Skip to main content
High Altitude Medicine & Biology logoLink to High Altitude Medicine & Biology
. 2022 Sep 14;23(3):215–222. doi: 10.1089/ham.2022.0015

Exposure to High Altitude Promotes Loss of Muscle Mass That Is Not Rescued by Metformin

Zackery S Fullerton 1, Benjamin D McNair 1, Nicholas A Marcello 1, Emily E Schmitt 1,2, Danielle R Bruns 1,2,✉
PMCID: PMC9526469  PMID: 35653735

Abstract

Fullerton, Zackery S., Benjamin D. McNair, Nicholas A. Marcello, Emily E. Schmitt, and Danielle R. Bruns. Exposure to high altitude promotes loss of muscle mass that is not rescued by metformin. High Alt Med Biol. 23:215–222, 2022.

Background:

Exposure to high altitude (HA) causes muscle atrophy. Few therapeutic interventions attenuate muscle atrophy; however, the diabetic drug, metformin (Met), has been suggested as a potential therapeutic to preserve muscle mass with aging and obesity-related atrophy. The purpose of the present study was to test the hypothesis that HA would induce muscle atrophy that could be attenuated by Met.

Methods:

C57Bl6 male and female mice were exposed to simulated HA (∼5,200 m) for 4 weeks, while control (Con) mice remained at resident altitude (∼2,180 m). Met was administered in drinking water at 200 mg/(kg·day). We assessed muscle mass, myocyte cell size, muscle and body composition, and expression of molecular mediators of atrophy.

Results:

Mice exposed to HA were leaner and had a smaller hind limb complex (HLC) mass than Con mice. Loss of HLC mass and myocyte size were not attenuated by Met. Molecular markers for muscle atrophy were activated at HA in a sex-dependent manner. While the atrophic regulator, atrogin, was unchanged at HA or with Met, myostatin expression was upregulated at HA. In female mice, Met further stimulated myostatin expression.

Conclusions:

Although HA exposure resulted in loss of muscle mass, particularly in male mice, Met did not attenuate muscle atrophy. Identification of other interventions to preserve muscle mass during ascent to HA is warranted.

Keywords: high altitude, hypoxia, metformin, muscle atrophy

Introduction

Exposure to high altitude (HA) induces a variety of physiological responses. Although several environmental factors contribute to these consequences at HA, hypoxia at high elevations places significant stress on the cardiopulmonary system as well as other systems (Fulco et al., 2002; Pircher et al., 2021). In addition to cardiorespiratory changes with HA exposure, loss of muscle mass and fiber atrophy also occur (Mizuno et al., 2008). These observations hold true in mountaineering expeditions, as well as in response to simulated HA with hypobaric hypoxia exposure, both in humans (Green et al., 1989; Gaston et al., 2019) and in rodents (McNair et al., 2020). Skeletal muscle function is a significant contributor to overall whole-body health and is responsible for locomotion, posture, metabolism, and maintenance of body temperature, among other critical physiological processes (Wolfe, 2006). In addition to HA, loss of muscle mass is associated with various clinical contexts, including cancer cachexia (Agrawal et al., 2018), obesity (Wannamethee and Atkins, 2015), and aging (Tieland et al., 2018). Therefore, maintaining muscle mass with physiological or pathological stress such as HA is significant.

Despite the significance of muscle mass in overall health, the mechanisms of muscle atrophy are ill-defined and therapeutic interventions are limited (Carraro et al., 2018). However, recent investigations of the traditionally antihyperglycemic drug and AMP-activated protein kinase (AMPK) activator, metformin (Met), have implicated it as a versatile therapeutic beyond its blood glucose-lowering effects (Rena et al., 2017). Met has been used to attenuate muscle atrophy and myopathy in high-fat-induced obesity (Hasan et al., 2018; Aliabadi et al., 2021). Putative mechanisms of protection include attenuation of obesity-induced inflammation as well as resolution of atrophic signaling such as the atrogin-1/MuRF-1 signaling pathway (Sandri et al., 2004). However, even though Met has promising effects on skeletal muscle mass in models of obesity, it has not yet been tested as an antiatrophic agent at HA. Met has been suggested as an ergogenic aid for exercise performance at HA (Scalzo et al., 2017) due to improvement in glycogen synthesis, further suggesting that it may represent a novel therapy to attenuate HA-induced muscle wasting. Given its robust safety profile and high clinical use (Le and Lee, 2019), Met represents a novel and safe therapeutic (Evans et al., 2005). Therefore, we tested the hypothesis that Met would attenuate HA-induced muscle atrophy in male and female mice.

Materials and Methods

Experimental model of hypoxia and muscle mass loss

All experiments and methods described in this study were conducted in accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of University of Wyoming.

A total of 49 C57Bl6 mice aged ∼4 months were analyzed for this study. Male (n = 10) and female (n = 6) mice were subjected to HA artificially in a hypobaric chamber (∼5,200 m) and remained at HA for 4 weeks, with descent only occurring ∼30 minutes per week for cage changes and welfare checks. Control (Con) mice (male, n = 11; and female, n = 6) were housed at ambient altitude (∼2,200 m).

Mice received Met at HA (male, n = 9; and female, n = 7) or at ambient altitude (Con; male, n = 4; and female, n = 7) in drinking water at 200 mg/(kg·day), consistent with previous reports in mice (Senesi et al., 2016; Zeng et al., 2019; Yang et al., 2020). Water and standard laboratory chow (Laboratory Diet 5001) were provided ad libitum. Food was taken out of the cage the day before sacrifice.

Animals were humanely euthanized (Fatal-Plus; pentobarbital), body weights collected, and hind limb complexes (HLCs: gastrocnemius, soleus, and plantaris) weighed and flash-frozen for molecular analyses. Blood glucose was measured using a handheld glucometer at sacrifice (Tyson Bio HT100). Water and food consumption was measured and normalized over the 4-week intervention as per the number of mice per cage per day (g/mouse/day).

Body and leg composition

Dual-energy X-ray absorptiometry (DEXA) was performed at the end of the 4-week HA exposure, as previously described (McNair et al., 2020). Briefly, mice were anesthetized with isoflurane and placed in the prone position. Scans were acquired and analyzed for body and leg composition.

Immunoblotting

The HLC was mechanically homogenized in radioimmunoprecipitation assay lysis buffer (150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, and 50 mM Tris, pH 8.0) with protease inhibitors. Protein quantification was performed with a micro-BCA protein assay kit (Regue et al., 2019). Protein (30 μg) was run with sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane.

The membranes were blocked with 5% bovine serum albumin, incubated with primary antibodies, and then visualized with a horseradish peroxidase-conjugated secondary antibody. Primary antibodies used were as follows: p-AMPK (Thr172) (Cell Signaling Cat. 2531), AMPKα (Cell Signaling Cat. 2532), p-ACC (Ser79) (Cell Signaling Cat. 3661), and ACC (Cell Signaling Cat. 3662).

Protein quantification of band intensities was performed by area density analysis using ImageJ. Data were expressed as phospho/total protein (p/t).

Real-time quantitative PCR

Total RNA was isolated from the HLC using the standard TRIzol protocol and reverse transcribed using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). PCR was performed using QuantStudio 5 (Thermo Fisher Scientific) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific).

Oligonucleotide sequences were as follows: 18S forward: GCCGCTAGAGGTGAAATTCTTG, 18S reverse: CTTTCGCTCTGGTCCGTCTT; myostatin forward: TCACGCTACCACGGAAACAA, myostatin reverse: AGGAGTCTTGACGGGTCTGA; and atrogin-1 forward: AGAAAAGCGGCAGCTTCGT, atrogin-1 reverse: GCTGCGACGTCGTAGTTCAG.

Data were normalized to the housekeeping gene 18S, quantified by the ΔΔ Ct method, and expressed as fold change of the same-sex control.

Histology

HLCs were frozen in optimal cutting temperature compound (Fisher Scientific, Waltham, MA). Tissue sections were cut at 4–6 μm on a precooled cryotome (Leica Biosystems, IL). Sections were then treated with 1% Triton X-100, washed with deionized water, and stained with wheat germ agglutinin–fluorescein (Sigma-Aldrich, Milwaukee, WI), as previously described (Yusifov et al., 2021).

Images were taken of the gastrocnemius to quantify cell size. Fluorescent images were acquired with an Olympus IX71 inverted microscope (Olympus, Waltham, MA) and CoolSNAP HQ2 CCD camera (Roper Scientific). Skeletal muscle cell size was calculated by a blinded technician using a semiautomated analysis of skeletal muscle morphology (Tyagi et al., 2017) using ImageJ (version 1.53a; NIH).

Statistical analyses

All data shown are expressed as mean ± standard error of the mean. Significance was determined by three-way analysis of variance (altitude × drug × sex), followed by within-sex and environment t-test, to directly assess the impact of Met. Significance was set a priori at α < 0.05.

Analyses were performed using SPSS Statistics, version 22 (IBM, Armonk, NY).

Results

Weight loss occurs with ascent to HA, thus we assessed changes in body weight and composition. As expected, both male and female mice lost weight (Fig. 1A, F). Met exacerbated HA-induced weight loss in male mice. These differences were not explained by initial body weights, which did not differ at baseline (Fig. 1A, F). HA mice were also leaner than Con mice, with lower trunk fat in male mice (Fig. 1B, G).

FIG. 1.

FIG. 1.

HA and Met impact body weight and composition and muscle mass. (A) In male mice, exposure to HA resulted in loss of body weight, (B) trunk fat, and (C) HLC muscle mass normalized to TL, none of which were attenuated by Met. (D) Blood glucose was lower at HA and with Met. In female mice, (E) HA exposure resulted in loss of body weight, (F) trunk fat, and (G) muscle mass. (H) Blood glucose was lower at HA. Data are presented as mean ± SEM. Data were analyzed by three-way ANOVA, followed by Student's t-test, to compare the effect of Met within sex and at altitude. #Main effect of altitude. *p < 0.05 within sex and altitude. HA, high altitude; HLC, hind limb complex; Met, metformin; SEM, standard error of the mean; TL, tibia length.

Interestingly, in Con conditions, Met attenuated weight loss in both sexes. HA resulted in loss of HLC mass normalized to tibia length to account for body size (Fig. 1D, I). The loss of muscle mass was exacerbated in male mice compared with female mice, as evidenced by a significant interaction of altitude and sex. Loss of HLC mass at HA was not attenuated by Met. Given the blood glucose-lowering effects of Met, we measured blood glucose to confirm that Met was given at a sufficient dose. While mice at HA had lower blood glucose than Con mice, indeed Met also lowered blood glucose (Fig. 1E, J).

Given the impact of HA on water and food intake, we measured food and water consumption by cage. Water consumption did not vary by altitude, although Con Met mice drank less than Con mice (Fig. 2A). Total mean food consumption did not differ by altitude or drug (Fig. 2B); however, HA mice with and without Met consumed significantly less food in week 1 compared with later weeks in the HA chamber (Fig. 2C).

FIG. 2.

FIG. 2.

Food and water consumption at HA. (A) Water consumption did differ by altitude or drug, although within control (Con) elevation, Met mice consumed less water. (B) Over the 4-week exposure, cumulative average food consumption did differ by HA or Con. Data are presented as mean ± SEM. Data were analyzed by three-way ANOVA, followed by Student's t-test, to compare the effect of Met within sex and at altitude. (C) Food consumption was significantly lower at week 1 in HA groups compared with weeks 2, 3, and 4. *HA week 1 compared with weeks 2, 3, and 4 by two-way ANOVA (time × environment).

In addition to loss of muscle mass at HA, atrophy is accompanied by a loss of muscle size. Therefore, we quantified muscle size by lectin staining. HA resulted in lower muscle cross-sectional area in both male and female mice (Fig. 3). Met exacerbated the loss of myocyte area at HA in female mice. However, at Con altitude, Met increased muscle size in male mice.

FIG. 3.

FIG. 3.

HA stimulates loss of muscle size, which was not rescued by Met. (A, B) Representative images of HLC lectin staining. (C) In male (D) and female mice, exposure to HA resulted in smaller myocyte cell size. Met exacerbated loss of muscle size in female mice. Data are presented as mean ± SEM. Data were analyzed by three-way ANOVA, followed by within-sex and altitude Student's t-test. n = 2–3 biological replicates with 12 cells in each replicate. #Main effect of altitude. *p < 0.05 within sex and altitude.

We quantified expression of molecular regulators of muscle atrophy and muscle biosynthesis. While the atrophic regulator, atrogin, was unchanged at HA or with Met (Fig. 4A, B), myostatin expression was upregulated in HA male and female mice. In female mice, Met also increased myostatin expression, with a significant interaction with HA (Fig. 4D).

FIG. 4.

FIG. 4.

Expression of regulators of muscle mass. (A, B) Atrogin expression was not impacted by HA in male or female mice. (C) Myostatin expression was upregulated by HA in male and (D) female mice. Met also stimulated expression of myostatin in the HLCs from female mice. n = 4 per group. Data are presented as mean ± SEM. Data were analyzed by three-way ANOVA, followed by within-sex and altitude Student's t-test. #Main effect of altitude. *p < 0.05 within sex and altitude.

Although its mechanism of action still lacks consensus, Met is a reported activator of AMPK. Therefore, we quantified activation of AMPK by immunoblotting. AMPK activation was generally unchanged at HA or with Met (Fig. 5A). However, Met stimulated phosphorylation of downstream target, acetyl-CoA carboxylase, in male mice at Con altitude (Fig. 5E). Acetyl-CoA carboxylase activation was lower at HA in female mice (Fig. 5B, F).

FIG. 5.

FIG. 5.

Activation of AMPK in the muscle of male and female mice exposed to HA with or without Met. (A) Representative images of male and (B) female mice. (C, D) AMPK was unchanged by HA or Met. (E) Downstream AMPK target acetyl CoA carboxylase was activated by Met in Con mice, but not impacted by HA in male mice. (F) ACC activation was attenuated by HA in female mice. Data are presented as mean ± SEM. Data were analyzed by three-way ANOVA, followed by within-sex and altitude Student's t-test. n = 5–9 per group. #Main effect of altitude. *p < 0.05 within sex and altitude. AMPK, AMP-activated protein kinase.

Discussion

Ascent to HA induces a multitude of respiratory, cardiovascular, and metabolic changes. One such change is the loss of skeletal muscle mass, noted in both human populations and rodent models of HA exposure (Fulco et al., 2002; Chaudhary et al., 2012; McNair et al., 2020; Pircher et al., 2021). Given the increasing popularity of travel to HA locations and the implications of loss of muscle mass in chronic disease (Wannamethee and Atkins, 2015; Agrawal et al., 2018), identification of therapeutics to attenuate some of these effects is warranted. In this study, we tested the therapeutic antiatrophy potential of the antidiabetic drug, Met. Despite significant loss of muscle mass with HA exposure, Met did not attenuate muscle loss. Future efforts should aim to identify other therapeutics for this unmet need.

Chronic exposure to HA has been widely reported to result in loss of body mass (Dunnwald et al., 2019). Loss of mass is typically also accompanied by changes in body composition characterized by depletion of fat storage (Hamad and Travis, 2006). In this study, we report significant loss of body weight, largely characterized by loss of trunk fat. To date, efforts to identify the mechanisms by which HA results in loss of mass have not been fully resolved. Food intake drops precipitously in the first few days of HA exposure and then is maintained at a lower level than normoxic altitude. Our data are consistent with this observation, with mice consuming significantly less food in the first week of HA exposure, which then normalizes over the remaining 3 weeks. However, an elevated basal metabolic rate has also been suggested to occur with HA exposure, although this observation lacks consensus (Mawson et al., 2000). The loss of body mass is likely due to a complex interplay between energy intake and expenditure and depends on additional factors such as activity level and duration and severity of HA exposure. Separation of loss of body mass from muscle mass has also been difficult. Several groups have attempted to dissect body composition/mass changes from the loss of muscle mass.

The loss of muscle mass at HA is not fully explained by the loss of body weight as comparisons of pair-fed normoxic animals demonstrate attenuated muscle loss compared with the loss noted in animals at HA (de Theije et al., 2015, 2018). These data suggest that while muscle mass is dependent on overall energy status, HA also directly impacts maintenance of muscle mass—a significant finding that suggests future research efforts into muscle wasting must also take into account local or systemic oxygen availability.

Met has been among the top 10 most widely prescribed drugs in the United States for nearly two decades. Its safety profile and tolerability are well established. Lactic acidosis is a rare but significant effect of Met therapy, which can limit its clinical use. Given the changes in lactate at HA, metabolic acidosis may be more significant in HA populations. However, recent reports of Tibetan Plateau residents on Met therapy did not demonstrate differences in lactate compared with patients on other blood glucose-lowering drugs (Le and Lee, 2019). Over the last few years, in addition to its potent blood glucose-lowering effects, Met has emerged as a potential therapeutic for other age-related and chronic conditions, including muscle wasting. In a genetic mouse model of obesity and concomitant muscle loss, Met partially restored hind limb cross-sectional area (Yang et al., 2020). In sedentary, but otherwise healthy, male mice, Met improved indices of muscle function such as speed, work, time, and estimated oxygen consumption following an exercise bout (Senesi et al., 2016). However, several reports have also emerged suggesting that Met accelerates muscle wasting.

In wild-type mice, Met treatment decreased the gastrocnemius fiber size compared with controls (Kang et al., 2021). Although this proatrophic effect was blunted in diabetic mice, Met was suggested to regulate mass through stimulation of myostatin. Myostatin is a master regulator of muscle growth. It negatively regulates mass and hypertrophy such that a decrease in expression of myostatin results in increased muscle mass (Rodriguez et al., 2014). In vitro studies have demonstrated that Met stimulates expression of myostatin in C2C12 cells (Das et al., 2012). Our data are consistent with this notion, at least in female mice, which in both Con and HA conditions demonstrated upregulation of myostatin expression with Met treatment.

In addition to its regulation of myostatin, Met may also regulate other atrophy-related pathways. In C2C12 myotubes, Met induced expression of atrophy regulators, MAFbx and MuRF1. Interestingly, another AMPK activator, 5-aminoimidazole-4-carboxamide riboside (AICAR), did too, and when used in synergy with the known atrophic agent, dexamethasone, the stimulatory effect on wasting was synergistic (Krawiec et al., 2007). In cultured myotubes treated with proinflammatory cytokines to mimic cachexia, AICAR, but not Met, inhibited cytokine-induced atrophy and restored muscle metabolism. These in vitro results were validated in vivo in a model of cancer cachexia (Hall et al., 2018). The reasons why AICAR attenuated atrophy, while Met did not, are not clear, but were speculated to involve mechanisms of AMPK action. Together, the clear disparate reports of Met, AMPK activation, and model of muscle loss strongly suggest that Met and other AMPK activators are highly context dependent. That is, we and others posit that perhaps Met is beneficial in settings of energy excess such as diabetes-induced muscle wasting, while it is less effective during times of energy deficit such as hypoxia. Testing this hypothesis will be the focus of future research efforts.

Sex differences underlie many human diseases, including hypoxia-related pulmonary hypertension (Mair et al., 2014) and cachexia-induced muscle loss (Wallengren et al., 2015). In both these conditions, male subjects fare worse than females, with men losing more muscle mass compared with women. Our data demonstrate that male mice lose more muscle mass at HA compared with females. In addition, muscle acetyl coA carboxylase and myostatin were differentially regulated by altitude and sex. Sex-based differences in response to HA have been attributed to sex hormone metabolism and signaling with respect to estrogen and testosterone (Austin et al., 2013). It has been hypothesized that changes in fiber-type contribution, cross-sectional area, or signaling pathways could be attributed to sex-based differences in skeletal muscle fatigue (Haizlip et al., 2015). Females have greater oxidative capacity than males (Fulco et al., 2001), which could explain why males lose more muscle mass than females at HA. In addition, male mice could lose more skeletal muscle mass because they are more sensitive to inflammation-mediated atrophy (Wallengren et al., 2015) and have less mitochondrial content compared with females (Montero et al., 2018). While testing these specific mechanisms was beyond the scope of the current work, we suggest that future research efforts aim to understand differences in HA-induced atrophy.

Limitations and Conclusions

We acknowledge several limitations of the present study. The current experiments were performed in mice and may not fully translate to humans. However, given the decades of research utilizing preclinical models of atrophy and HA exposure, as well as research utilizing clinically relevant doses of Met in rodents to improve health, we suspect that similar findings would hold true in humans with HA exposure.

Although DEXA analysis permitted quantification of trunk fat versus fat-free mass, we were not able to quantify muscle-specific composition. Thus, while we can be confident (based on lectin quantification of myocyte size) that the loss of muscle mass was due to loss of fat-free mass rather than fat mass, we did not directly quantify these differences. Given our research question and the small size of the mouse HLC, we did not dissect the HLC muscle to determine muscle-specific differences. We acknowledge this limitation based on reports of different sensitivity of glycolytic versus oxidative muscles to atrophy by hypoxic stimuli (Nagahisa and Miyata, 2018). We suggest that future research efforts also aim to understand if Met and other putative muscle regulators impact muscle function and signaling in a fiber-specific manner.

Last, and perhaps most importantly with respect to the current findings, we must discuss the Con environmental condition. Our vivarium is housed at a resident altitude of ∼2,200 m (barometric pressure 585 mmHg). While this elevation is considered to be moderate elevation, our animals experienced mild hypoxic stress, as evidenced by loss of body weight over the 4-week intervention. However, the presence of hypoxia at 2,200 m does not dampen our findings as we still noted robust loss of muscle and body mass at HA. Indeed, were we to repeat the experiments with a true sea level control, we would have found even more striking differences between Con and HA groups. That is, were our control group really located at sea level rather than moderate altitude, the loss of muscle mass at HA would have been more robust, not less. Ongoing efforts in our laboratory are aimed at comprehensively quantifying the phenotype of moderate altitude.

In conclusion, we demonstrated that HA induced significant muscle atrophy in a sexually dimorphic manner, with male mice losing more mass than female mice. We tested Met as a potential therapeutic for HA-induced muscle atrophy and found that Met does not attenuate muscle atrophy.

Future work aimed at understanding the molecular basis for HA-induced muscle loss in males and females will be critical for identification of viable therapeutics for this unmet need.

Authors' Contributions

Z.S.F. was involved in data acquisition and analysis and also drafted, revised, and approved the final manuscript; B.D.M. and N.A.M. were involved in data acquisition and also approved the final manuscript; E.E.S. was involved in data acquisition and conceptual design and also drafted, edited, and approved the final manuscript; and D.R.B. was involved in data analysis and conceptual design and also drafted, edited, and approved the final manuscript.

Institutional Review Board Statement

Ethical review and approval were obtained for this study and it was conducted in accordance with institutional guidelines and approved by the Institutional Animal Care and Use Committee of University of Wyoming.

Author Disclosure Statement

No competing financial interests exist.

Funding Information

This research was funded by the Wyoming NASA Space Grant Consortium #NNX15AI08H (Danielle R. Bruns) and NIH/NIA K01 AG05881 (Danielle R. Bruns).

References

  1. Agrawal A, Rathor R, Kumar R, Suryakumar G, and Ganju L. (2018). Role of altered proteostasis network in chronic hypobaric hypoxia induced skeletal muscle atrophy. PLoS One 13:e0204283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aliabadi M, Zamani-Garmsiri F, Panahi G, Tehrani SS, and Meshkani R. (2021). Metformin in combination with genistein ameliorates skeletal muscle inflammation in high-fat diet fed c57BL/6 mice. Cytokine 146:155638. [DOI] [PubMed] [Google Scholar]
  3. Austin ED, Lahm T, West J, Tofovic SP, Johansen AK, Maclean MR, Alzoubi A, and Oka M. (2013). Gender, sex hormones and pulmonary hypertension. Pulm Circ 3:294–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Carraro U, Gava K, Baba A, Marcante A, and Piccione F. (2018). To contrast and reverse skeletal muscle atrophy by full-body in-bed gym, a mandatory lifestyle for older olds and borderline mobility-impaired persons. Adv Exp Med Biol 1088:549–560. [DOI] [PubMed] [Google Scholar]
  5. Chaudhary P, Suryakumar G, Prasad R, Singh SN, Ali S, and Ilavazhagan G. (2012). Chronic hypobaric hypoxia mediated skeletal muscle atrophy: Role of ubiquitin-proteasome pathway and calpains. Mol Cell Biochem 364:101–113. [DOI] [PubMed] [Google Scholar]
  6. Das AK, Yang QY, Fu X, Liang JF, Duarte MS, Zhu MJ, Trobridge GD, and Du M. (2012). AMP-activated protein kinase stimulates myostatin expression in C2C12 cells. Biochem Biophys Res Commun 427:36–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. de Theije CC, Langen RC, Lamers WH, Gosker HR, Schols AM, and Kohler SE. (2015). Differential sensitivity of oxidative and glycolytic muscles to hypoxia-induced muscle atrophy. J Appl Physiol (1985) 118:200–211. [DOI] [PubMed] [Google Scholar]
  8. de Theije CC, Schols AMWJ, Lamers WH, Neumann D, Kohler SE, and Langen RCJ. (2018). Hypoxia impairs adaptation of skeletal muscle protein turnover- and AMPK signaling during fasting-induced muscle atrophy. PLoS One 13:e0203630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dunnwald T, Gatterer H, Faulhaber M, Arvandi M, and Schobersberger W. (2019). Body composition and body weight changes at different altitude levels: A systematic review and meta-analysis. Front Physiol 10:430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Evans JM, Donnelly LA, Emslie-Smith AM, Alessi DR, and Morris AD. (2005). Metformin and reduced risk of cancer in diabetic patients. BMJ 330:1304–1305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fulco CS, Friedlander AL, Muza SR, Rock PB, Robinson S, Lammi E, Baker-Fulco CJ, Lewis SF, and Cymerman A. (2002). Energy intake deficit and physical performance at altitude. Aviat Space Environ Med 73:758–765. [PubMed] [Google Scholar]
  12. Fulco CS, Rock PB, Muza SR, Lammi E, Braun B, Cymerman A, Moore LG, and Lewis SF. (2001). Gender alters impact of hypobaric hypoxia on adductor pollicis muscle performance. J Appl Physiol (1985) 91:100–108. [DOI] [PubMed] [Google Scholar]
  13. Gaston A-F, Peiro AM, Hapkova I, and Durand F. (2019). Exploring physiological parameters in ski mountaineering during world cup races. Int J Perform Anal Sport 19:275–288. [Google Scholar]
  14. Green HJ, Sutton JR, Cymerman A, Young PM, and Houston CS. (1989). Operation Everest II: Adaptations in human skeletal muscle. J Appl Physiol (1985) 66:2454–2461. [DOI] [PubMed] [Google Scholar]
  15. Haizlip KM, Harrison BC, and Leinwand LA. (2015). Sex-based differences in skeletal muscle kinetics and fiber-type composition. Physiology (Bethesda) 30:30–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hall DT, Griss T, Ma JF, Sanchez BJ, Sadek J, Tremblay AMK, Mubaid S, Omer A, Ford RJ, Bedard N, Pause A, Wing SS, Di Marco S, Steinberg GR, Jones RG, and Gallouzi IE. (2018). The AMPK agonist 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR), but not metformin, prevents inflammation-associated cachectic muscle wasting. EMBO Mol Med 10:e8307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hamad N, and Travis SP. (2006). Weight loss at high altitude: Pathophysiology and practical implications. Eur J Gastroenterol Hepatol 18:5–10. [DOI] [PubMed] [Google Scholar]
  18. Hasan MM, Shalaby SM, El-Gendy J, and Abdelghany EMA. (2018). Beneficial effects of metformin on muscle atrophy induced by obesity in rats. J Cell Biochem 120:5677–5686. [DOI] [PubMed] [Google Scholar]
  19. Kang MJ, Moon JW, Lee JO, Kim JH, Jung EJ, Kim SJ, Oh JY, Wu SW, Lee PR, Park SH, and Kim HS. (2021). Metformin induces muscle atrophy by transcriptional regulation of myostatin via HDAC6 and FoxO3a. J Cachexia Sarcopenia Muscle 13:605–620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Krawiec BJ, Nystrom GJ, Frost RA, Jefferson LS, and Lang CH. (2007). AMP-activated protein kinase agonists increase mRNA content of the muscle-specific ubiquitin ligases MAFbx and MuRF1 in C2C12 cells. Am J Physiol Endocrinol Metab 292:E1555–E1567. [DOI] [PubMed] [Google Scholar]
  21. Le S, and Lee GC. (2019). Emerging trends in metformin prescribing in the United States from 2000 to 2015. Clin Drug Investig 39:757–763. [DOI] [PubMed] [Google Scholar]
  22. Mair KM, Johansen AK, Wright AF, Wallace E, and MacLean MR. (2014). Pulmonary arterial hypertension: Basis of sex differences in incidence and treatment response. Br J Pharmacol 171:567–579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mawson JT, Braun B, Rock PB, Moore LG, Mazzeo R, and Butterfield GE. (2000). Women at altitude: Energy requirement at 4,300 m. J Appl Physiol (1985) 88:272–281. [DOI] [PubMed] [Google Scholar]
  24. McNair BD, Marcello NA, Smith DT, Schmitt EE, and Bruns DR. (2020). Changes in muscle mass and composition by exercise and hypoxia as assessed by DEXA in mice. Medicina (Kaunas) 56:446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mizuno M, Savard GK, Areskog NH, Lundby C, and Saltin B. (2008). Skeletal muscle adaptations to prolonged exposure to extreme altitude: A role of physical activity? High Alt Med Biol 9:311–317. [DOI] [PubMed] [Google Scholar]
  26. Montero D, Madsen K, Meinild-Lundby AK, Edin F, and Lundby C. (2018). Sexual dimorphism of substrate utilization: Differences in skeletal muscle mitochondrial volume density and function. Exp Physiol 103:851–859. [DOI] [PubMed] [Google Scholar]
  27. Nagahisa H, and Miyata H. (2018). Influence of hypoxic stimulation on angiogenesis and satellite cells in mouse skeletal muscle. PLoS One 13:e0207040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Pircher T, Wackerhage H, Aszodi A, Kammerlander C, Böcker W, and Saller MM. (2021). Hypoxic signaling in skeletal muscle maintenance and regeneration: A systematic review. Front Physiol 12:684899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Regue L, Ji F, Flicker D, Kramer D, Pierce W, Davidoff T, Widrick JJ, Houstis N, Minichiello L, Dai N, and Avruch J. (2019). IMP2 increases mouse skeletal muscle mass and voluntary activity by enhancing autocrine insulin-like growth factor 2 production and optimizing muscle metabolism. Mol Cell Biol 39:e00528-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rena G, Hardie DG, and Pearson ER. (2017). The mechanisms of action of metformin. Diabetologia 60:1577–1585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rodriguez J, Vernus B, Chelh I, Cassar-Malek I, Gabillard JC, Hadj Sassi A, Seiliez I, Picard B, and Bonnieu A. (2014). Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell Mol Life Sci 71:4361–4371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K, Schiaffino S, Lecker SH, and Goldberg AL. (2004). Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 117:399–412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Scalzo RL, Paris HL, Binns SE, Davis JL, Beals JW, Melby CL, Luckasen GJ, Hickey MS, Miller BF, Hamilton KL, and Bell C. (2017). Ergogenic properties of metformin in simulated high altitude. Clin Exp Pharmacol Physiol 44:729–738. [DOI] [PubMed] [Google Scholar]
  34. Senesi P, Montesano A, Luzi L, Codella R, Benedini S, and Terruzzi I. (2016). Metformin treatment prevents sedentariness related damages in mice. J Diabetes Res 2016:8274689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tieland M, Trouwborst I, and Clark BC. (2018). Skeletal muscle performance and ageing. J Cachexia Sarcopenia Muscle 9:3–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tyagi S, Beqollari D, Lee CS, Walker LA, and Bannister RA. (2017). Semi-automated analysis of mouse skeletal muscle morphology and fiber-type composition. J Vis Exp 56024. DOI: 10.3791/56024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wallengren O, Iresjö BM, Lundholm K, and Bosaeus I. (2015). Loss of muscle mass in the end of life in patients with advanced cancer. Support Care Cancer 23:79–86. [DOI] [PubMed] [Google Scholar]
  38. Wannamethee SG, and Atkins JL. (2015). Muscle loss and obesity: The health implications of sarcopenia and sarcopenic obesity. Proc Nutr Soc 74:405–412. [DOI] [PubMed] [Google Scholar]
  39. Wolfe RR. (2006). The underappreciated role of muscle in health and disease. Am J Clin Nutr 84:475–482. [DOI] [PubMed] [Google Scholar]
  40. Yang Y, Liao Z, and Xiao Q. (2020). Metformin ameliorates skeletal muscle atrophy in Grx1 KO mice by regulating intramuscular lipid accumulation and glucose utilization. Biochem Biophys Res Commun 533:1226–1232. [DOI] [PubMed] [Google Scholar]
  41. Yusifov A, Chhatre VE, Zumo JM, Cook RF, McNair BD, Schmitt EE, Woulfe KC, Bruns DR. (2021). Cardiac response to adrenergic stress differs by sex and across the lifespan. Geroscience 43:1799–1813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zeng J, Zhu L, Liu J, Zhu T, Xie Z, Sun X, and Zhang H. (2019). Metformin protects against oxidative stress injury induced by ischemia/reperfusion via regulation of the lncRNA-H19/miR-148a-3p/Rock2 axis. Oxid Med Cell Longev 2019:8768327. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from High Altitude Medicine & Biology are provided here courtesy of SAGE Publications

RESOURCES