Skip to main content
Evidence-based Complementary and Alternative Medicine : eCAM logoLink to Evidence-based Complementary and Alternative Medicine : eCAM
. 2022 Sep 24;2022:9855411. doi: 10.1155/2022/9855411

Intervention Effects of Okra Extract on Brain-Gut Peptides and Intestinal Microorganisms in Sleep Deprivation Rats

Jingru Wu 1, Mingxue Cao 2, Ming Hu 3, Yu Gong 1, Jianming Xue 4, Yilin Yang 5, Hairui Zhou 6,
PMCID: PMC9526647  PMID: 36193125

Abstract

Objective

Okra, possessing various bioactive components, is used to treat different diseases. This study sought to estimate the intervention effects of okra extract (OE) on brain-gut peptides (BGPs) and intestinal microorganisms in sleep deprivation (SD) rats.

Methods

SD rat models were established using the modified multiple platform method and then treated with normal saline, diazepam tablets, or different doses of OE. Body weight and average daily water consumption of rats were recorded. Depressive behaviors of rats were assessed by the open field test and sucrose preference test. Serum levels of noradrenaline, melatonin, inflammatory factors (IL-1β/IL-6/TNF-α/IL-4/IL-10), and BGP indexes, including gastrin (GAS), motilin (MTL), 5-hydroxytryptamine (5-HT), cholecystokinin (CCK), and vasoactive intestinal peptide (VIP) were measured by ELISA. Additionally, the DNA relative contents of representative intestinal microorganisms in the collected rat feces were determined using RT-qPCR.

Results

SD decreased body weight and average daily water consumption and induced depressive behaviors as well as stress and inflammatory responses in rats. SD rats exhibited lowered GAS, MTL, 5-HT, and VIP but elevated CCK and showed diminished DNA relative contents of Bacteroidetes and probiotics (Bifidobacteria and Lactobacilli) but increased Clostridium perfringens. OE at different doses ameliorated the depressive behaviors and mitigated the stress and inflammatory responses in SD rats, raised the serum contents of GAS, MTL, 5-HT, and VIP, reduced CCK level, elevated the DNA relative contents of Bacteroidetes and probiotics, but diminished Clostridium perfringens. OE exhibited similar intervention effects to diazepam tablets (positive control).

Conclusion

OE exerts intervention effects on BGPs and intestinal microorganisms in SD rats.

1. Introduction

Sleep is ubiquitous and complicated animal behavior, and sleep health is a multidimensional pattern of sleep-wake, adapted to environmental, individual, and social demands, facilitating physical and mental well-being [1, 2]. Sleep deprivation (SD) is a result of multiple health problems or a contributor to various major health risks, raising great public health concerns [3]. SD occurs when insufficient sleep results in deterioration in health, decreased performance, and inadequate alertness, which is extremely common, with approximately 20% of adults being sleep-deprived [4]. In addition, SD contributes to changes in mood, memory, learning, and immune functions, affecting physical or psychological activities [5] and causing energy metabolism disorder in neural cells [6]. As a strong stress stimulus, prolonged SD impacts the behavioral and physiological functions of the body, increases general systemic diseases, and leads to cognitive decline and chronic fatigue syndrome [7]. Owning to the importance of sleep, it is necessitated to underline the complicated mechanism of SD to enhance sleep quality.

Brain-gut peptides (BGPs), such as motilin, gastrin, and calcitonin gene-related protein [8], are dual-distributed in the gastrointestinal and nervous systems, exhibiting roles in regulating the secretion of pro-inflammatory cytokines [9]. More importantly, the neuroprotective effects of numerous BGPs have been documented [10]. For instance, electroacupuncture treatment could palliate the neurodegenerative disease—Parkinson's disease—by regulating BGPs in rats, including cholecystokinin, gastrin, neuropeptide Y, somatostatin, and peptide YY [11]. Furthermore, BGPs are implicated in sleep, learning from the idea that ghrelin is a BGP that causes anxiety and other aberrant emotions, contributing to the impacts of insomnia on emotional behaviors [12].

Intestinal microorganism, involved in various physiological processes and metabolism, is imperative in circadian rhythms and sleep [13]. Interestingly, the brain is intimately and complexly linked with the gut, and this bidirectional communication between the central nervous system and the intestinal nervous system is termed the brain-gut axis, in which the gut microbiome is pivotal [14]. Prior work has supported the correlation between intestinal flora and sleep quality [15, 16], and SD can result in corticosterone increase, intestinal flora disorder, and colitis phenotype in mice [17, 18]. Transient SD contributes to subtle changes in intestinal microorganisms in mice [19], whereas intestinal microorganisms modulate SD-elicited inflammatory responses and cognitive impairment [20]. There are more than 100 trillion microorganisms in the human gut and Bacteroidetes are reported to be a common type of intestinal bacteria [21], which are changed in SD mice [22]. In the wake of advances in clinical medicine, the role of intestinal flora in the brain-gut axis is gradually recognized [23, 24], which has emerged as a research hotspot. It is noteworthy that the brain-gut-microbiome axis imposes a potential role in Alzheimer's disease [23]. Neuropeptide Y and peptide YY exert vital roles in obesity development through the brain-gut axis [25]. Imbalances in the structure and function of intestinal flora may be a driving force in global inflammation, which is implicated in several diseases [26, 27]. However, more investigation regarding the effect of SD on BGP and intestinal microorganisms remains to be carried out.

Okra (Abelmoschus esculentus L. Moench), originated in Africa, is a vital vegetable crop that grows widely in tropical, subtropical, and warm temperate regions [28, 29], which also belongs to the natural plant-derived drug [30]. In 2016, the production of okra exceeded 8.9 million tons in more than 33 countries, with the highest production in India [31]. Okra fruit, used as a nutritious and fresh vegetable, possesses medicinal and health properties. Additionally, okra possesses abundant functional components, such as lipids, minerals, carbohydrates, dietary fiber, pectin, amino acids, and vitamins [32]. Okra extract (OE) mainly consists of okra fruit extract and okra seed extract, playing a myriad of effects. There is evidence to suggest that okra fruit powder can affect metabolic syndrome and intestinal microflora diversity in high-fat-diet-induced obese mice [33]. In particular, okra seed oil palliates ethanol-elicited liver damage and mediates intestinal microbial dysregulation in mice [34]. Okra polysaccharide exerts an antidepressant effect by balancing gut microbiota [35]. Okra seed and leaf extracts exert a significant antioxidant activity and can act as major antioxidants [36]. The ethanol extract of okra fruit may be an effective wound-healing agent with antibacterial, antioxidant, and anti-inflammatory activities [37]. Total polyphenols, the major components in okra fruit extract [38], have several subclasses, such as flavonoid. Flavonoid compounds are the most imperative active ingredients in okra [39, 40]. Previous studies have also reported the isolation of natural free flavonoid compounds and their derivatives from okra fruit [4143]. It is noteworthy that flavonoid compounds are capable of regulating intestinal bacteria and playing a defensive role against diseases [4447]. However, there are few clinical and experimental studies at home and abroad to assess the effects of okra fruit extract on SD-induced intestinal flora imbalance and BGPs. Hence, in this study, Sprague-Dawley rats were used as the experimental animals to establish SD rat models by the modified multiple platform method and SD rats were intragastrically administered with different doses of OE to explore the intervention effect of OE on BGPs and intestinal microorganisms in SD rats, hoping to provide a scientific theoretical basis for OE in maintaining human intestinal microbial homeostasis and improving public health issues such as SD in humans. In addition, this study lent insight to develop a natural plant-derived drug rich in flavonoid compounds, along with the potential to adjust intestinal bacteria, so as to improve the SD-caused body behaviors.

2. Materials and Methods

2.1. Ethics Statement

All animal experiments were conducted in line with the Guide for the Care and Use of Laboratory Animals and ratified by the Laboratory Animal Ethics Review Committee of Jiamusi University. Enormous efforts were made to minimize the animal quantity and their pain.

2.2. Experimental Animals

Healthy male Sprague-Dawley rats (aged 15 weeks and weighing 200 ± 20 g) purchased from Charles River [License No. SCXK (Beijing) 2016-0008, Beijing, China] were reared at 18–25°C and 40–60% humidity on 12 h light-dark cycles, with adequate food and water [5, 8], subjecting to adaptive feeding for one week.

2.3. Establishment of SD Models

A modified multiple platform method was used to establish rat models of SD [5]. Four small cylindrical platforms (6.5 cm diameter and 8 cm height) were fixed at the bottom of a self-made SD box (41 cm × 33 cm × 25 cm) with an interplatform spacing of 8 cm longitudinally and 12 cm transversely. The box was filled with water and the water surface was approximately 1.0 cm below the platform surface. The rats were placed on platforms where they had free access to moving, food, and water, with ample water and food on the top of the platforms. Additionally, the top of the box was covered with wire netting to prevent rats from escaping. The illumination of the 40-w fluorescent lamp was given from 6 : 50 to 18 : 50. The water temperature was maintained at 23–25°C, with water in the box changed every day to keep clean. When entering the rapid eye movement (REM) phase of sleep, the rat head would fall into the water due to muscle relaxation and reduced whole-body muscle tension, and then, the rats would wake up and try to climb up the platform to avoid drowning [22].

During the adaptive feeding, except the control group, rats in other groups received standing training in the SD box once a day for 1 h each. SD was processed starting on the 8th day, once a day for 12 h (6 : 50–18 : 50) each, lasting for 3 weeks. The general states of rats, such as mental status, circadian activity, coat color, and stress response, were observed, and the daily water consumption was recorded.

2.4. Drug Administration and Grouping

Totally 48 rats were randomly allocated into the following 6 groups (8 rats/group, rats were intragastrically injected with different drugs): control group (normal saline, 8 mL/kg/d), SD group (normal saline, 8 mL/kg/d), and positive control group (diazepam tablet suspension); and low-dose OE group (L-OE, 5 mg/kg/d), medium-dose OE group (M-OE, 10 mg/kg/d), and high-dose OE group (H-OE, 20 mg/kg/d) [33]. During the SD process, diazepam tablets and OEs were dissolved in normal saline to make into suspensions, which were intragastrically administrated into rats daily. The diazepam tablets were provided by Yimin Pharmaceutical (H11020898, Beijing, China), and the dose for rats was calculated to be 0.45 mg/kg/d based on 6.3 times of adult dosage. OE was provided by Biocar Biotechnology (Guangzhou, Guangdong, China), showed as brown fine powders.

After 3 weeks of SD, the open field test (OFT) and sucrose preference test (SPT) were conducted. The sample collection was performed the next morning after all behavioral experiments. Following anesthesia, blood was collected from the abdominal aorta of rats using a 10-mL vacuum blood collection tube (at least 5 mL per rat) and then allowed to stand for 30 min, followed by centrifugation at 3000 × g for 15 min to obtain the serum [33, 34]. In addition, rats were stimulated by tail lifting to promote defecation on the ultra-clean bench, with at least one grain of formed feces obtained from each rat. Each grain of feces was stored in a sterile cryopreservation tube, and the obtained serum and feces were placed in the −80°C freezer for subsequent analyses.

2.5. Determination of Body Weight

Rats were weighed using an electronic scale (Yajin Electronic Technology, Shanghai, China) on days 0, 7, 14, and 21 of the SD process, with the unit of g.

2.6. Open Field Test (OFT)

The OFT analysis was used for behavioral examination in rats. After 3 weeks of SD, rats were placed in an open box (100 cm × 100 cm × 40 cm). The bottom of the box was segmented into 25 equally sized grids (20 cm × 20 cm) with black lines, and the grids along the side walls were calculated as peripheral grids (16 pieces) and the rest were central grids (9 pieces). Subsequently, we manually counted the number of rats horizontally crossing the grids within 5 min (the scores of horizontal movements: 1 score, all four paws entered the grid, counted as 1 score/grid) and the number of rearing of hind limbs (the scores of vertical movement: 1 score, both forepaws rose high into the air or climbed the wall, counted as 1 score/time). The OFT scores were the sum of the above two. This test was conducted by two experimenters who did not know the grouping of experimental rats in advance. The scores recorded by the two experimenters were averaged to obtain the final score. Following the test for each rat, the open box was cleaned with 75% ethanol and thoroughly dried, after which the next rat was observed to avoid odors affecting the test results.

2.7. Sucrose Preference Test (SPT)

After 3 weeks of SD, rats were subjected to the SPT. Prior to the test, rats fasted and water was forbidden for 24 h. Subsequently, rats were given two bottles of water quantified in advance: one bottle of 1% sucrose water and the other bottle of pure water. Thirty min later, the positions of sucrose water and pure water were changed. Sixty min later, the water bottle was taken away and the weight was recorded. The proportion of sucrose water consumption (sucrose preference rate) = sucrose water consumption/total water consumption × 100%.

2.8. Enzyme-Linked Immunosorbent Assay (ELISA)

ELISA kits (Enzyme-linked Biotechnology, Shanghai, China) were used to determine the levels of noradrenaline (NE, ml002873), melatonin (MT, ml003417), interleukin (IL)-1β (ml037361), IL-6 (ml064292), tumor necrosis factor-α (TNF-α, ml002859), IL-4 (ml058093), IL-10 (ml028497) [22], and BGP-related indexes, including gastrin (GAS, ml862256), motilin (MTL, ml003079), cholecystokinin (CCK, ml003073), 5-hydroxytryptamine (5-HT, ml059511), and vasoactive intestinal peptide (VIP, ml936589) [8, 24].

2.9. Detection of Representative Intestinal Microorganisms

Fecal samples (0.2 g) were put into a 2-mL round-bottom centrifuge tube, and the total DNA was extracted from feces using fecal DNA extraction kits. The V3–V4 variable region sequences of the 16S rRNA gene in the four investigated intestinal bacteria (Bifidobacteria, Lactobacilli, Clostridium perfringens, and Bacteroidetes) acted as the targets. The primers were designed based on the conserved region in the sequence, and then, the amplification of polymerase chain reaction was processed as follows: 5 min at 95°C, then 25 cycles of 30 s at 95°C, 30 s at 50°C, 40 s at 72°C, and extension for 7 min at 72°C. Data were analyzed using the 2−ΔΔCt method, and the primers are exhibited in Table 1.

Table 1.

Primer sequences.

Intestinal bacteria Forward 5′–3′ Reverse 5′–3′
Bifidobacteria GATGCAACGCGAAGAACCTTACCT CTTAACCCAACATCTCACGACACGA
Lactobacilli GGGAGGCAGCAGTAGGGAATCTT GTTAGCCGTGACTTTCTGGTTGGAT
Clostridium perfringens GCGTAGAGATTAGGAAGAACACCAG TATTCATCGTTTACGGCGTGGACTA
Bacteroidetes AAAGGGAGCGTAGGTGGACAGTT TGCCTTCGCAATCGGAGTTCTTC

2.10. Statistical Analysis

All data were processed using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). Measurement data were exhibited as mean ± standard deviation. Data between two groups were analyzed by the independent sample t-test or one-way repeated measures analysis of variance (ANOVA). Comparisons between multiple groups were conducted using one-way ANOVA, and Tukey's multiple comparisons test was performed for the post hoc analysis. The p < 0.05 was regarded statistically significant.

3. Results

3.1. SD-Induced Depressive Behaviors in Rats

Growing reports have elicited the association between SD with depression- and anxiety-like behaviors [48, 49]. To assess the effect of SD on depressive behaviors in rats, we observed the general states of rats after SD modeling and then found that SD rats showed manifestations of excitement, irritability, listlessness, and reduced response to surrounding environmental stimuli, with irregular and dull coat color. Compared with the control group, the SD rats had significantly reduced body weight on days 7, 14, and 21 (p < 0.01) (Figure 1(a)) and diminished average daily water consumption (p < 0.01) (Figure 1(b)). In addition, the OFT results revealed that SD rats exhibited lower horizontal scores, vertical scores, and total scores than the control rats (p < 0.01) (Figures 1(c)1(e)). The SPT results unveiled that relative to the control group, SD rats had notably diminished sucrose preference rate (p < 0.01) (Figure 1(f)). Overall, SD could cause depressive behaviors in rats.

Figure 1.

Figure 1

SD-induced depressive behaviors in rats. SD rat models were established using a modified multiple platform method. (a) Assessment of body weight; (b) statistics of average daily water consumption; (c)–(e) assessment of OFT scores; (f) determination of sucrose preference rate. N = 8, data were expressed as mean ± standard deviation. Data comparisons in panel A were performed using one-way repeated measures ANOVA and data in panels B/C/D/E/F were analyzed using the independent sample t-test. ∗∗p < 0.01, ∗∗∗p < 0.001.

3.2. SD-Triggered Stress and Inflammatory Responses in Rats

It is noteworthy that SD affects the balance of inflammatory markers and cytokines [50, 51] and induces stress responses in mice [22, 52]. Next, we measured the serum levels of NE, MT, and inflammatory factors in SD and control rats by ELISA, and observed that SD rats presented prominently higher NE but lower MT than the control group (all p < 0.01) (Figures 2(a) and 2(b)). Additionally, compared with the control group, the levels of pro-inflammatory factors (IL-1β, IL-6, and TNF-α) were markedly elevated (p < 0.01) (Figures 2(c)2(e)), while the levels of anti-inflammatory cytokines (IL-4 and IL-10) were significantly diminished in the SD group (p < 0.01) (Figures 2(f) and 2(g)). In summary, SD could result in stress and inflammatory responses in rats.

Figure 2.

Figure 2

Effects of SD on stress and inflammatory responses in rats. (a)-(b) ELISA determined the serum levels of NE and MT; (c)–(g) ELISA measured the serum levels of inflammatory factors (IL-1β, IL-6, TNF-α, IL-4, and IL-10). N = 8, data were presented as mean ± standard deviation, and the independent sample t-test was used for comparisons between groups. ∗∗p < 0.01, ∗∗∗p < 0.001.

3.3. OE Improved Depressive Behaviors and Mitigated Stress and Inflammatory Responses in SD Rats

Preceding evidence has noted that okra polysaccharide produces antidepressant effects by preventing inflammation and balancing intestinal microflora [35]. To investigate the effects of OE on depressive behaviors, stress, and inflammatory responses in SD rats, we intragastrically administrated 5, 10, and 20 mg/kg/d OE into rats during the SD process. The results revealed that relative to the SD group, OE intervention noticeably maintained the elevation in rat body weight (p < 0.01), average daily water consumption, OFT scores, and sucrose preference rate (p < 0.01), while no differences were evident between the low-, medium-, and high-dose groups (all p > 0.05) and between the OE group and the diazepam group (all p > 0.05) (Figures 3(a)3(f)). Furthermore, after OE intervention, the NE level was significantly diminished, while the MT level was remarkably raised in SD rats, with statistically evident differences in NE and MT levels between the L-OE + SD group and the H-OE + SD group (all p < 0.01), but not between the L-OE + SD group and the M-OE + SD group (p > 0.05) (Figures 3(g) and 3(h)). Finally, we determined the inflammatory factor levels in rat serum and noted that OE attenuated the stimulatory effect of SD on serum cytokines, manifested by significantly reduced IL-1β, IL-6, and TNF-α, but there were no obvious differences in IL-1β and IL-6 between the M-OE/H-OE + SD groups and L-OE + SD group (all p > 0.05) and the difference in TNF-α level between the L-OE + SD group and H-OE + SD group was statistically evident (p < 0.01) (Figures 3(i)3(k)). Additionally, in comparison with the SD group, OE intervention clearly enhanced IL-4 and IL-10 (all p < 0.01) and no differences were significant in IL-4 level between the low-, medium-, and high-dose groups (p > 0.05), and IL-10 level was markedly higher in the H-OE + SD group than that in the L-OE + SD group (p < 0.01), and the OE group and the diazepam group showed no obvious differences (p > 0.05) (Figures 3(l) and 3(m)). Briefly, OE could ameliorate depressive behaviors and alleviate stress and inflammatory responses in SD rats.

Figure 3.

Figure 3

OE improved depressive behaviors and mitigated stress and inflammatory responses in SD rats. Rats were subjected to SD along with intragastric administration. (a) Assessment of body weight; (b) statistics of average daily water consumption; (c)–(e) assessment of OFT scores; (f) determination of sucrose preference rate; (g)-(h) measurement of NE and MT levels in serum; (i)–(m) ELISA determined the levels of inflammatory factors (IL-1β, IL-6, TNF-α, IL-4, and IL-10). N = 8, data were expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, followed by Tukey's test. Compared with the SD group, p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001; compared with the L-OE + SD group, #p < 0.05, ##p < 0.01.

3.4. OE Regulated the Secretion of BGPs in SD Rats

The insomnia-triggered anxiety behaviors have been identified to be related to changes in BGPs [12]. To assess the function of OE on BGPs in SD rats, we measured the serum levels of BGP-related indexes (GAS, MTL, 5-HT, VIP, and CCK) in rats using ELISA and noted that the SD group exhibited lower GAS, MTL, 5-HT, and VIP and higher CCK than the control group. However, OE intervention reversed the SD-induced changes in the above indexes. Meanwhile, we observed that the H-OE + SD group had higher GAS, 5-HT, and VIP than the L-OE + SD group, and M-OE/H-OE + SD groups exhibited a higher MTL level than the L-OE + SD group (all p < 0.01), but there was no evident difference in the CCK level among different dose groups and between the OE group and diazepam group (all p > 0.05) (Figures 4(a)4(e)). Taken together, OE could modulate the BGP generation in SD rats.

Figure 4.

Figure 4

Regulatory effect of OE on BGP secretion in SD rats. (a)–(e) GAS, MTL, 5-HT, VIP, and CCK levels measured by ELISA kits. N = 8, data were exhibited as mean ± standard deviation. One-way ANOVA was adopted for comparisons among multiple groups, followed by Tukey's test. SD group compared with the control group, ∗∗∗p < 0.001; OE groups compared with the SD group, &p < 0.05, &&p < 0.01, &&&p < 0.001; compared with the L-OE + SD group, #p < 0.05, ##p < 0.01.

3.5. Intervention Effects of OE on Representative Intestinal Microorganisms in SD Rats

Owing to the significance of intestinal microorganisms in physiological rhythm and sleep [13], we determined the DNA relative contents of four representative intestinal bacteria by RT-qPCR. Subsequently, we observed that compared with the control group, the DNA relative content of Bacteroidetes was clearly diminished in the SD group but raised after OE intervention, with significant differences between medium-/high-dose OE and low-dose OE (all p < 0.01) and no significant differences between the diazepam group and the OE group (p > 0.05) (Figure 5(a)).

Figure 5.

Figure 5

Intervention effects of OE on intestinal microorganisms in SD rats. (a)–(d) DNA relative contents of Bacteroidetes, Bifidobacteria, Lactobacilli, and Clostridium perfringens detected by RT-qPCR. N = 8, data were expressed as mean ± standard deviation. Comparisons between groups were conducted using one-way ANOVA, followed by Tukey's test. The SD group compared with the control group, ∗∗∗p < 0.001; OE groups compared with the SD group, &&p < 0.01; compared with the L-OE + SD group, #p < 0.05, ##p < 0.01.

Moreover, the SD group had noticeably lower DNA relative contents of probiotics (Bifidobacteria and Lactobacilli) than the control group (p < 0.01), indicating the obvious inhibition of SD on these two intestinal bacteria. After OE intervention, the DNA relative contents of Bifidobacteria and Lactobacilli increased significantly (p < 0.01), and this increase was greater in the H-OE + SD group than that in the L-OE + SD group (Figures 5(b) and 5(c)).

In addition, the DNA relative content of Clostridium perfringens was elevated in SD rats but reduced upon OE intervention, which was markedly lower in the M-OE/H-OE + SD groups than that in the L-OE + SD group (all p < 0.01), with no evident difference between the diazepam group and the OE group (p > 0.05) (Figure 5(b)). Altogether, OE exerted an intervention effect on representative intestinal microorganisms in SD rats.

4. Discussion

Sleep is essential for physiological homeostasis maintenance, health, and life quality, but SD is a growing health issue in contemporary society [53, 54]. Recently, the relevant research about SD mainly focuses on the cognitive function of the brain, and for instance, SD is reported to disrupt the plasticity and transmission of synapses, resulting in memory impairment [55]. Propofol alleviates learning and memory impairment in SD rats by suppressing autophagy in hippocampal neurons [6]. Chronic SD causes memory impairment, and selenium treatment improves antioxidant enzyme activity in the hippocampus [56]. Compelling evidence has identified that the gut microbiome influences sleep quality via the brain-gut-microbiome axis [15]. Importantly, the components of okra, such as polysaccharides and pectin, could regulate intestinal flora [57]. The current study highlighted the intervention effects of OE on BGPs and intestinal microorganisms in SD rats.

SD is reported to have numerous negative effects, including cognitive deficits, impaired performance, personal conflicts, mood disturbances, and poor communication with family [58]. A preceding meta-analysis has suggested that SD can exacerbate depression-like behaviors [59]. A core symptom of depression-anhedonia that refers to the inability to experience pleasure from enjoyable or rewarding activities can be evaluated by the SPT assay, and the OFT experiment is a test of anxiety-related behaviors and locomotion [60]. Herein, we estimated the association between SD and depressive behaviors. Our results noted that SD rats exhibited decreased body weight, daily water consumption, OFT scores, and sucrose preference rate. In line with our findings, mice subjected to prolonged paradoxical SD exhibited depressive-like behaviors and decreased locomotive activity and sucrose preference rate [61]. Additionally, SD rats exhibited anxiety-like behavior during OFT and depression-like behaviors in the forced swim test [62]. Intriguingly, 96 h of REM-SD enhanced caloric intake but reduced body weight in rats [63]. Conjointly, SD could provoke depressive behaviors in rats.

Growing reports have revealed that SD could increase oxidative stress and inflammatory markers [64, 65]. Stress normally results in sleep loss which, in turn, could aggravate physiological stress responses [66]. MT is an acknowledged free radical scavenger with powerful antioxidant and antistress functions [67, 68]. NE is involved in stress responses and stressful stimuli could induce an increased NE level in the prefrontal cortex [69]. Due to the intrinsic impacts of SD on inflammation and stress response, we detected the relevant indexes. Unsurprisingly, SD rats had elevated NE; diminished MT; raised IL-1β, IL-6, and TNF-α; and reduced IL-4 and IL-10. Consistently, previous findings supported that SD exacerbates inflammatory responses, featured by an elevation of pro-inflammatory mediators including IL-1β, IL-6, IL-17, and TNF-α in humans and animals [22, 70, 71]. Briefly, the above evidence and findings confirmed that SD caused stress and inflammatory responses in rats.

Apart from the nutritious feature, okra possesses antioxidant, immunomodulation, and antifatigue effects, exerting health-promoting properties [72]. To assess the role of OE in SD rats, we intragastrically injected different doses of OE into SD rats. Afterwards, we observed that OE intervention enhanced body weight, daily water consumption, OFT scores, and sucrose preference rate in SD rats. Additionally, OE treatment lowered NE; increased MT; diminished IL-1β, IL-6, and TNF-α; and elevated IL-4 and IL-10 in SD rats. Importantly, accumulating studies have evidenced the antidepressant effects of numerous herbs [7375]. OE, abundant in antioxidant substances, suppresses oxidative stress by avoiding the excessive consumption of antioxidant enzymes [76]. Moreover, okra is a truly promising natural ingredient to reduce inflammation in individuals with inflammation-predisposed disorders, with the potential to diminish C-reactive protein, IL-1β, IL-6, and TNF-α [77]. In particular, flavonoid, one of the most pivotal components of okra, is responsible for the antioxidant and anti-inflammatory effects [39]. Compelling evidence suggests that the total flavonoid extract of flowers of Abelmoschus manihot (L.) Medicus alleviates acute lung injury in mice by inhibiting inflammation and oxidative stress [78]. In addition, total flavonoids extracted from flowers of Abelmoschus manihot can protect mice against carbon tetrachloride-induced liver injury via antioxidant stress and anti-inflammatory properties [79]. Collectively, OE intervention mitigated the SD-evoked depressive behaviors and stress and inflammatory responses in rats.

The possible involvement of brain-gut interactions in insomnia treatment has been confirmed [80]. Subsequently, we determined the BGP-related indicators and unraveled that GAS, MTL, 5-HT, and VIP levels were decreased, and the CCK level was increased in SD rats, while these SD-caused changes were annulled by OE intervention. GAS is a brain-gut peptide that is widely known for its growth hormone-releasing and orexigenic activities, which participates in sleep regulation [81]. Central 5-HT limits apnea and stabilizes breathing by reducing cholinergic signaling through muscarinic receptors [82]. However, the studies about the function of OE in regulating BGPs are limited, and our findings creatively documented that OE could regulate the BGP secretion in SD rats.

Sleep duration and quality may be essential targets for keeping healthy gut microbiota composition [16], and sleep disorders are also linked with changes in gut microbiota composition in animal and adult human models [83]. Lactobacilli and Bifidobacteria are beneficial bacteria in the gut [15, 84, 85], and Lactobacillus fermentum can improve sleep conditions in mice and effectively reduce sleep latency and the time to return to normal REM sleep [86]. Moreover, the combination of living Bifidobacterium and Lactobacillus mitigates anxiety- and depression-like behaviors in mice [87]. On a separate note, Clostridium perfringens is a class of harmful bacteria present in the gut [88], which can lead to intestinal dysbacteriosis [89]. We then detected the DNA relative contents of four intestinal bacteria. The RT-qPCR results unveiled that SD rats showed elevated DNA relative contents of Clostridium perfringens and diminished Bacteroidetes, Bifidobacteria, and Lactobacilli. By contrast, OE reversed the above SD-elicited changes in intestinal bacteria. Preceding evidence has noted that okra pectin palliates inflammatory responses and protects the intestinal mucosal barrier function by increasing the content of intestinal antibacterial peptides [57]. Moreover, okra seed oil notably enhances the Bacteroidetes population and maintains intestinal eubiosis in ethanol-treated mice [34]. The main active ingredient of okra fruit extract is flavonoid. It is broadly acknowledged that flavonoid compounds can modulate intestinal bacteria [44, 45, 47, 90]. Specifically, baicalin, a plant-derived flavonoid, has a variety of biological activities, which inhibits lung injury by manipulating the production of intestinal bacteria and short-chain fatty acids [91], improves metabolic abnormalities and intestinal bacteria, and reduces diet-induced metabolic syndrome [92]. Interestingly, total flavonoids of Abelmoschus manihot effectively ameliorate the ulcerative colitis aggravated by chronic stress and improve depressive-like phenotype, disturbed intestinal flora, and intestinal barrier function in chronic stress mice [93]. The aforementioned results supported the intervention effects of OE on intestinal microorganisms in SD rats. Additionally, in all experiments, OE exhibited similar intervention effects to diazepam tablets (positive control), one of the widely prescribed sedative drugs for the treatment of anxiety and sleep disorders [94, 95].

In conclusion, we explored the effects of SD on physiological and behavioral aspects in rats and assessed the changes in stress and inflammatory responses in SD rats. Meanwhile, we concomitantly treated rats with OE during the SD process to innovatively highlight the intervention effects of OE on BGPs and intestinal microorganisms in SD rats. Starting from intestinal microorganisms, the study provided a new entry point for SD treatment. However, this study only conducted the preliminary exploration and lacked in-depth study. Additionally, the percentage of flavonoid compounds in the okra fruit extract and the effects of OE on human health remain to be explored in-depth. Therefore, future studies shall investigate the regulatory mechanism of OE in affecting intestinal microorganisms and BGPs at the molecular level. Moreover, from the perspective of the brain-gut axis, more studies on the relationship between intestinal microorganisms and BGPs are warranted and we shall further estimate the association between intestinal microorganisms and sleep. Furthermore, the flavonoid compounds require to be isolated from okra fruit to investigate their regulatory effects on brain-gut peptides and intestinal microorganisms in SD rats. Exploring the regulatory effects of OE on human intestinal microorganisms and its effects on human health (such as dose and side effects) is also important.

Acknowledgments

This work was supported by Heilongjiang Province Key R & D Program Guidance Projects (GZ20210033), the Natural Science Foundation of Heilongjiang Province (LH2021H104), and Jiamusi University Doctoral Special Research Fund (JMSUBZ2020-15).

Data Availability

All data generated or analyzed during this study are included in the article and can be obtained from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors' Contributions

JW and MC contributed to the study concepts and study design; JW and MH contributed to the literature research; JW, MH, and JX contributed to the experimental studies and data acquisition; MC, HZ, and YY contributed to the data analysis and statistical analysis; JW and MC contributed to the manuscript preparation; HZ contributed to the manuscript editing and review; all authors read and approved the final manuscript.

References

  • 1.Campos-Beltran D., Marshall L. Changes in sleep EEG with aging in humans and rodents. Pfluegers Archiv European Journal of Physiology . 2021;473(5):841–851. doi: 10.1007/s00424-021-02545-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Albakri U., Drotos E., Meertens R. Sleep health promotion interventions and their effectiveness: an umbrella review. International Journal of Environmental Research and Public Health . 2021;18(11):p. 5533. doi: 10.3390/ijerph18115533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liew S. C., Aung T. Sleep deprivation and its association with diseases-a review. Sleep Medicine . 2021;77:192–204. doi: 10.1016/j.sleep.2020.07.048. [DOI] [PubMed] [Google Scholar]
  • 4.Abrams R. M. Sleep deprivation. Obstetrics & Gynecology Clinics of North America . 2015;42(3):493–506. doi: 10.1016/j.ogc.2015.05.013. [DOI] [PubMed] [Google Scholar]
  • 5.Xu S., Zhang Y., Xu Z., Song L. Effect of the cPKCγ-ng signaling system on rapid eye movement sleep deprivation-induced learning and memory impairment in rats. Frontiers in Psychiatry . 2021;12 doi: 10.3389/fpsyt.2021.763032.763032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dai W., Xiao Y., Tu Y., et al. Propofol protects hippocampal neurons in sleep-deprived rats by inhibiting mitophagy and autophagy. Annals of Translational Medicine . 2021;9(18):p. 1427. doi: 10.21037/atm-21-3872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Orzel-Gryglewska J. Consequences of sleep deprivation. International Journal of Occupational Medicine & Environmental Health . 2010;23(1):95–114. doi: 10.2478/v10001-010-0004-9. [DOI] [PubMed] [Google Scholar]
  • 8.Xue Z., Wu C., Wei J., et al. An orally administered magnoloside A ameliorates functional dyspepsia by modulating brain-gut peptides and gut microbiota. Life Sciences . 2019;233 doi: 10.1016/j.lfs.2019.116749.116749 [DOI] [PubMed] [Google Scholar]
  • 9.Han W., Jin F., Zhang H., et al. Association of brain-gut peptides with inflammatory cytokines in moyamoya disease. Mediators of Inflammation . 2020;2020:9. doi: 10.1155/2020/5847478.5847478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dong D., Xie J., Wang J. Neuroprotective effects of brain-gut peptides: a potential therapy for Parkinson’s disease. Neuroscience Bulletin . 2019;35(6):1085–1096. doi: 10.1007/s12264-019-00407-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yu J., Min D., Bai Y., Qu L., Zou T., Wang S. Electroacupuncture alleviates parkinson disease and regulates the expression of brain-gut peptides. Experimental Animals . 2020;69(4):448–460. doi: 10.1538/expanim.19-0153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Song Y., Li F., Wang L., et al. Effects of Wen Dan Tang on insomnia-related anxiety and levels of the brain-gut peptide Ghrelin. Neural Regeneration Research . 2014;9(2):205–212. doi: 10.4103/1673-5374.125351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wagner-Skacel J., Dalkner N., Moerkl S., et al. Sleep and microbiome in psychiatric diseases. Nutrients . 2020;12(8) doi: 10.3390/nu12082198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Person H., Keefer L. Psychological comorbidity in gastrointestinal diseases: update on the brain-gut-microbiome axis. Progress in Neuro-Psychopharmacology and Biological Psychiatry . 2021;107 doi: 10.1016/j.pnpbp.2020.110209.110209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Smith R. P., Easson C., Lyle S. M., et al. Gut microbiome diversity is associated with sleep physiology in humans. PLoS One . 2019;14(10) doi: 10.1371/journal.pone.0222394.e0222394 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Matenchuk B. A., Mandhane P. J., Kozyrskyj A. L. Sleep, circadian rhythm, and gut microbiota. Sleep Medicine Reviews . 2020;53 doi: 10.1016/j.smrv.2020.101340.101340 [DOI] [PubMed] [Google Scholar]
  • 17.Gao T., Wang Z., Cao J., Dong Y., Chen Y. Melatonin ameliorates corticosterone-mediated oxidative stress-induced colitis in sleep-deprived mice involving gut microbiota. Oxidative Medicine and Cellular Longevity . 2021;2021:24. doi: 10.1155/2021/9981480.9981480 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gao T., Wang Z., Cao J., Dong Y., Chen Y. Melatonin attenuates microbiota dysbiosis of jejunum in short-term sleep deprived mice. Journal of Microbiology . 2020;58(7):588–597. doi: 10.1007/s12275-020-0094-4. [DOI] [PubMed] [Google Scholar]
  • 19.El Aidy S., Bolsius Y. G., Raven F., Havekes R. A brief period of sleep deprivation leads to subtle changes in mouse gut microbiota. Journal of Sleep Research . 2020;29(6) doi: 10.1111/jsr.12920.e12920 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang Z., Chen W. H., Li S. X., et al. Gut microbiota modulates the inflammatory response and cognitive impairment induced by sleep deprivation. Molecular Psychiatry . 2021;26(11):6277–6292. doi: 10.1038/s41380-021-01113-1. [DOI] [PubMed] [Google Scholar]
  • 21.Sun Y., Zhang H. J., Chen R., Zhao H. B., Lee W. H. 16S rDNA analysis of the intestinal microbes in osteoporotic rats. Bioscience of Microbiota, Food and Health . 2021;40(3) doi: 10.12938/bmfh.2020-065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gao T., Wang Z., Dong Y., et al. Role of melatonin in sleep deprivation-induced intestinal barrier dysfunction in mice. Journal of Pineal Research . 2019;67(1) doi: 10.1111/jpi.12574.e12574 [DOI] [PubMed] [Google Scholar]
  • 23.Sun M., Ma K., Wen J., et al. A review of the brain-gut-microbiome axis and the potential role of microbiota in Alzheimer’s disease. Journal of Alzheimer’s Disease . 2020;73(3):849–865. doi: 10.3233/jad-190872. [DOI] [PubMed] [Google Scholar]
  • 24.He Y., Yang C., Wang P., et al. Child compound endothelium corneum attenuates gastrointestinal dysmotility through regulating the homeostasis of brain-gut-microbiota axis in functional dyspepsia rats. Journal of Ethnopharmacology . 2019;240 doi: 10.1016/j.jep.2019.111953.111953 [DOI] [PubMed] [Google Scholar]
  • 25.Wu Y., He H., Cheng Z., Bai Y., Ma X. The role of neuropeptide Y and peptide YY in the development of obesity via gut-brain Axis. Current Protein & Peptide Science . 2019;20(7):750–758. doi: 10.2174/1389203720666190125105401. [DOI] [PubMed] [Google Scholar]
  • 26.Hu X. F., Zhang W. Y., Wen Q., et al. Fecal microbiota transplantation alleviates myocardial damage in myocarditis by restoring the microbiota composition. Pharmacological Research . 2019;139:412–421. doi: 10.1016/j.phrs.2018.11.042. [DOI] [PubMed] [Google Scholar]
  • 27.Hall A. B., Tolonen A. C., Xavier R. J. Human genetic variation and the gut microbiome in disease. Nature Reviews Genetics . 2017;18(11):690–699. doi: 10.1038/nrg.2017.63. [DOI] [PubMed] [Google Scholar]
  • 28.Wu D. T., Nie X. R., Shen D. D., et al. Phenolic compounds, antioxidant activities, and inhibitory effects on digestive enzymes of different cultivars of okra (Abelmoschus esculentus) Molecules . 2020;25(6):p. 1276. doi: 10.3390/molecules25061276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.D’Urso G., Napolitano A., Cannavacciuolo C., Masullo M., Piacente S. Okra fruit: LC-ESI/LTQOrbitrap/MS/MS(n) based deep insight on polar lipids and specialized metabolites with evaluation of anti-oxidant and anti-hyperglycemic activity. Food & Function . 2020;11(9):7856–7865. doi: 10.1039/d0fo00867b. [DOI] [PubMed] [Google Scholar]
  • 30.Petropoulos S., Fernandes A., Barros L., Ferreira I. C. Chemical composition, nutritional value and antioxidant properties of Mediterranean okra genotypes in relation to harvest stage. Food Chemistry . 2018;242:466–474. doi: 10.1016/j.foodchem.2017.09.082. [DOI] [PubMed] [Google Scholar]
  • 31.Arapitsas P. Identification and quantification of polyphenolic compounds from okra seeds and skins. Food Chemistry . 2008;110(4):1041–1045. doi: 10.1016/j.foodchem.2008.03.014. [DOI] [PubMed] [Google Scholar]
  • 32.Yasin H., Tariq F., Sameen A., et al. Ethanolic extract of okra has a potential gastroprotective effect on acute gastric lesions in sprague dawley rats. Food Sciences and Nutrition . 2020;8(12):6691–6698. doi: 10.1002/fsn3.1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang J., Zhao Y., Ren D., Yang X. Effect of okra fruit powder supplementation on metabolic syndrome and gut microbiota diversity in high fat diet-induced obese mice. Food Research International . 2020;130 doi: 10.1016/j.foodres.2019.108929.108929 [DOI] [PubMed] [Google Scholar]
  • 34.Zhang J., Lu Y., Yang X., Zhao Y. Supplementation of okra seed oil ameliorates ethanol-induced liver injury and modulates gut microbiota dysbiosis in mice. Food & Function . 2019;10(10):6385–6398. doi: 10.1039/c9fo00189a. [DOI] [PubMed] [Google Scholar]
  • 35.Yan T., Nian T., Liao Z., et al. Antidepressant effects of a polysaccharide from okra (Abelmoschus esculentus (L) Moench) by anti-inflammation and rebalancing the gut microbiota. International Journal of Biological Macromolecules . 2020;144:427–440. doi: 10.1016/j.ijbiomac.2019.12.138. [DOI] [PubMed] [Google Scholar]
  • 36.Gul M. Z., Bhakshu L. M., Ahmad F., Kondapi A. K., Qureshi I. A., Ghazi I. A. Evaluation of Abelmoschus moschatus extracts for antioxidant, free radical scavenging, antimicrobial and antiproliferative activities using in vitro assays. BMC Complementary and Alternative Medicine . 2011;11(1):p. 64. doi: 10.1186/1472-6882-11-64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sipahi H., Orak D., Reis R., et al. A comprehensive study to evaluate the wound healing potential of okra (Abelmoschus esculentus) fruit. Journal of Ethnopharmacology . 2022;287 doi: 10.1016/j.jep.2021.114843.114843 [DOI] [PubMed] [Google Scholar]
  • 38.Peter E. L., Nagendrappa P. B., Ajayi C. O., Sesaazi C. D. Total polyphenols and antihyperglycemic activity of aqueous fruits extract of Abelmoschus esculentus: modeling and optimization of extraction conditions. PLoS One . 2021;16(4) doi: 10.1371/journal.pone.0250405.e0250405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Nasrollahi Z., ShahaniPour K., Monajemi R., Ahadi A. M. Abelmoschus esculentus (L.) Moench improved blood glucose, lipid, and down-regulated PPAR-alpha, PTP1B genes expression in diabetic rats. Journal of Food Biochemistry . 2022;46(7) doi: 10.1111/jfbc.14097.e14097 [DOI] [PubMed] [Google Scholar]
  • 40.Yuan K., Liao H., Dong W., Shi X., Liu H. Analysis and comparison of the active components and antioxidant activities of extracts from Abelmoschus esculentus L. Pharmacognosy Magazine . 2012;8(30):156–161. doi: 10.4103/0973-1296.96570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Thanakosai W., Phuwapraisirisan P. First identification of alpha-glucosidase inhibitors from okra (Abelmoschus esculentus) seeds. Natural Product Communications . 2013;8(8) doi: 10.1177/1934578x1300800813. [DOI] [PubMed] [Google Scholar]
  • 42.Liu I. M., Liou S. S., Lan T. W., Hsu F. L., Cheng J. T. Myricetin as the active principle of Abelmoschus moschatus to lower plasma glucose in streptozotocin-induced diabetic rats. Planta Medica . 2005;71(7):617–621. doi: 10.1055/s-2005-871266. [DOI] [PubMed] [Google Scholar]
  • 43.Yuan K., Liao H., Liu H. A new flavonol glycoside from the Abelmoschus esculentus Linn. Pharmacognosy Magazine . 2012;8(29):12–15. doi: 10.4103/0973-1296.93303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wang M., Yu F., Zhang Y., Chang W., Zhou M. The effects and mechanisms of flavonoids on cancer prevention and therapy: focus on gut microbiota. International Journal of Biological Sciences . 2022;18(4):1451–1475. doi: 10.7150/ijbs.68170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.He B., Jiang J., Shi Z., et al. Pure total flavonoids from citrus attenuate non-alcoholic steatohepatitis via regulating the gut microbiota and bile acid metabolism in mice. Biomedicine & Pharmacotherapy . 2021;135 doi: 10.1016/j.biopha.2020.111183.111183 [DOI] [PubMed] [Google Scholar]
  • 46.Fan L., Zhao X., Tong Q., et al. Interactions of dihydromyricetin, a flavonoid from vine tea (ampelopsis grossedentata) with gut microbiota. Journal of Food Science . 2018;83(5):1444–1453. doi: 10.1111/1750-3841.14128. [DOI] [PubMed] [Google Scholar]
  • 47.Duan R., Guan X., Huang K., et al. Flavonoids from whole-grain oat alleviated high-fat diet-induced hyperlipidemia via regulating bile acid metabolism and gut microbiota in mice. Journal of Agricultural and Food Chemistry . 2021;69(27):7629–7640. doi: 10.1021/acs.jafc.1c01813. [DOI] [PubMed] [Google Scholar]
  • 48.Rahmani M., Rahmani F., Rezaei N. The brain-derived neurotrophic factor: missing link between sleep deprivation, insomnia, and depression. Neurochemical Research . 2020;45(2):221–231. doi: 10.1007/s11064-019-02914-1. [DOI] [PubMed] [Google Scholar]
  • 49.Kang X., Jiang L., Lan F., et al. Hydrogen sulfide antagonizes sleep deprivation-induced depression- and anxiety-like behaviors by inhibiting neuroinflammation in a hippocampal Sirt1-dependent manner. Brain Research Bulletin . 2021;177:194–202. doi: 10.1016/j.brainresbull.2021.10.002. [DOI] [PubMed] [Google Scholar]
  • 50.Wright K. P., Drake A. L., Frey D. J., et al. Influence of sleep deprivation and circadian misalignment on cortisol, inflammatory markers, and cytokine balance. Brain, Behavior, and Immunity . 2015;47:24–34. doi: 10.1016/j.bbi.2015.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Irwin M. R., Olmstead R., Carroll J. E. Sleep disturbance, sleep duration, and inflammation: a systematic review and meta-analysis of cohort studies and experimental sleep deprivation. Biological Psychiatry . 2016;80(1):40–52. doi: 10.1016/j.biopsych.2015.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Xue R., Wan Y., Sun X., Zhang X., Gao W., Wu W. Nicotinic mitigation of neuroinflammation and oxidative stress after chronic sleep deprivation. Frontiers in Immunology . 2019;10:p. 2546. doi: 10.3389/fimmu.2019.02546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Liebich T., Lack L., Hansen K., et al. A systematic review and meta-analysis of wind turbine noise effects on sleep using validated objective and subjective sleep assessments. Journal of Sleep Research . 2021;30(4) doi: 10.1111/jsr.13228.e13228 [DOI] [PubMed] [Google Scholar]
  • 54.Cherubini J. M., Cheng J. L., Williams J. S., MacDonald M. J. Sleep deprivation and endothelial function: reconciling seminal evidence with recent perspectives. American Journal of Physiology—Heart and Circulatory Physiology . 2021;320(1):H29–H35. doi: 10.1152/ajpheart.00607.2020. [DOI] [PubMed] [Google Scholar]
  • 55.Looti Bashiyan M., Nasehi M., Vaseghi S., Khalifeh S. Investigating the effect of crocin on memory deficits induced by total sleep deprivation (TSD) with respect to the BDNF, TrkB and ERK levels in the hippocampus of male Wistar rats. Journal of Psychopharmacology . 2021;35(6):744–754. doi: 10.1177/02698811211000762. [DOI] [PubMed] [Google Scholar]
  • 56.Massadeh A. M., Alzoubi K. H., Milhem A. M., Rababa’h A. M., Khabour O. F. Evaluating the effect of selenium on spatial memory impairment induced by sleep deprivation. Physiology & Behavior . 2022;244 doi: 10.1016/j.physbeh.2021.113669.113669 [DOI] [PubMed] [Google Scholar]
  • 57.Xiong B., Zhang W., Wu Z., et al. Okra pectin relieves inflammatory response and protects damaged intestinal barrier in caerulein-induced acute pancreatic model. Journal of the Science of Food and Agriculture . 2021;101(3):863–870. doi: 10.1002/jsfa.10693. [DOI] [PubMed] [Google Scholar]
  • 58.Sandoval Y., Lobo A. S., Somers V. K., et al. Sleep deprivation in interventional cardiology: implications for patient care and physician-health. Catheterization and Cardiovascular Interventions . 2018;91(5):905–910. doi: 10.1002/ccd.27185. [DOI] [PubMed] [Google Scholar]
  • 59.Hu B., Liu C., Lv T., et al. Meta-analysis of sleep deprivation effects on depression in rodents. Brain Research . 2022;1782 doi: 10.1016/j.brainres.2022.147841.147841 [DOI] [PubMed] [Google Scholar]
  • 60.Wang W., Zheng L., Xu L., Tu J., Gu X. Pinocembrin mitigates depressive-like behaviors induced by chronic unpredictable mild stress through ameliorating neuroinflammation and apoptosis. Molecular Medicine . 2020;26(1) doi: 10.1186/s10020-020-00179-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Wang Z., Chen L., Zhang L., Wang X. Paradoxical sleep deprivation modulates depressive-like behaviors by regulating the MAOA levels in the amygdala and hippocampus. Brain Research . 2017;1664:17–24. doi: 10.1016/j.brainres.2017.03.022. [DOI] [PubMed] [Google Scholar]
  • 62.Lai W. D., Tung T. H., Teng C. Y., et al. Fish oil ameliorates neuropsychiatric behaviors and gut dysbiosis by elevating selected microbiota-derived metabolites and tissue tight junctions in rats under chronic sleep deprivation. Food & Function . 2022;13(5):2662–2680. doi: 10.1039/d2fo00181k. [DOI] [PubMed] [Google Scholar]
  • 63.Venancio D. P., Suchecki D. Prolonged REM sleep restriction induces metabolic syndrome-related changes: mediation by pro-inflammatory cytokines. Brain, Behavior, and Immunity . 2015;47:109–117. doi: 10.1016/j.bbi.2014.12.002. [DOI] [PubMed] [Google Scholar]
  • 64.DeMartino T., Ghoul R. E., Wang L., et al. Oxidative stress and inflammation differentially elevated in objective versus habitual subjective reduced sleep duration in obstructive sleep apnea. Sleep . 2016;39(7):1361–1369. doi: 10.5665/sleep.5964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Andrabi M., Andrabi M. M., Kunjunni R., et al. Lithium acts to modulate abnormalities at behavioral, cellular, and molecular levels in sleep deprivation-induced mania-like behavior. Bipolar Disorders . 2020;22(3):266–280. doi: 10.1111/bdi.12838. [DOI] [PubMed] [Google Scholar]
  • 66.Chiem E., Nichols I., Van C., Kori S., Paul K. Sleep loss mediates the effect of stress on nitrergic signaling in female mice. Neuroscience Letters . 2021;740 doi: 10.1016/j.neulet.2020.135362.135362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Ren B. C., Zhang W., Zhang W., Ma J. X., Pei F., Li B. Y. Melatonin attenuates aortic oxidative stress injury and apoptosis in STZ-diabetes rats by Notch1/Hes1 pathway. The Journal of Steroid Biochemistry and Molecular Biology . 2021;212 doi: 10.1016/j.jsbmb.2021.105948.105948 [DOI] [PubMed] [Google Scholar]
  • 68.Lunkes L. C., Paiva I. M., Egger R. C., et al. Melatonin administration attenuates acute stress by inducing sleep state in zebrafish (Danio rerio) Comparative Biochemistry and Physiology—Part C: Toxicology & Pharmacology . 2021;246 doi: 10.1016/j.cbpc.2021.109044.109044 [DOI] [PubMed] [Google Scholar]
  • 69.Kaneko F., Kawahara Y., Kishikawa Y., et al. Long-term citalopram treatment alters the stress responses of the cortical dopamine and noradrenaline systems: the role of cortical 5-ht1a receptors. International Journal of Neuropsychopharmacology . 2016;19(8) doi: 10.1093/ijnp/pyw026.pyw026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Yang H., Li X., Zhang L., Xue F., Zheng J. Immunomodulatory effects of sleep deprivation at different timing of psoriasiform process on skin inflammation. Biochemical and Biophysical Research Communications . 2019;513(2):452–459. doi: 10.1016/j.bbrc.2019.03.185. [DOI] [PubMed] [Google Scholar]
  • 71.Bajaj P., Kaur G. Acute sleep deprivation-induced anxiety and disruption of hypothalamic cell survival and plasticity: a mechanistic study of protection by butanol extract of tinospora cordifolia. Neurochemical Research . 2022;47 doi: 10.1007/s11064-022-03562-8. [DOI] [PubMed] [Google Scholar]
  • 72.Zhu X. M., Xu R., Wang H., Chen J. Y., Tu Z. C. Structural properties, bioactivities, and applications of polysaccharides from okra [Abelmoschus esculentus (L.) moench]: a review. Journal of Agricultural and Food Chemistry . 2020;68(48):14091–14103. doi: 10.1021/acs.jafc.0c04475. [DOI] [PubMed] [Google Scholar]
  • 73.Zhou Y., Li T., Zhu S., Gong W., Qin X., Du G. Study on antidepressant mechanism of radix bupleuri-radix paeoniae alba herb pair by metabonomics combined with 1H nuclear magnetic resonance and ultra-high-performance liquid chromatography-tandem mass spectrometry detection technology. Journal of Pharmacy and Pharmacology . 2021;73(9):1262–1273. doi: 10.1093/jpp/rgab061. [DOI] [PubMed] [Google Scholar]
  • 74.Zhang W., Chen L., Li P., Zhao J., Duan J. Antidepressant and immunosuppressive activities of two polysaccharides from Poria cocos (Schw.) Wolf. International Journal of Biological Macromolecules . 2018;120:1696–1704. doi: 10.1016/j.ijbiomac.2018.09.171. [DOI] [PubMed] [Google Scholar]
  • 75.Cassani J., Alberto Ferreyra-Cruz O., María Dorantes-Barrón A., Vigueras Villaseñor R. M., Arrieta-Baez D., Estrada-Reyes R. Antidepressant-like and toxicological effects of a standardized aqueous extract of Chrysactinia mexicana A. gray (Asteraceae) in mice. Journal of Ethnopharmacology . 2015;171:295–306. doi: 10.1016/j.jep.2015.05.055. [DOI] [PubMed] [Google Scholar]
  • 76.Tian Z. H., Miao F. T., Zhang X., Wang Q. H., Lei N., Guo L. C. Therapeutic effect of okra extract on gestational diabetes mellitus rats induced by streptozotocin. Asian Pacific Journal of Tropical Medicine . 2015;8(12):1038–1042. doi: 10.1016/j.apjtm.2015.11.002. [DOI] [PubMed] [Google Scholar]
  • 77.Malek Mahdavi A., Javadivala Z., Ahmadian E. Effects of okra (Abelmoschus esculentus L) on inflammatory mediators: a systematic review of preclinical studies. Food & Function . 2022;13(6):3159–3169. doi: 10.1039/d1fo03915f. [DOI] [PubMed] [Google Scholar]
  • 78.Deng J., He Z., Li X., et al. Huangkui capsule attenuates lipopolysaccharide-induced acute lung injury and macrophage activation by suppressing inflammation and oxidative stress in mice. Evidence-Based Complementary and Alternative Medicine . 2021;2021:11. doi: 10.1155/2021/6626483.6626483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Ai G., Liu Q., Hua W., Huang Z., Wang D. Hepatoprotective evaluation of the total flavonoids extracted from flowers of Abelmoschus manihot (L.) Medic: in vitro and in vivo studies. Journal of Ethnopharmacology . 2013;146(3):794–802. doi: 10.1016/j.jep.2013.02.005. [DOI] [PubMed] [Google Scholar]
  • 80.Zhang Y., Cong D., Liu P., et al. Study on the mechanism of regulating the hypothalamic cortical hormone releasing hormone/corticotropin releasing hormone type I receptor pathway by vibro-annular abdominal massage under the brain-intestine interaction in the treatment of insomnia. Medicine (Baltimore) . 2021;100(19) doi: 10.1097/md.0000000000025854.e25854 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Szentirmai E. Central but not systemic administration of ghrelin induces wakefulness in mice. PLoS One . 2012;7(7) doi: 10.1371/journal.pone.0041172.e41172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Davis M. R., Magnusson J. L., Cummings K. J. Increased central cholinergic drive contributes to the apneas of serotonin-deficient rat pups during active sleep. Journal of Applied Physiology (1985) . 2019;126(5):1175–1183. doi: 10.1152/japplphysiol.00909.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Schoch S. F., Castro-Mejia J. L., Krych L., et al. From Alpha Diversity to Zzz: interactions among sleep, the brain, and gut microbiota in the first year of life. Progress in Neurobiology . 2022;209 doi: 10.1016/j.pneurobio.2021.102208.102208 [DOI] [PubMed] [Google Scholar]
  • 84.Ran X., Dou D., Chen H., Ren G. The correlations of adverse effect and tonifying effect of ginseng medicines. Journal of Ethnopharmacology . 2022;291 doi: 10.1016/j.jep.2022.115113.115113 [DOI] [PubMed] [Google Scholar]
  • 85.Qiao B., Li X., Zheng T., Tan Z. Different effects of lard and vegetable blend oil on intestinal microorganisms, enzyme activity and blood routine in mice. Journal of Oleo Science . 2022;71(2) doi: 10.5650/jos.ess21247. [DOI] [PubMed] [Google Scholar]
  • 86.Lin A., Shih C. T., Chu H. F., et al. Lactobacillus fermentum PS150 promotes non-rapid eye movement sleep in the first night effect of mice. Scientific Reports . 2021;11(1) doi: 10.1038/s41598-021-95659-3.16313 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Xie J., Yuan Y., Tan H., et al. The combination of living Bifidobacterium, Lactobacillus, and Streptococcus improves social ranking and relieves anxiety-like behaviors in competitive mice in a social dominance tube test. Brain and Behavior . 2022;12(1) doi: 10.1002/brb3.2453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Park I., Oh S., Nam H., Celi P., Lillehoj H. S. Antimicrobial activity of sophorolipids against Eimeria maxima and Clostridium perfringens, and their effect on growth performance and gut health in necrotic enteritis. Poultry Science . 2022;101(4) doi: 10.1016/j.psj.2022.101731.101731 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Nagpal R., Tsuji H., Takahashi T., et al. Gut dysbiosis following C-section instigates higher colonisation of toxigenic Clostridium perfringens in infants. Beneficial Microbes . 2017;8(3):353–365. doi: 10.3920/bm2016.0216. [DOI] [PubMed] [Google Scholar]
  • 90.Li L., Somerset S. Associations between flavonoid intakes and gut microbiota in a group of adults with cystic fibrosis. Nutrients . 2018;10(9):p. 1264. doi: 10.3390/nu10091264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Peng L. Y., Shi H. T., Tan Y. R., et al. Baicalin inhibits APEC-induced lung injury by regulating gut microbiota and SCFA production. Food & Function . 2021;12(24):12621–12633. doi: 10.1039/d1fo02407h. [DOI] [PubMed] [Google Scholar]
  • 92.Lin Y., Wang Z. Y., Wang M. J., et al. Baicalin attenuate diet-induced metabolic syndrome by improving abnormal metabolism and gut microbiota. European Journal of Pharmacology . 2022;925 doi: 10.1016/j.ejphar.2022.174996.174996 [DOI] [PubMed] [Google Scholar]
  • 93.Wang R., Chen T., Wang Q., et al. Total flavone of Abelmoschus manihot ameliorates stress-induced microbial alterations drive intestinal barrier injury in DSS colitis. Drug Design, Development and Therapy . 2021;15:2999–3016. doi: 10.2147/dddt.s313150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Um M. Y., Yoon M., Lee J., Jung J., Cho S. A novel potent sleep-promoting effect of turmeric: turmeric increases non-rapid eye movement sleep in mice via histamine H1 receptor blockade. Molecular Nutrition & Food Research . 2021;65(14) doi: 10.1002/mnfr.202100100.e2100100 [DOI] [PubMed] [Google Scholar]
  • 95.Haider S., Nawaz A., Batool Z., Tabassum S., Perveen T. Alleviation of diazepam-induced conditioned place preference and its withdrawal-associated neurobehavioral deficits following pre-exposure to enriched environment in rats. Physiology and Behavior . 2019;208 doi: 10.1016/j.physbeh.2019.112564.112564 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in the article and can be obtained from the corresponding author upon request.


Articles from Evidence-based Complementary and Alternative Medicine : eCAM are provided here courtesy of Wiley

RESOURCES