Skip to main content
NCBI home page
Cytotechnology logoLink to Cytotechnology
. 2022 Aug 26;74(5):539–547. doi: 10.1007/s10616-022-00543-1

Protective effect of selenium on vincristine-induced peripheral neuropathy in PC12 cell line

Davod Jafari 1,2,#, Seyed Sadegh Eslami 1,2,#, Sara Malih 3, Parastoo Tarighi 2,✉
PMCID: PMC9525541  PMID: 36238267

Abstract

Vincristine-induced peripheral neuropathy (VIPN) is the main side effect and major reason for neuropathic pain in cancer survivors treated with vincristine. Vincristine, a chemotherapeutic antimitotic drug, is used frequently in combination chemotherapy. The primary purpose of the current study was to assess the protective effect of sodium selenite (SSe) on VIPN in vitro. Cytotoxicity effects of vincristine were evaluated using PC12 cells as a neuronal model. The cell culture studies were conducted in three groups based on the various treatments, including vincristine, SSe, and co-exposure to both compositions. Cell viability and cell cycle analyses were performed using MTT assay and flow cytometry, respectively. The level of mRNA expression of Bax and Bcl-2 was determined using qRT-PCR. According to the results, vincristine decreased the survival rate of PC12 cells. After 24 and 48 h exposure to different concentrations of vincristine (0.1–20 μΜ), the survival rate of PC12 cells decreased as compared to the control group. The results showed that treatment with 5 μΜ of vincristine resulted in apoptosis of PC12 cells. Interestingly,co-incubation of these cells with SSe significantly reduced the cell damage induced by vincristine. Furthermore, vincristine induced the inhibition of the G2 phase in PC 12 cells, and using SSe in combination with vincristine eliminated the inhibition of the cell cycle in the G2 phase. Briefly, our in vitro preliminary study showed that SSe might protect PC12 cells from vincristine-induced peripheral neuropathy during chemotherapy.

Keywords: Vincristine, Selenium, VIPN, Apoptosis, Neuropathy

Introduction

Vinca alkaloids, a group of secondary metabolites isolated from Catharanthus roseus or Madagascar periwinkle plant, have been prescribed in diabetic patients to prevent the side effects of hypoglycemia from ancient times. Later, it is discovered that some vinca alkaloids result in suppressive activity on murine bone marrow, as well as longevity in rats with acute lymphoblastic leukemia (ALL) (Johnson et al. 1963). Vincristine, a chemotherapeutic antimitotic drug, is used frequently in combination chemotherapy for leukemia, lymphomas, and other cancers (Courtemanche et al. 2015). Moreover, it is the most commonly prescribed vinca alkaloid in children, which often has dose-limiting neurotoxicity. Vincristine leads to severe motor and peripheral sensory neuropathies, thus reduction or withdrawal of therapy affects the patient's quality of life (Starobova and Vetter 2017).

Peripheral neuropathy is one of the most frequent side effects of antineoplastic agents, such as vincas, taxanes, and platins. Vincas bind with the β-tubulin subunit of microtubules, inhibit the formation of microtubules, and disrupt the microtubular axonal transport system (Zajączkowska et al. 2019). Vincristine inhibits both mitotic spindles and axonal microtubules that may induce axonopathy, known as a slowly progressive axonal sensorimotor neuropathy (Lobert et al. 1996; Legha 1986). Some other mechanisms for vincristine-induced peripheral neuropathy (VIPN) have been suggested in cellular and animal models (Carozzi et al. 2015; Boyette-Davis et al. 2015); however, the underlying mechanism has not yet been fully elucidated. Numerous experiments have been performed, primarily in adults, to determine whether drugs can be prescribed concurrently with chemotherapeutic agents to hinder or treat VIPN. Unfortunately, the results have largely been unimpressive. It is observed that duloxetine is the only drug to be effective for the painful chemotherapy-induced neuropathy (CIPN) caused by paclitaxel or oxaliplatin (Hershman et al. 2014).

Selenium, an important antioxidant in the diet, is incorporated at the active sites of several enzymes. It acts as an integral part of glutathione-dependent enzymes that is essential in biological systems, including the cellular antioxidant system, which uses the glutathione redox cycle to fight oxidative stress in diseases such as Diabetes Mellitus (DM) (Tapiero et al. 2003).

It has recently been discovered that selenium can reduce the injury resulted from ischemia–reperfusion injury (IRI). Antioxidants and antioxidant enzymes play a major role in reducing cellular damage caused by IRI. Selenium is an essential trace element, showing antioxidant and neuroprotective effects (Beck et al. 2007). Several experimental data support the protective role of selenium against hypertension in IRI. Researchers have shown the beneficial effects of selenium on the IRI of peripheral nerves (Erbil et al. 2008; Milcan et al. 2004). Selenium is better retained in the brain in conditions of deficiency than other organs (Behne et al. 1988; Nakayama et al. 2007). Besides, selenoprotein M is found at the highest level in the brain (Gromer et al. 2005). Selenoprotein M, with endoplasmic reticulum (ER) localization signal peptide, accumulates in the ER. Further, changes in the level of selenoprotein M have been observed in Perinilin-2 overexpressing mouse models of Alzheimer's disease (AD) (Steinbrenner and Sies 2013) and also in AD patients (Hwang et al. 2005). Furthermore, the possible neuroprotective role of selenoprotein M in the hippocampal and cerebellar astrocyte cell lines has been identified (Kryukov et al. 2003). A recently published article demonstrated that diphenyl diselenide, an organic selenium compound with antioxidant effects, diminishes diabetic peripheral neuropathy (DPN) through stimulating of Nrf2/Keap1 signaling mechanism in rat models of DPN (Wang et al. 2020). Another study revealed that Melatonin and Selenium ameliorate Docetaxel-induced peripheral neuropathic pain and oxidative neurotoxicity in mouse models (Ertilav et al. 2020).

Since vincristine treatment severely affects the peripheral nerves and deteriorates the quality of patients' life, there have been many studies on the co-administration of other combinations with this type of neuropathy-inducing drugs; however, the results are not promising. Therefore, since selenium is a potent antioxidant and its protective effects on peripheral and central nerves have been revealed in various studies, the main objective of the current study is to determine the impact of selenium on PC12 cells as a neural cell model treated with vincristine.

Materials and methods

Cell culture

Rat adrenal phaeochromocytoma (PC12) cell line was purchased from the cell bank of Pasteur Institute of Iran (NCBI). Cells were incubated in DMEM (Biowest, France) containing 10% fetal bovine serum (FBS; Gibco, Invitrogen) and 1% penicillin–streptomycin (Biowest, France) at 37 °C with 5% CO2-humidified air.

MTT assay

The MTT colorimetric assay was conducted for cell viability. Cells were seeded (3 × 103 cells/well) in 96-well plates and incubated in DMEM for 24 h. The first plate was treated with increasing concentrations of vincristine diluted in DMEM (0.1–20 μΜ); the second plate was treated with different concentrations of sodium selenite (SSe) diluted in DMEM (0.1–10 μΜ). After 24 and 48 h of incubation, 10 µl MTT solution (Sigma-Aldrich) was added to each well to achieve a final concentration of 5 mg/ml and was incubated for 3 h. Then, the cell culture supernatant was discarded, 100 μl DMSO (Sigma-Aldrich) was added to each well, and the plate was shaken for 5 min for dissolution of the formazan crystals. The absorbance was detected at 570 nm by a plate reader spectrophotometer. Combination treatments consisted of a 24 and 48 h incubation in DMEM with three doses of vincristine (1, 5, 10 μM) and SSe (0.1, 0.2, 0.4 μM) as described in the results section. MTT assay was done in triplicate for every treatments.

RNA extraction, cDNA synthesis, and quantitative RT-PCR

Bax and Bcl-2 gene expression levels were analyzed in the PC12 cell line. Cells were seeded on 6 well tissue culture plates and exposed to vincristine (5 μM), SSe (0.4 μM), and a combination of vincristine and SSe (5 μM + 0.4 μM). After 24 h of treatment, the cells were trypsinized, and total RNA was isolated using the Trizol RNA isolation reagent (Sinaclone, Iran). RNA concentration and quality were evaluated by the NanoDrop spectrophotometer (Thermo Scientific NanoDrop™). cDNA templates were synthesized from 500 ng of total RNA using the PrimeScript RT reagent Kit (PrimeScript, Takara, Japan). Quantitative RT-PCR reactions were used to assess Bax and Bcl-2 mRNA expression levels using the RealQ plus 2 × Master Mix Green Assay (Ampliqon, Denmark) following the manufacturer's instructions. Normalization was carried out using GAPDH. Relative expression was reported by the 2−ΔΔCT method. The description of the primer pairs used in this study is listed in Table 1.

Table 1.

Primer sequences for qRT- PCR

Gene Forward Reverse Accession number
Bax GGACGAACTGGACAGTAACATGG GCAAAGTAGAAAAGGGCGACAAC NM_001291428.1
Bcl-2 ATCGCCCTGTGGATGACTGAG CAGCCAGGAGAAATCAAACAGAGG NM_000633.3
GAPDH GAAGGTGAAGGTCGGAGTCAAC CAGAGTTAAAAGCAGCCCTGGT NM_001357943
Open in a new tab

Analysis of cell cycle distribution by Flow cytometry

After different treatments, PC12 cells were trypsinized and centrifuged at 600×g for 5 min, then washed with PBS. Cell cycle distribution was assessed by fixing the cells in cold (4 °C) 70% ethanol overnight. Before analysis, 1 μl propidium iodide (PI) was added to a final concentration of 0.1 mg/ml and vortexed gently. Cells were analyzed by using the FACS caliber cytometer (Becton Dickinson, San Diego, CA, USA), and all data were acquired and evaluated by FlowJo version 10 software.

Statistical analysis

In this study, GraphPad Prism 8.0 (GraphPad Software, Inc.) was used for data analysis; they were expressed as the mean ± standard error. One-way or two-way analysis of variance (ANOVA) and Tukey's post hoc test were performed to evaluate the differences among the multiple groups. P < 0.05 was considered significant. All test carried out in triplicate.

Results

Vincristine reduces the survival rate of PC12 cells

Herein, to investigate the impact of vincristine on neuropathy, PC12 cells were treated with increasing doses of vincristine, and the cell survival rates were determined at various time intervals. A reduction in cell viability was observed in vincristine treated cells (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Cell viability assay (MTT) results of vincristine treatments on PC12 cell line at 24 and 48 h time points. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

SSe protects against the cytotoxicity induced by vincristine

Possible SSe protective effects on PC12 cells against the vincristine-induced cytotoxicity were assessed. As shown in Fig. 2a, SSe alone did not alter PC12 cell viability. Albeit, SSe (mentioned concentrations) treatment reduced the toxic effects of vincristine on PC12 cells (P < 0.01; Fig. 2b).

Fig. 2.

Fig. 2

Open in a new tab

Cell viability assay (MTT) results of SSe and SSe + vincristine treatments on PC12 cell line. a SSe treatment at 24 and 48 h time points and b different concentrations of SSe and vincristine treatment at 24 and 48 h time points. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

SSe affects apoptosis-related genes in PC12 cells and increases the Bax/Bcl-2 ratio

In order to investigate the toxic effect of vincristine on apoptosis and alleviative effect of SSe on vincristine-induced apoptosis, mRNA of two apoptosis-related genes (Bax and Bcl-2) was examined in PC12 cells. The results indicated a dramatic increase in the expression of the Bax gene in PC12 cells treated with SSe, vincristine, and the combination of the two substances. At 24 h, the expression level of Bcl-2 gene in cells pre-incubated with SSe increased significantly but decreased in the vincristine treatment group. The reduction in the Bcl-2 gene expression in treatment with the combination of two substances was statistically insignificant (Fig. 3a). The Bax/Bcl-2 ratio significantly increased compared with the control cells (Fig. 3b).

Fig. 3.

Fig. 3

Open in a new tab

Gene expression analysis results of PC12 cell line. a Bax and Bcl-2 changes in mRNA level in PC12 cells treated with SSe, vincristine and their combination as well as control group without any treatment. b The ratio of Bax/Bcl-2 gene expression level as an indicator of apoptosis in SSe, vincristine and their combination treated cells as well as control group without any treatment. (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001)

Combination of vincristine and SSe inhibits PC12 cell cycle arrest at the G2/M phase

The cell cycle distribution of SSe, vincristine, and the combination of the two substances treated PC12 cells was investigated by flow cytometry. PC12 cells were incubated with 5 μM of vincristine, 0.4 μM of SSe, and the combination of the two substances for 24 h. According to the results of the vincristine treatment, the cell population in the G2 phase increased. Concomitantly, treatment with the combination of SSe and vincristine reduced the cellular population in the G2 phase. Although vincristine reduced the cell population in phase S compared to the control group, the treatment with a combination of SSe and vincristine increased the cell population in phase S compared to the vincristine-treated group. Therefore, vincristine induced inhibition of the G2 phase in PC12 cells, and the use of SSe as an adjuvant in combination with vincristine diminished the inhibition of the cell cycle in the G2 phase (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Cell cycle diagrams of PC12 cell line treated with vincristine, their combination and control cells without any treatment

Discussion

Vincristine is a common chemotherapy drug used in a wide range of cancers. Its administration is limited due to its high side effects, especially neuropathy. VIPN is a well-recognized side effect of cancer treatments and the major reason for neuropathic pain in cancer survivors (Lavoie Smith et al. 2015). Almost all children treated with vincristine experience VIPN (Lavoie Smith et al. 2015; Mora et al. 2016; Ramchandren et al. 2009). Its prevalence and severity vary according to the types of risk factors. Common VIPN signs and symptoms include sensory, motor, and autonomic neuropathy (Courtemanche et al. 2015; Gilchrist et al. 2014; Hausheer et al. 2006). Patients typically experience numbness, tingling, and neuropathic pain that commonly affects the upper and lower limbs bilaterally. In many cases, VIPN advances slowly (Argyriou et al. 2006; Gomber et al. 2010). However, the mechanisms involved in the vincristine-induced cell death are not fully elucidated. In this study, a rat adrenal phaeochromocytoma cell line, neuronal model cell PC12, is utilized to investigate the impact of different concentrations of vincristine on the PC12 cell cycle and apoptosis, as well as the possible protective effect of SSe on vincristine treated PC12 cells.

Vinblastine (VBL) and vincristine (VCR) are the two major vinca alkaloids most widely incorporated into chemotherapy regimens. These factors bind to the β-subunit of tubulin heterodimers, inhibit the polymerization of microtubules, and divide cells in metaphase (Dumontet and Jordan 2010). Vincristine is a microtubule-interfering compound, and as a result, a cell cycle-specific agent. It destroys the formation of mitotic spindles and induces cell cycle arrest at the M phase (Carozzi et al. 2015; Sawaguchi et al. 2015). Recently, vincristine has been delivered in liposomal nanoparticles in a method called vincristine sulfate liposome injection (VSLI) and branded as Marqibo. Liposomal formulation of vincristine is developed to optimize pharmacokinetic properties, improve tumor drug targeting, and optimize dose intensity (Silverman and Deitcher 2013).

In the present study, it is indicated that vincristine induces cell death, apoptosis, and inhibition of the cell cycle in the PC12 cell line by MTT, qRT-PCR and flow cytometry. The results of present research is consistent with previous studies (Tu et al. 2013; Cuddihy and O'Connell 2003; Kung et al. 1990). The functional mechanism of vincristine does not depend on time and concentration. Tu et al. (2013) demonstrate that vincristine causes mitotic arrest and apoptosis in SH-SY5Y human neuroblastoma cells.

Data presented here demonstrate that vincristine reduces cell viability with mild to moderate toxicity in comparison to the control group; however, it is not dose- and time-dependent. This is likely due to the short incubation time in comparison to previous studies with 72 h incubation period and choosing concentrations close to each other (Tu et al. 2013). Although no other study has yet investigated the impact of vincristine various concentrations on the viability of the PC12 cells (Lin et al. 2002; Silva et al. 2006), our findings are at odds with results obtained in human neuroblastoma cell line SH-SY5Y, as well as vincristine effect on human CML K562 cell line (Souza et al. 2011), human umbilical vein endothelial cells (HUVECs), and BJ human normal fibroblasts (BJs) (Bota et al. 2019), where vincristine-induced cell death in a dose- and time-dependent manner.

Notably, sodium selenite (SSe) attenuating the detrimental effects of vincristine is selected as an anticancer and antioxidant compound as an adjuvant for vincristine. SSe MTT results indicate that in most toxic doses for cancer cell lines (Kandaş et al. 2009), it has no toxicity effect on the PC12 cells. In addition, MTT results from the combined treatment of SSe and vincristine show an increase in cell viability up to 15% at selected doses compared to vincristine treatment, indicating the protective property of SSe on vincristine toxicity in the PC12 cell line. In line with our findings, selenium has shown cytoprotective effects in previous studies (Erbil et al. 2008; Steinbrenner and Sies 2013; Kieliszek and Blazejak 2013; Loef et al. 2011). It is demonstrated that co-exposure of selenium with arsenic suppresses arsenic-induced intrinsic apoptosis pathway through improving the mTOR/Akt autophagy mechanism in PC12 cells (Rahman et al. 2018). Furthermore, the co-presence of selenium and cadmium increases cell viability and inhibits the cadmium-induced oxidative stress and apoptosis in PC12 cells (Binte Hossain et al. 2018). In the present study, the cell cycle assessment by flow cytometry reveals that vincristine arrests the cell cycle in the G2 phase, which is in line with previous studies (Tu et al. 2013), and the combination of SSe and vincristine significantly reduces the inhibitory properties of vincristine in the G2 phase.

Analyzing the mRNA levels of Bax and Bcl-2 also shows an elevation in the expression ratio of Bax to Bcl-2 genes (apoptosis marker) in vincristine treatment and a combination of two substances. Bax, Bcl-2, NF-кB, caspase 3, caspase 9, and ERK1 play crucial roles in apoptosis (Cai et al. 2000; Lemarie et al. 2006). Bcl-2 is an antiapoptotic protein incorporated in cell survival (Ola et al. 2011). Bax is a proapoptotic protein important for apoptotic signal transduction (Narita et al. 1998). The ratio of the different Bcl-2 family members has been suggested to incline a cell to either enhanced or suppressed apoptosis in response to various external stimuli (Chresta et al. 1996; Zhu et al. 2015). Therefore, alteration in the Bax/Bcl-2 ratio is a major factor in determining cell fate. Schwann cell apoptosis is one of the indicators of DPN. Yu et al. evaluated hydrogen‑rich medium (HM) effects on high glucose (HG)-induced Schwann cells apoptosis by using western blot analysis and observed a significant decrease in the ratio of Bax/Bcl-2 induced by HG in HM treated group (Yu et al. 2015). Another study conducted by Zhu et al. demonstrated that Bax/Bcl-2 ratio increases in HG-induced Schwann cells apoptosis in DPN (Zhu et al. 2018).

Eventually, although our data suggest that selenium may protect PC12 cells against vincristine-induced damage, additional research is required to determine the efficacy of the potential of SSe on preclinical models and, eventually, in patients with VIPN.

Conclusions

Challenging to the neuropathy induced by vincristine chemotherapeutic drug in cancer patients, selenium, as adjuvant in sodium selenite (Sse) form, was used here. The significant cytotoxic effect of vincristine on the non-cancerous cell line PC12 as a neural cell model was shown. Next, trying to elucidate how SSe could affect the amount of vincristine cytotoxicity effect on PC12 cells, a combined treatment of SSe and vincristine was applied. The present research results of the combined treatments showed a promising protective effect of SSe on PC12 as compared to vincristine treatments alone. These results may suggest selenium as a new agent to decrease the side effects of vincristine on PC12 cell cycle distribution induced by vincristine and a combination of the two substances.

Acknowledgements

The authors acknowledge Iran University of Medical Sciences Research and Technology support.

Author contributions

Conception and design of the study: DJ and SSE, Acquisition of data: SSE and DJ, Analysis and/or interpretation: SSE, DJ, SM, Drafting the manuscript: SM, DJ, SSE, Revising the manuscript critically for important intellectual content: PT, DJ and SM. Artwork preparation: DJ.

Funding

This study was funded by Iran University of Medical Sciences.

Data availability

Data and analyses are available from the corresponding author and first authors on request.

Code availability

Not applicable.

Declarations

Conflict of interest

Authors declare that they have no conflict of interest.

Ethical approval

This research approved by ethics committee of Iran University of Medical Sciences.

Consent to participate

Not Applicable.

Consent for publication

Not applicable.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Davod Jafari and Seyed Sadegh Eslami have equally contributed.

Contributor Information

Davod Jafari, Email: Jafari.dt@gmail.com, Email: Jafari.d@tak.iums.ac.ir.

Seyed Sadegh Eslami, Email: seyed.sadegh.eslami.1994@gmail.com, Email: Eslami.sa@iums.ac.ir.

Sara Malih, Email: malih.sarah@gmail.com, Email: s.malih@modares.ac.ir.

Parastoo Tarighi, Email: tarighi.p@iums.ac.ir.

References

  1. Argyriou AA, Polychronopoulos P, Koutras A, Iconomou G, Gourzis P, Assimakopoulos K, et al. Is advanced age associated with increased incidence and severity of chemotherapy-induced peripheral neuropathy? Support Care Cancer. 2006;14:223–229. doi: 10.1007/s00520-005-0868-6. [DOI] [PubMed] [Google Scholar]
  2. Beck J, Ferrucci L, Sun K, Walston J, Fried LP, Varadhan R, et al. Low serum selenium concentrations are associated with poor grip strength among older women living in the community. BioFactors. 2007;29:37–44. doi: 10.1002/biof.5520290104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Behne D, Hilmert H, Scheid S, Gessner H, Elger W. Evidence for specific selenium target tissues and new biologically important selenoproteins. Biochim Biophys Acta. 1988;966:12–21. doi: 10.1016/0304-4165(88)90123-7. [DOI] [PubMed] [Google Scholar]
  4. Binte Hossain KF, Rahman MM, Sikder MT, Saito T, Hosokawa T, Kurasaki M. Inhibitory effects of selenium on cadmium-induced cytotoxicity in PC12 cells via regulating oxidative stress and apoptosis. Food Chem Toxicol. 2018;114:180–189. doi: 10.1016/j.fct.2018.02.034. [DOI] [PubMed] [Google Scholar]
  5. Bota M, Fischer-Fodor E, Bochiș O-V, Cenariu M, Popa G, Blag CL, et al. Combined effect of propranolol, vincristine and bevacizumab on HUVECs and BJ cells. Exp Ther Med. 2019;17:307–315. doi: 10.3892/etm.2018.6925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Boyette-Davis JA, Walters ET, Dougherty PM. Mechanisms involved in the development of chemotherapy-induced neuropathy. Pain Manag. 2015;5:285–296. doi: 10.2217/pmt.15.19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cai X, Shen YL, Zhu Q, Jia PM, Yu Y, Zhou L, et al. Arsenic trioxide-induced apoptosis and differentiation are associated respectively with mitochondrial transmembrane potential collapse and retinoic acid signaling pathways in acute promyelocytic leukemia. Leukemia. 2000;14:262–270. doi: 10.1038/sj.leu.2401650. [DOI] [PubMed] [Google Scholar]
  8. Carozzi VA, Canta A, Chiorazzi A. Chemotherapy-induced peripheral neuropathy: what do we know about mechanisms? Neurosci Lett. 2015;596:90–107. doi: 10.1016/j.neulet.2014.10.014. [DOI] [PubMed] [Google Scholar]
  9. Chresta CM, Masters JR, Hickman JA. Hypersensitivity of human testicular tumors to etoposide-induced apoptosis is associated with functional p53 and a high Bax:Bcl-2 ratio. Can Res. 1996;56:1834–1841. [PubMed] [Google Scholar]
  10. Courtemanche H, Magot A, Ollivier Y, Rialland F, Leclair-Visonneau L, Fayet G, et al. Vincristine-induced neuropathy: atypical electrophysiological patterns in children. Muscle Nerve. 2015;52:981–985. doi: 10.1002/mus.24647. [DOI] [PubMed] [Google Scholar]
  11. Cuddihy AR, Oonnell MJ. Cell-cycle responses to DNA damage in G. Int Rev Cytol. 2003;222:99–140. doi: 10.1016/S0074-7696(02)22013-6. [DOI] [PubMed] [Google Scholar]
  12. Dumontet C, Jordan MA. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nat Rev Drug Discov. 2010;9:790–803. doi: 10.1038/nrd3253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Erbil G, Ozbal S, Sonmez U, Pekcetin C, Tugyan K, Bagriyanik A, et al. Neuroprotective effects of selenium and ginkgo biloba extract (EGb761) against ischemia and reperfusion injury in rat brain. Neurosciences (riyadh) 2008;13:233–238. [PubMed] [Google Scholar]
  14. Ertilav K, Nazıroğlu M, Ataizi ZS, Yıldızhan K. Melatonin and selenium suppress docetaxel-induced TRPV1 activation, neuropathic pain and oxidative neurotoxicity in mice. Biol Trace Element Res. 2020;199:1469–1487. doi: 10.1007/s12011-020-02250-4. [DOI] [PubMed] [Google Scholar]
  15. Gilchrist LS, Marais L, Tanner L. Comparison of two chemotherapy-induced peripheral neuropathy measurement approaches in children. Support Care Cancer. 2014;22:359–366. doi: 10.1007/s00520-013-1981-6. [DOI] [PubMed] [Google Scholar]
  16. Gomber S, Dewan P, Chhonker D. Vincristine induced neurotoxicity in cancer patients. Indian J Pediatr. 2010;77:97–100. doi: 10.1007/s12098-009-0254-3. [DOI] [PubMed] [Google Scholar]
  17. Gromer S, Eubel JK, Lee BL, Jacob J. Human selenoproteins at a glance. Cell Mol Life Sci. 2005;62:2414–2437. doi: 10.1007/s00018-005-5143-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hausheer FH, Schilsky RL, Bain S, Berghorn EJ, Lieberman F. Diagnosis, management, and evaluation of chemotherapy-induced peripheral neuropathy. Semin Oncol. 2006;33:15–49. doi: 10.1053/j.seminoncol.2005.12.010. [DOI] [PubMed] [Google Scholar]
  19. Hershman DL, Lacchetti C, Dworkin RH, Lavoie Smith EM, Bleeker J, Cavaletti G, et al. Prevention and management of chemotherapy-induced peripheral neuropathy in survivors of adult cancers: American Society of Clinical Oncology clinical practice guideline. J Clin Oncol. 2014;32:1941–1967. doi: 10.1200/JCO.2013.54.0914. [DOI] [PubMed] [Google Scholar]
  20. Hwang DY, Cho JS, Oh JH, Shim SB, Jee SW, Lee SH, et al. Differentially expressed genes in transgenic mice carrying human mutant presenilin-2 (N141I): correlation of selenoprotein M with Alzheimer's disease. Neurochem Res. 2005;30:1009–1019. doi: 10.1007/s11064-005-6787-6. [DOI] [PubMed] [Google Scholar]
  21. Johnson IS, Armstrong JG, Gorman M, Burnett JP., Jr The vinca alkaloids: a new class of oncolytic agents. Can Res. 1963;23:1390–1427. [PubMed] [Google Scholar]
  22. Kandaş NO, Randolph C, Bosland MC. Differential effects of selenium on benign and malignant prostate epithelial cells: stimulation of LNCaP cell growth by noncytotoxic, low selenite concentrations. Nutr Cancer. 2009;61:251–264. doi: 10.1080/01635580802398430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kieliszek M, Blazejak S. Selenium: significance, and outlook for supplementation. Nutrition. 2013;29:713–718. doi: 10.1016/j.nut.2012.11.012. [DOI] [PubMed] [Google Scholar]
  24. Kryukov GV, Castellano S, Novoselov SV, Lobanov AV, Zehtab O, Guigo R, et al. Characterization of mammalian selenoproteomes. Science. 2003;300:1439–1443. doi: 10.1126/science.1083516. [DOI] [PubMed] [Google Scholar]
  25. Kung AL, Zetterberg A, Sherwood SW, Schimke RT. Cytotoxic effects of cell cycle phase specific agents: result of cell cycle perturbation. Can Res. 1990;50:7307–7317. [PubMed] [Google Scholar]
  26. Lavoie Smith EM, Li L, Chiang C, Thomas K, Hutchinson RJ, Wells EM, et al. Patterns and severity of vincristine-induced peripheral neuropathy in children with acute lymphoblastic leukemia. J Peripher Nerv Syst. 2015;20:37–46. doi: 10.1111/jns.12114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Legha SS. Vincristine neurotoxicity. Pathophysiol Manag Med Toxicol. 1986;1:421–427. doi: 10.1007/BF03259853. [DOI] [PubMed] [Google Scholar]
  28. Lemarie A, Morzadec C, Mérino D, Micheau O, Fardel O, Vernhet L. Arsenic trioxide induces apoptosis of human monocytes during macrophagic differentiation through nuclear factor-kappaB-related survival pathway down-regulation. J Pharmacol Exp Ther. 2006;316:304–314. doi: 10.1124/jpet.105.092874. [DOI] [PubMed] [Google Scholar]
  29. Lin CR, Cheng JT, Lin FC, Chou AK, Lee TC, Chen JT, et al. Effect of thiopental, propofol, and etomidate on vincristine toxicity in PC12 cells. Cell Biol Toxicol. 2002;18:63–70. doi: 10.1023/A:1014423330210. [DOI] [PubMed] [Google Scholar]
  30. Lobert S, Vulevic B, Correia JJ. Interaction of vinca alkaloids with tubulin: a comparison of vinblastine, vincristine, and vinorelbine. Biochemistry. 1996;35:6806–6814. doi: 10.1021/bi953037i. [DOI] [PubMed] [Google Scholar]
  31. Loef M, Schrauzer GN, Walach H. Selenium and Alzheimer's disease: a systematic review. J Alzheimers Dis. 2011;26:81–104. doi: 10.3233/JAD-2011-110414. [DOI] [PubMed] [Google Scholar]
  32. Milcan A, Arslan E, Bagdatoglu OT, Bagdatoglu C, Polat G, Kanik A, et al. The effect of alprostadil on ischemia-reperfusion injury of peripheral nerve in rats. Pharmacol Res. 2004;49:67–72. doi: 10.1016/j.phrs.2003.07.008. [DOI] [PubMed] [Google Scholar]
  33. Mora E, Smith EML, Donohoe C, Hertz DL. Vincristine-induced peripheral neuropathy in pediatric cancer patients. Am J Cancer Res. 2016;6:2416–2430. [PMC free article] [PubMed] [Google Scholar]
  34. Nakayama A, Hill KE, Austin LM, Motley AK, Burk RF. All regions of mouse brain are dependent on selenoprotein P for maintenance of selenium. J Nutr. 2007;137:690–693. doi: 10.1093/jn/137.3.690. [DOI] [PubMed] [Google Scholar]
  35. Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, et al. Bax interacts with the permeability transition pore to induce permeability transition and cytochrome c release in isolated mitochondria. Proc Natl Acad Sci USA. 1998;95:14681–14686. doi: 10.1073/pnas.95.25.14681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ola MS, Nawaz M, Ahsan H. Role of Bcl-2 family proteins and caspases in the regulation of apoptosis. Mol Cell Biochem. 2011;351:41–58. doi: 10.1007/s11010-010-0709-x. [DOI] [PubMed] [Google Scholar]
  37. Rahman MM, Uson-Lopez RA, Sikder MT, Tan G, Hosokawa T, Saito T, et al. Ameliorative effects of selenium on arsenic-induced cytotoxicity in PC12 cells via modulating autophagy/apoptosis. Chemosphere. 2018;196:453–466. doi: 10.1016/j.chemosphere.2017.12.149. [DOI] [PubMed] [Google Scholar]
  38. Ramchandren S, Leonard M, Mody RJ, Donohue JE, Moyer J, Hutchinson R, et al. Peripheral neuropathy in survivors of childhood acute lymphoblastic leukemia. J Peripher Nerv Syst. 2009;14:184–189. doi: 10.1111/j.1529-8027.2009.00230.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sawaguchi Y, Ueno S, Nishiyma Y, Yamazaki R, Matsuzaki T. Establishment of a novel in vitro model for predicting incidence and severity of microtubule-targeting agent-induced peripheral neuropathy. Anticancer Res. 2015;35:6431–6437. [PubMed] [Google Scholar]
  40. Silva A, Wang Q, Wang M, Ravula SK, Glass JD. Evidence for direct axonal toxicity in vincristine neuropathy. J Peripher Nerv Syst. 2006;11:211–216. doi: 10.1111/j.1529-8027.2006.0090.x. [DOI] [PubMed] [Google Scholar]
  41. Silverman JA, Deitcher SR. Marqibo(R) (vincristine sulfate liposome injection) improves the pharmacokinetics and pharmacodynamics of vincristine. Cancer Chemother Pharmacol. 2013;71:555–564. doi: 10.1007/s00280-012-2042-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Souza PS, Vasconcelos FC, De Souza Reis FR, Nestal De Moraes G, Maia RC. P-glycoprotein and survivin simultaneously regulate vincristine-induced apoptosis in chronic myeloid leukemia cells. Int J Oncol. 2011;39:925–933. doi: 10.3892/ijo.2011.1103. [DOI] [PubMed] [Google Scholar]
  43. Starobova H, Vetter I. Pathophysiology of chemotherapy-induced peripheral neuropathy. Front Mol Neurosci. 2017;10:174. doi: 10.3389/fnmol.2017.00174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Steinbrenner H, Sies H. Selenium homeostasis and antioxidant selenoproteins in brain: implications for disorders in the central nervous system. Arch Biochem Biophys. 2013;536:152–157. doi: 10.1016/j.abb.2013.02.021. [DOI] [PubMed] [Google Scholar]
  45. Tapiero H, Townsend DM, Tew KD. The antioxidant role of selenium and seleno-compounds. Biomed Pharmacother = Biomedecine & Pharmacotherapie. 2003;57:134–144. doi: 10.1016/S0753-3322(03)00035-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tu Y, Cheng S, Zhang S, Sun H, Xu Z. Vincristine induces cell cycle arrest and apoptosis in SH-SY5Y human neuroblastoma cells. Int J Mol Med. 2013;31:113–119. doi: 10.3892/ijmm.2012.1167. [DOI] [PubMed] [Google Scholar]
  47. Wang X, Huan Y, Li C, Cao H, Sun S, Lei L, et al. Diphenyl diselenide alleviates diabetic peripheral neuropathy in rats with streptozotocin-induced diabetes by modulating oxidative stress. Biochem Pharmacol. 2020;182:114221. doi: 10.1016/j.bcp.2020.114221. [DOI] [PubMed] [Google Scholar]
  48. Yu Y, Ma X, Yang T, Li B, Xie K, Liu D, et al. Protective effect of hydrogen-rich medium against high glucose-induced apoptosis of Schwann cells in vitro. Mol Med Rep. 2015;12:3986–3992. doi: 10.3892/mmr.2015.3874. [DOI] [PubMed] [Google Scholar]
  49. Zajączkowska R, Kocot-Kępska M, Leppert W, Wrzosek A, Mika J, Wordliczek J. Mechanisms of chemotherapy-induced peripheral neuropathy. Int J Mol Sci. 2019;20:1451. doi: 10.3390/ijms20061451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhu L, Han MB, Gao Y, Wang H, Dai L, Wen Y, et al. Curcumin triggers apoptosis via upregulation of Bax/Bcl-2 ratio and caspase activation in SW872 human adipocytes. Mol Med Rep. 2015;12:1151–1156. doi: 10.3892/mmr.2015.3450. [DOI] [PubMed] [Google Scholar]
  51. Zhu L, Hao J, Cheng M, Zhang C, Huo C, Liu Y, et al. Hyperglycemia-induced Bcl-2/Bax-mediated apoptosis of Schwann cells via mTORC1/S6K1 inhibition in diabetic peripheral neuropathy. Exp Cell Res. 2018;367:186–195. doi: 10.1016/j.yexcr.2018.03.034. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data and analyses are available from the corresponding author and first authors on request.

Not applicable.

Articles from Cytotechnology are provided here courtesy of Springer Science+Business Media B.V.

RESOURCES