Alt a1 gene	Alt-forward	ATGCAGTTCACCACCATCGC
	Alt-reverse	ACGAGGGTGAYGTAGGCGTC

Phylogenetic analysis

The phylogenetic analyses were conducted using the Alt a1 gene and ITS. The MEGA software version 6.0 (MEGA, Tempe, AZ, USA) was utilized to draw the phylogenetic trees. Reference isolates have been used to draw phylogenetic trees to understand the evolutionary relationships. In order to draw tree of ITS, we used one Reference isolate, kc906251 Alternaria alternata, and to draw the tree of Alt a1, we used Reference isolates including Alternaria alternata strain src1nk21, A. arborescens Alt a1, A. cnerate Alt a1, A. sonchi Alt a1, A. capsic major allergen Alt a1, A. dauci Alt a1, A. tagtica major Alt a1 and A. brassicae Alt a1.

Statistical analysis

Descriptive statistics were used to describe the basic features of our study’s data including frequencies, percentages, and mean by used SPSS ver. 22.

Results

Morphological analysis

The forty Alternaria isolates were divided into four groups based on morphological observations (Figure 1). Group 1 comprised colonies that were light and dark green in color and felty and woolly in texture. Group 1 usually had small conidia with ellipsoidal or ovoid shapes and with or without several longitudinal or oblique septa. These features were identical to those of A. alternata.

Figure 1.

The morphological characteristics of the Alternaria species recovered from the air of Ahvaz city. A: A. alternata; B: A. tenuissima; C: A. brassicae-pekinensis; D: A. obovoidea.

Group 2 comprised colonies that were pale olive gray and olive gray in color and usually had a very thin white margin (1 to 2 mm). In addition, they were generally cottony and woolly in texture. Conidium is ellipsoidal tapering to the beak which is up to half of its length and often shorter. These features were identical to those of A. tenuissima.

Conidia consist of non-beaked, simple, or occasionally branched chains. Group 3 was comprised of colonies which were mostly epiphyllous, effuse, and hairy and were grey and dark blackish brown in color. These characteristics were similar to those of Alternaria brassicae-pekinensis.

Group 4 was comprised of A. obovoidea. The colonies in this group were dark olive gray in color. The conidia in this group were non-beaked and obovoid.

According to the morphology and growth patterns of the colonies, of the 40 Alternaria isolates obtained from the Ahvaz city air, 28 (70%) were identified as A. alternata, 5 (12.5%) were Alternaria brassicae-pekinensis, 4 (10%) were A. tenuissima, and 3 (3.5%) were A. obovoidea. Based on the latest division of Alternaria, A. tenuissima and A. alternata are in the Alternata section, whereas Alternaria brassicae-pekinensis and A. obovoidea are in the Ulocladioides section. Therefore, 80% and 20% of the isolates belonged to the Alternata and Ulocladioides sections, respectively.

Molocular analysis

Nuclear ITS

PCR was conducted on the rDNA ITS regions of the 40 Alternaria isolates. MEGA software (version 6.0) was used to align the ITS sequences. Besides the sequences obtained in the current research, the alignment comprised the Alternaria alternata (accession no: KC906251) ITS sequence acquired from the GenBank. The alignment of these sequences showed variability in the ITS. The phylogenetic tree of the ITS sequences was drawn using the neighbor-joining analysis (Figure 2). The ITS sequence analysis of all the isolates on the NCBI BLAST showed that all of them with similar identities could be related to A. alternata, A. tenuissima, A. brassicae, A. infectoria, and A. porri.

Figure 2.

The phylogenetic tree drawn using the neighbor-joining analysis of the ITS of the Alternaria species in the MEGA Software (version: 6.0). The values correlated with the branches demonstrate the degree of bootstrap support signified as a percentage of 1000 bootstrapped trees where the corresponding clades exist. The short length of the branches indicates the similarity of the isolates. The strain numbers follow the species.

Alt a1

The sequences of the Alt a1 gene in the Alternaria isolates were compared with those in the NCBI data base by employing the Basic Logical Alignment Search Tool (BLAST). The phylogenetic relationships between the Alternaria isolates were analyzed based on the sequences of the Alt a1 gene. Furthermore, the phylogenetic dendrogram of the sequences of the Alt a1 gene was drawn using the sequences stored in the GeneBank data base as well as the MEGA 6 software (Figure 3). It was found that all the examined isolates had the Alt a1 gene. The sequences of the Alt a1 gene on the isolates examined in the present study showed that they had similar identities in some Alternaria species such as A. infectoria, A. alternata, A. mali, and A. tenuissima.

Figure 3.

The phylogenetic tree for the Alt a1 gene sequences of the Alternaria species and the reference isolates of the Alternaria species. The bootstrap support values have 1000 replicates. The strain numbers follow the species.

Discussion

The current study was the first research on the morphological and molecular characteristics of the Alternaria species in the air of Ahvaz city located in the southwestern part of Iran. Based on the morphological characteristics, two Alternaria sections (Alternata and Ulocladioides) and four Alternaria species (A. obovoidea, A. alternata, A. brassicae-pekinensis, and A. tenuissima) were obtained. A. alternata was the dominant species among the identified species in the air of Ahvaz. Previous studies have mentioned A. alternata as the dominant species associated with diseased crops or plants which is consistent with the findings of the present research [25,26]. The reason for the similarity between the results of previous studies and the findings of the current study could be wind blow on farms and/or harvesting infected crops that can increase the concentration of A. alternata spores in the air. In contrast to the results of the current study, Rahimloo & Ghosta and Hashemloo reported that A. tenuissima had the highest association with cabbage and Prunus trees, respectively, in the northwest of Iran. The reason for the inconsistency between their results and those of the current study could probably be their focus only on morphological characteristics and/or geographical regions [27,28].

The phylogenetic relationships among the Alternaria isolates were examined according to ITS and Alt a1 sequence analysis. The analyses demonstrated little variation in the sequences of the ITS regions. In addition, the comparison of the ITS sequences on the available data of the GeneBank did not differentiate the Alternaria species. This study showed that some of Alternaria species such as A. brassicae, A. alternata, A. porri, A. infectoria, and A. tenuissima had the same sequences. This finding indicates that the ITS region does not have a high discriminatory power for the species of Alternaria. This standpoint has been confirmed by former researches which showed small differences among the ITS sequences of Alternaria species [29-31].

In this study, the presence of the Alt a1 gene was investigated among 40 Alternaria isolates recovered from the air of Ahvaz. The results of the current research indicated the presence of the Alt a1 gene in all the isolates of Alternaria. Previous studies confirm this finding [14,29]. The differences in the sequences of the mentioned gene lead to variations in the structure of the relevant protein and alter the allergic responses to it. This indicates the importance of strains in fungal pathogenicity and allergenicity. The results of the present study emphasize the importance of Alternaria species as one of the important groups of aeroallergenic fungi. These results indicated the need for further studies on strains obtained from different geographical locations and showed that the evaluation of the role of Alternaria species and a1 Alt protein in the etiology of asthma and allergies can be effective in strategies for the Control and treatment of allergies and infections related.

This study would have achieved a better outcome if we had worked on more Alternaria isolates. But it is difficult to obtain a pure isolate of Alternaria from the air and need to subculture it again.

In conclusion, based on the morphological analyses in the current research, four species of Alternaria (i.e. A. obovoidea, A. tenuissima, A. brassica-pekinensis, and A. alternata) were observed in the air of Ahvaz city. A. alternata was more frequent in the Ahvaz city air than the other species of Alternaria. Moreover, it is not appropriate to identify different species of Alternaria using ITS sequences. Furthermore, it was found that the Alt a1 gene existed in all the investigated Alternaria species and that a little variation in the sequence of the Alt a1 gene can lead to different allergenic reactions in patients with allergic asthma. Finally, identifiying the varieties of Alternaria species based on morphological and molecular (ITS or Alt a1 regions) characteristics is very difficult but useful.

Disclosure of conflict of interest

None.