Establishment of a platform for measuring mitochondrial oxygen consumption rate for cardiac mitochondrial toxicity

Abstract

The heart has an abundance of mitochondria since cardiac muscles require copious amounts of energy for providing continuous blood through the circulatory system, thereby implying that myocardial function is largely reliant on mitochondrial energy. Thus, cardiomyocytes are susceptible to mitochondrial dysfunction and are likely targets of mitochondrial toxic drugs. Various methods have been developed to evaluate mitochondrial toxicity by evaluating toxicological mechanisms, but an optimized and standardized assay for cardiomyocytes remains unmet. We have therefore attempted to standardize the evaluation system for determining cardiac mitochondrial toxicity, using AC16 human and H9C2 rat cardiomyocytes. Three clinically administered drugs (acetaminophen, amiodarone, and valproic acid) and two anticancer drugs (doxorubicin and tamoxifen) which are reported to have mitochondrial effects, were applied in this study. The oxygen consumption rate (OCR), which directly reflects mitochondrial function, and changes in mRNA levels of mitochondrial respiratory complex I to complex V, were analyzed. Our results reveal that exposure to all five drugs results in a concentration-dependent decrease in the basal and maximal levels of OCR in AC16 cells and H9C2 cells. In particular, marked reduction in the OCR was observed after treatment with doxorubicin. The reduction in OCR after exposure to mitochondrial toxic drugs was found to be associated with reduced mRNA expression in the mitochondrial respiratory complexes, suggesting that the cardiac mitochondrial toxicity of drugs is majorly due to dysfunction of mitochondrial respiration. Based on the results of this study, we established and standardized a protocol to measure OCR in cardiomyocytes. We expect that this standardized evaluation system for mitochondrial toxicity can be applied as basic data for establishing a screening platform to evaluate cardiac mitochondrial toxicity of drugs, during the developmental stage of new drug discovery.

Introduction

Mitochondria are multifunctional organelles in eukaryotic cells that provide energy in the form of adenosine triphosphate (ATP), largely via the process of oxidative phosphorylation (OXPHOS) in which electrons generated by the citric acid cycle translocate to the mitochondrial respiratory complexes [1–3]. The heart is constantly pumping blood to supply oxygen and nutrients to organs in the body, and the energy required for this is mainly provided by mitochondria [4]. Similar to other muscle cells, particularly the cardiomyocytes are mainly powered by mitochondria. However, increased mitochondrial density at times results in skyrocketing of energy output [5, 6]. Considering the above indicates that the heart is sensitive to mitochondrial-targeted drugs and is vulnerable to mitochondrial dysfunction [7].

Mitochondrial dysfunction is now widely implicated in the etiology of medication-induced toxicities, and has become the primary cause of compound attrition and post-market drug withdrawals due to safety concerns [8, 9]. However, most assays currently used for mitochondrial toxicity provide limited mechanistic information. Besides, although clinical testing and genetic analysis are being achieved through various biochemical assays to confirm the diagnosis of mitochondrial diseases, there is no standardized test procedure for determining mitochondrial toxicity. Therefore, to specifically evaluate cardiac mitochondrial toxicity, it is imperative to identify biomarkers that represent mitochondrial toxicity in cardiomyocytes, and establish an optimized and standardized analytical method to measure them.

Among the various physiological or biochemical methods that measure cellular metabolism, one index examines the major parameters of mitochondrial function by determining the oxygen consumption rate (OCR) of living cells [10–12]. OCR is a well-known biomarker of mitochondrial function [13], and determining the OCR or extracellular acidification rate (ECAR) is indicative of changes in the overall cellular metabolism due to certain genes [14], functional changes according to metabolic changes in immune cells [15], and metabolic changes in anticancer drug-induced cancer cells [16, 17]. Recently, many researchers have measured OCR to diagnose patients with mitochondrial disease, or to predict and evaluate drug-induced mitochondrial toxicity [18–20]. In these studies, the OCR of cells was first measured, and functional parameters of mitochondria (such as basal respiration, ATP production, H⁺ (proton) leak, and spare capacity of mitochondria) were then calculated based on the measured OCR data, with subsequent quantification of the degree of mitochondrial toxicity. Basal respiration represents the energy demand in the mitochondrial baseline condition, and ATP production represents the mitochondrial ability to produce ATP required by cells [21]. Proton leak indicates the remaining basal respiration not coupled to ATP production, which may indicate damage to mitochondria [21]. Spare capacity measures the theoretical maximum of mitochondrial respiration, and is indicative of the flexibility of mitochondria to respond to increased energy demands [21].

Mitochondrial stress is mainly measured using three modulators. Oligomycin, a specific inhibitor of the ATPase, inhibits ATP synthase (complex V) activity and affects or reduces electron flow through the electron transport chain (ETC), thereby reducing mitochondrial respiration or OCR [21, 22]. Therefore, changes in ATP production can be measured by injecting oligomycin into cells. Carbonyl cyanide-4 (trifluoromethoxy)phenylhydrazone (FCCP) is a potent uncoupler of oxidative phosphorylation which collapses the mitochondrial proton gradient and mitochondrial membrane potential [23, 24]. Thus, FCCP induces uninhibited electron flow and maximizes oxygen consumption by complex IV, which measures the maximal mitochondrial respiration capacity [21, 25]. The combination of rotenone (Rot), a complex I inhibitor, and antimycin A (AA), a complex III inhibitor, completely shuts down mitochondrial respiration, and is used to measure non-mitochondrial respiration [26–28]. Thus, by measuring the non-mitochondrial respiration, energy produced entirely from mitochondria can be calculated [11, 21].

In the current study, we used the commonly applied cell lines for cardiomyocytes, viz., AC16 human cardiomyocyte line and the H9C2 rat cardiomyocyte line. Our study evaluated whether OCR levels reflect the drug-induced mitochondrial toxicity, and attempted to establish optimal experimental conditions for analyzing OCR in cardiomyocytes.

Materials and methods

Chemicals

Valproic acid sodium salt, amiodarone hydrochloride, acetaminophen, doxorubicin hydrochloride, and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA). (Z)-4-Hydroxytamoxifen (Tocris, Bristol, UK) was procured from Welgene (Gyeongsan, Korea).

Cell culture and medium preparation

AC16 human cardiomyocytes were obtained from Sigma-Aldrich Inc., and H9C2 rat cardiomyocytes were purchased from the Korean Cell Line Bank (Seoul, Korea). Both cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated fetal bovine serum (FBS; Biowest, Nuailléa, France), 1% antibiotic–antimycotic solution (Welgene), and 0.01 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Welgene), at 37 °C in the humidified CO₂ incubator. On reaching 70–80% confluency, the adherent cells were trypsinized with 0.1% Trypsin–EDTA (Life Technologies Inc., CA, USA) for 2–3 min at 37 °C, followed by sub-culture at a split ratio of 1:10 (AC16 cells) or 1:8 (H9C2 cells).

For the preparation of galactose medium, 10 mM D-( +)-galactose, 2 mM L-glutamine (Gibco, Waltham, MA, USA), 5 mM HEPES, 10% FBS, 1 mM sodium pyruvate (Gibco), and 1% antibiotic–antimycotic solution were added to no glucose DMEM (Gibco).

Cell viability assays (WST assay)

The cell viability assay was carried out with minor modifications, based on our previous studies [29, 30]. Briefly, AC16 cells or H9C2 cells were seeded at a density of 5 × 10³ cells/well in 96-well plates (SPL Life Sciences Co., Ltd., Pocheon, Korea) at 37 °C in the humidified CO₂ incubator. Dulbecco's phosphate buffered saline (DPBS; Welgene) was added to the edge of a 96-well plate to prevent changes in drug concentration in medium due to evaporation (a type of edge effect). The following treatment groups were prepared for each run of the experiment, immediately before use: vehicle control, valproic acid sodium salt (1, 10 and 100 μM), acetaminophen (100 μM, 1 and 10 mM), amiodarone hydrochloride (1, 10 and 100 μM), (Z)-4-hydroxytamoxifen (100 nM, 1 and 10 μM), and doxorubicin hydrochloride (100 nM, 1 and 10 μM). The above dilutions were chosen based on the range of concentrations that cause cardiac or mitochondrial toxicity, as reported in previous studies [31–35]. After 24 h incubation for cell adhesion, the galactose medium containing vehicle or drug was added to each well of the respective 96-well plates. To determine the optimal conditioning period of galactose medium, the experimental drugs were also prepared in high glucose DMEM (Hyclone Laboratories Inc., Logan, UT, USA) or galactose medium. Treated cells were then incubated for 24 h at 37 °C in the humidified CO₂ incubator. After discarding the medium, Ez-cytox (DoGen, Seoul, Korea) solution (which produces water soluble tetrazolium (WST)) was added to each well, and plates were further incubated for 30 min. A solution comprising a mixture of culture medium and Ez-cytox was used as the background control. Absorbance was measured at 450 nm using a microreader (Epoch, BioTek Instruments Inc., Winooski, VT, USA). A time-range finding study (30 min, 60 min and 90 min incubation time) was conducted to determine the optimal incubation time for the Ez-cytox solution, in the absorbance range of 0.1 to 1 (data not shown).

Analysis of mitochondrial oxygen consumption rate (OCR)

Analysis of mitochondrial OCR was performed after experiment optimization, according to the manufacturer’s manual (Agilent Technologies, Inc., Santa Clara, CA, USA). Briefly, AC16 cells or H9C2 cells were seeded at a cell density of 5 × 10³ to 1 × 10⁴ cells/100 μL in Seahorse XFp cell culture microplates (Agilent Technologies, Inc.) containing the cell culture growth medium. The edge wells were filled with deionized water to maintain humidity. After achieving cell attachment, the medium was replaced with a galactose medium containing valproic acid sodium salt, acetaminophen, amiodarone hydrochloride, (Z)-4-hydroxytamoxifen, or doxorubicin hydrochloride, and incubation was continued for 24 h at 37 °C in the humidified CO₂ incubator. The sensors in the sensor cartridge were hydrated with XF Calibrant for 24 h. An assay medium was prepared on the day of the assay by adding 10 mM D-glucose, 1 mM sodium pyruvate, and 2 mM L-glutamine solution to unbuffered XF Base DMEM. Treated cells were washed twice with assay medium and allowed to equilibrate for 30 min at 37 °C in a non-CO₂ incubator. The ports on the sensor cartridge were loaded with 1.0–1.5 μM oligomycin, 0.5–2.0 μM FCCP, and 0.5 μM rotenone/antimycin A (Rot/AA). Experimental protocols were designed using the wave desktop software (version 2.6.53; Agilent Technologies, Inc.). The OCR of AC16 cells or H9C2 cells was subsequently analyzed for 90 min using the Seahorse XF HS Mini analyzer (Agilent Technologies, Inc.). OCR was measured at four different steps: (1) at baseline, (2) after oligomycin injection, (3) after FCCP injection, and (4) after Rot/AA injection. Each step was measured thrice for 3 min each (total OCR measured: 12 times). To correct for differences in cell viability caused by drug exposure, the OCR was normalized to cell viability of each treatment group.

Based on the measured OCR values, the basal respiration, ATP production, proton leak, and spare capacity of each treatment group were calculated according to the following formulae:

$$\text{Basal respiration}=\text{average OCR of step 1}-\text{average OCR of step 4}$$

$$\text{ATP production}=\text{average OCR of step 1}-\text{average OCR of step 2}$$

$$\text{Proton leak}=\text{average OCR of step 2}-\text{average OCR of step 4}$$

$$\text{Spare capacity}=\text{average OCR of step 3}-\text{average OCR of step 4}$$

Total RNA extraction and cDNA synthesis

AC16 or H9C2 cells were seeded in 100 mm cell culture dishes. On reaching a confluency of 80–90%, the cells were incubated in galactose medium for 24 h with each drug. Total RNA was isolated from cells using the TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), following the manufacturer’s instructions. The resultant RNA pellet was dissolved in 50–100 μL UltraPure^™ DNase/RNase-Free Distilled Water (Gibco), and total RNA concentration was measured with a microreader (BioTek Instruments Inc.) at 260/280 nm. cDNA synthesis was achieved using the PrimeScript RT Master Mix (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions. cDNA synthesis was performed at 37 °C for 15 min, and the enzyme was inactivated at 95 °C for 5 s.

Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

For quantitative analysis of the mRNA expression of complexes in the ETC, the cDNA was amplified using 10 pmol/μL each of the forward and reverse primers (Bioneer Co., Daejeon, Korea), and TB Green Premix Ex Taq II (Takara Bio Inc.). qPCR was carried out for 40 cycles comprising 95ºC for 15 s, 58 °C for 60 s, using the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Table 1 shows the sequence of each primer used in this study. The housekeeping gene GAPDH was used as the internal control. The ΔCt was calculated using the following the formula:

$$\mathrm{\Delta }\text{Ct}=\text{Ct}\left(\text{an ETC gene}\right)-\text{Ct}(GAPDH)$$

Table 1.

Primer sequences for RT-qPCR

Species	Genes	Primer sequences (5' → 3')	Tm (°C)
Human	Glyceraldehyde 3-phosphate dehydrogenase (GHPDH)	Forward: GGTTTCCATAGGACCTGCTG Reverse: TCTTGGGTGTCTCGTCTTCT	57.96 58.00
	NADH dehydrogenase (ubiquinone) Fe-S protein 1 (NDUFS1)	Forward: CCAAGTCAGAAGGCCAAAGT Reverse: TCTTCACACTGCTGGAAACC	58.01 58.03
	Succinate dehydrogenase complex, subunit A (SDHA)	Forward: GAGCGTGAGTTTAGTGAGGG Reverse: AGAACACCATCACATACGGC	58.00 57.98
	Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (UQCRFS1)	Forward: TTTGCACTCATCTTGGCTGT Reverse: GTGAACTCATACGTGGGGAC	58.01 57.99
	Cytochrome c oxidase 5B (COX5B)	Forward: GGGTTGGAGAGGGAGATCAT Reverse: GTCCTCTTCACAGATGCAGC	58.19 58.63
	ATP synthase, H + transporting, mitochondrial F1 complex, alpha subunit (ATP5F1A)	Forward: GGACAAGCAGGAGACAGATG Reverse: AAAGCCTGGGTATTGTGCAA	57.98 57.99
Rat	Glyceraldehyde 3-phosphate dehydrogenase (GHPDH)	Forward: CATCACCATCTTCCAGGAGC Reverse: GCGGAGATGATGACCCTTTT	58.04 57.96
	NADH dehydrogenase (ubiquinone) Fe-S protein 1 (NDUFS1)	Forward: AAAGTGACGTGTGGAGCTTT Reverse: CATGAGCCTGAAGACTGCAT	57.96 57.96
	Succinate dehydrogenase complex, subunit A (SDHA)	Forward: CCTCCTGCTATCCGTTCCTA Reverse: CCCTCACATCAAGTACTGCC	58.00 57.97
	Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (UQCRFS1)	Forward: TCTCCCAGTTTGTTTCCAGC Reverse: AGCTTCCTGGTCAATCTCCT	58.02 58.04
	Cytochrome c oxidase 5B (COX5B)	Forward: GGAAGCTGTGACAAGACCAA Reverse: CTTGTCAGACGTTAGGGCTC	58.03 58.00
	ATP synthase, H + transporting, mitochondrial F1 complex, alpha subunit (ATP5F1A)	Forward: CCATGCCTCTAACACTCGAC Reverse: GGACATACCCTTTAAGCCGG	58.07 58.04

The ΔΔCt was calculated using the mean of the treatment group as vehicle control sample:

$$\mathrm{\Delta }\mathrm{\Delta }\text{Ct}=\mathrm{\Delta }\text{Ct}\left(\text{treatment group}\right)-\mathrm{\Delta }\text{Ct}(\text{vehicle control})$$

Finally, expression of each sample was determined as 2 − ΔΔCt.

Statistical analysis

All experiments were run at least three times, and all data are presented as means ± standard error of the mean (SEM). Data from the experiments were statistically analyzed by one-way analysis of variance (ANOVA) followed by a post hoc Dunnett's test, Student's t test, or multiple t-test using the GraphPad prism 7 software (GraphPad Software Inc., San Diego, CA, US). The p values of less than 0.05 are considered statistically significant, and highlighted with an asterisk (*) or a sharp (#).

Results

Selection of test drugs and cytotoxicity test

To standardize the method for measuring mitochondrial OCR in cardiomyocytes, we first selected five drugs that are linked to cardiac or mitochondrial toxicity, as reported in previous studies. In this study, three therapeutic drugs and two anticancer drugs that are widely applied in clinics were selected. Na and co-workers reported that valproic acid (Val), which is used as an anticonvulsant, increases ROS levels in embryonic stem cells and inhibits differentiation into cardiomyocytes at concentrations above 100 μM [31]. Acetaminophen (AP), also known as paracetamol or N-acetyl-p-aminophenol, has also been shown to cause cytotoxicity in the liver as well as in cardiomyocytes [32]. Amiodarone (Amd) is clinically used as a potent anti-arrhythmic drug and significantly inhibits mitochondrial permeability transition in cardiomyocytes, although it is more toxic in hepatocytes and pancreatic cells [35, 36]. Tamoxifen is widely used for the treatment and prevention of breast cancer, but it has been reported that its active metabolite, 4-hydroxytamoxifen (4-OHT), abolishes myocyte contractility at 10 μM in a time-dependent manner, and alters Ca²⁺ handling by decreasing the Ca²⁺ transient amplitude [34]. Similar to tamoxifen, doxorubicin (Dox) is also used to treat multiple malignancies including breast, bladder, and Kaposi's sarcoma. However, its therapeutic use is limited due to multitude adverse side effects, including cardiac mitochondrial dysfunction [34].

The AC16 and H9C2 cells cultured in galactose medium were exposed to the drugs for 24 h. Based on a previous study that found galactose-grown cells were more susceptible to mitochondrial toxicants than high-glucose-grown cells, each drug was exposed in galactose medium to make cardiomyocyte ATP production rely almost exclusively on mitochondrial function [37]. That is to say, drugs exhibiting higher toxicity in galactose medium compared to glucose medium are indicative of mitochondrial toxicity [20]. However, this does not mean that there is a difference in cell viability between glucose media and galactose media, but rather that culture in galactose media increases mitochondrial-specific toxicity sensitivity. We observed that except Val, exposure to four drugs reduced the cell viability of both AC16 and H9C2 cells in a concentration-dependent manner (Fig. 1). A dramatic decrease was particularly observed after exposure to doxorubicin (Fig. 1e). Our results further confirmed that AC16 cells were more sensitive to the test drug-induced cytotoxicity than H9C2 cells (Fig. 1).

Fig. 1.

Changes in cell viability in AC16 and H9C2 cells after treatment with five different drugs. AC16 or H9C2 cells were seeded into 96-well plates at a density of 5 × 10³ cells/well. The cells were then exposed to four different concentrations of valproic acid sodium salt, acetaminophen, amiodarone hydrochloride, (Z)-4-hydroxytamoxifen, or doxorubicin hydrochloride, in galactose medium for 24 h. Cell viability was measured using the WST assay after treatment of the cells with EZ-cytox for 30 min (a valproic acid sodium salt, b acetaminophen, c amiodarone hydrochloride, d (Z)-4-hydroxytamoxifen and e doxorubicin hydrochloride). The data in the graphs are obtained from at least three repeated experiments, statistically analyzed one-way analysis of variance (ANOVA) followed by a post hoc Dunnett's test, and are presented as the mean ± SEM. *p < 0.05 vs. vehicle control of AC16 cells. #p < 0.05 vs. vehicle control of HC16 cells

Determination of optimal experimental conditions for the measurement of mitochondrial OCR in cardiomyocytes

Since the number of mitochondria and the basal level of OCR as well as the sensitivity to specific electron transport complex inhibitors could differ for cells, it is necessary to establish the OCR measurement conditions for each cell type. In order to determine the appropriate concentration of FCCP to be added in step 3, AC16 cells were treated with 100 nM Dox for 24 h, followed by exposure to 0.5 μM or 1.0 μM FCCP in step 3 of the OCR measurement (Fig. 2a and b). After the addition of 0.5 μM FCCP to AC16 cells, OCR of the vehicle control increased to about 140 pmol/min, and OCR of the Dox-treated cells increased to about 100 pmol/min; however, the increased levels after FCCP treatment were observed to gradually decrease during the three measurement periods (Fig. 2a). Conversely, treatment with 1.0 μM FCCP resulted in increased OCR of the vehicle control and Dox-treated cells, and was maintained relatively stable over the measurement period of step 3 (Fig. 2b). These results indicate that 0.5 μM FCCP is insufficient for removing the restriction of mitochondrial electron flow, indicating that a minimum concentration of 1.0 μM FCCP should be added to measure the maximum respiration of AC16 cells. To determine the appropriate concentration for measuring the maximum respiration of H9C2 cells, FCCP was evaluated at 0.5 μM, 1.0 μM, and 2.0 μM concentrations (Fig. 2c–e). All three concentrations were insufficient to elicit the maximum level of H9C2 OCR. However, the difference between the OCR levels decreased by oligomycin and subsequent increase after exposure to FCCP showed a concentration-dependent increasing trend (Fig. 2c–e). We theorized this to be because the basal mitochondrial respiration rate of H9C2 cells is relatively low, and 1.5 μM of oligomycin was too excessive to inhibit complex V in H9C2 cells. Therefore, in order to increase the basal mitochondrial respiration rate of H9C2 cells, the number of cells to be seeded on the microplate was doubled to 1 × 10⁴ cells/well, and the concentration of oligomycin was lowered to 1.0 μM. Indeed, the maximal mitochondrial respiration level of H9C2 cells was significantly higher than the basal respiration level (p > 0.05) after these experimental alterations (Fig. 2f). Based on these experimental results that determined the conditions for measuring OCR, we established the optimal experimental conditions for measuring drug-induced OCR changes in AC16 and H9C2 cardiomyocytes (Table 2).

Fig. 2.

Establishment of experimental conditions for the measurement of mitochondrial OCR in two types of cardiomyocytes. AC16 or H9C2 cells were seeded at a cell density of 5 × 10³ cells/100 μL in Seahorse XFp cell culture microplates with cell culture growth medium. The cells were treated with vehicle or 100 nM doxorubicin (Dox) in galactose medium for 24 h. a, b To determine the optimal FCCP concentration for AC16 cells, either 0.5 or 1.0 µM FCCP was loaded into the port of the sensor cartridge. c–e To determine the optimal FCCP concentration for H9C2 cells, either 0.5, 1.0 or 2.0 µM FCCP was loaded into the port of the sensor cartridge. f Under the condition of 1 × 10⁴ cells/well of H9C2 cells, either 0.5, 1.0 or 2.0 FCCP was loaded into the port of the sensor cartridge to determine the optimal oligomycin concentration for H9C2 cells. OCR was detected using Seahorse XF HS Mini analyzer, and the OCR was normalized to cell viability of each treatment group. The data in the graphs are obtained from at least three repeated experiments, and are presented as the mean ± SEM

Table 2.

Optimal experimental conditions for the measurement of mitochondrial OCR in cardiomyocytes

Cell types	AC16 cells	H9C2 cells
Seeding cell number	5 × 103 cells/well	1 × 104 cells/well
Exposure time	24 h	24 h
Oligomycin	1.5 μM	1.0 μM
FCCP	1.0 μM	2.0 μM
Rot/AA	0.5 μM	0.5 μM

Drug-induced changes in mitochondrial OCR of cardiomyocytes

We next measured changes in OCR in AC16 cells after exposure to each of the 5 drugs. Based on the OCR data, we calculated the basal respiration, ATP production, proton leak and spare capacity of each treatment group. As presented in Fig. 3, all drugs induced a decrease in the OCR of AC16 cells in a concentration-dependent manner. Exposure to Val significantly decreased the basal respiration, ATP production, proton leak and spare capacity at all concentrations tested (Fig. 3a). AP decreased the OCR at 100 μM (except for proton leak), and 10 mM AP showed approximately 70% inhibition of OCR (Fig. 3b). Mitochondrial ATP production spare capacity was the most significantly reduced parameter of the mitochondrial functions after AP treatment (Fig. 3b). With increasing number of AC16 cells, exposure to Amd gradually decreased the OCR, particularly a major reduction in the mitochondrial spare capacity of AC16 cells (Fig. 3c). In Fig. 3c, the vehicle control seemed to respond less to oligomycin, but there was no statistical significance (p = 0.3766). Compared to other drugs, 4-OHT, the main active metabolite of tamoxifen, showed relatively low mitochondrial toxicity to AC16 cells but inhibited all parameters of mitochondrial function by more than 50% at 10 μM (Fig. 3d). Among the drugs examined, Dox treatment caused the maximum damage to mitochondrial respiration in AC16 cells. At concentrations above 1 μM, Dox almost completely blocked the respiration of AC16 cells, completely shut down ATP production (a major mitochondrial function), and also induced a dramatic decrease in the mitochondrial spare capacity (Fig. 3e).

Fig. 3.

Changes in OCR in AC16 human cardiomyocytes after treatment with five different drugs. AC16 cells were seeded on Seahorse XFp cell culture microplates at 5 × 10³ cells/well. The medium was replaced with a galactose medium containing valproic acid sodium salt (Val), acetaminophen (AP), amiodarone hydrochloride (Amd), (Z)-4-hydroxytamoxifen (4-OHT), or doxorubicin hydrochloride (Dox). The ports on the sensor cartridge were loaded with 1.5 μM oligomycin, 1.0 μM carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP), and 0.5 μM rotenone/antimycin A (Rot/AA). OCR was detected using Seahorse XF HS Mini analyzer, and the OCR was normalized to cell viability of each treatment group (a Val b AP, c Amd, d 4-OHT and e Dox). Based on the measured OCR, the basal respiration, ATP production, H⁺ (proton) leak, and spare capacity of each treatment group were calculated. The data in the graphs are obtained from at least three repeated experiments, statistically analyzed multiple t test, and are presented as the mean ± SEM. *p < 0.05 vs. vehicle control

Similar to AC16 cells, changes in OCR after exposure to the 5 drugs were determined in H9C2 cells. However, the OCR was significantly reduced by Val in AC16 cells but not in H9C2 cells (Fig. 4a). AP significantly inhibited mitochondrial spare capacity and ATP production of H9C2 cells, but had no significant effect on the remaining basal respiration not coupled to ATP production (proton leak) (Fig. 4b). Moreover, the level of basal respiration was greatly reduced by Amd, leading to a concentration-dependent decrease in the subsequent measurement parameters (Fig. 4c). Similar to Val, 4-OHT also had no significant effect on the reduction of OCR in H9C2 cells (Fig. 4d). However, exposure to Dox induced significant inhibition of OCR even in H9C2 cells, and completely shut down the mitochondrial function at 1 μM and 10 μM (Fig. 4e).

Fig. 4.

Changes in OCR in H9C2 rat cardiomyocytes after treatment with five different drugs. H9C2 cells were seeded on Seahorse XFp cell culture microplates at 1 × 10⁴ cells/well. The medium was replaced with a galactose medium containing valproic acid sodium salt (Val), acetaminophen (AP), amiodarone hydrochloride (Amd), (Z)-4-hydroxytamoxifen (4-OHT), or doxorubicin hydrochloride (Dox). The ports on the sensor cartridge were loaded with 1.0 μM oligomycin, 2.0 μM carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP), and 2.5 μM rotenone/antimycin A (Rot/AA). OCR was detected using Seahorse XF HS Mini analyzer, and the OCR was normalized to cell viability of each treatment group (a Val b AP, c Amd, d 4-OHT and e Dox). Based on the measured OCR, the basal respiration, ATP production, H⁺ (proton) leak, and spare capacity of each treatment group were calculated. The data in the graphs are obtained from at least three repeated experiments, statistically analyzed by multiple t test, and are presented as the mean ± SEM. *p < 0.05 vs. vehicle control

Considering the above results, we observed that changes in OCR to mitochondrial toxicants were much broader and more responsive in AC16 cells than in H9C2 cells. These results indicate that measuring OCR in AC16 cells could be more effective in predicting mitochondrial respiratory toxicity caused by mitochondrial toxicants.

Changes in ETC genes are associated with OCR

To determine whether these OCR changes are related to changes at the gene level of complex enzymes involved in mitochondrial respiration, mRNA expressions of mitochondrial complexes I, II, III, IV, and V were quantified through qPCR after treatment with the mitochondrial toxicants. It is interesting to note that the expressions of mitochondrial respiratory complexes were generally inhibited by all the test drugs (Fig. 5), and the dramatic decrease in OCR by Dox was similarly portrayed at the mRNA level of the respiratory complexes (Fig. 5e). The mRNA expression of respiratory complex I was reduced by all drugs, suggesting that the function of the complex I enzyme (the first large protein complex of the respiratory chains) is hindered, resulting in the direct inhibition of ATP production through oxidative phosphorylation (Fig. 5a–e). The mRNA expression of complex I by Val in H9C2 cells was decreased to a greater extent than in AC16 cells (Fig. 5a). Moreover, expression of the respiratory complex V was decreased by four drugs, except 4-OHT (Fig. 5d), which is consistent with the result that 4-OHT did not exert a significant effect on mitochondrial respiration of H9C2 cells (Fig. 4d).

Fig. 5.

Changes in mRNA expression level of the mitochondrial electron transport system complex in two cardiomyocytes after treatment with five different drugs. AC16 or H9C2 cells were incubated in galactose medium for 24 h with each drug. Total RNA was isolated and the cDNA was synthesized, after which qPCR was achieved using the TB Green Premix Ex Taq II and the QuantStudio 3 Real-Time PCR System. mRNA levels of ETC complex genes were subsequently measured after treatment: a valproic acid sodium salt, b acetaminophen, c amiodarone hydrochloride, d (Z)-4-hydroxytamoxifen, e doxorubicin hydrochloride. The data in the graphs are obtained from at least three repeated experiments, statistically analyzed by Student's t test, and are presented as the mean ± SEM. *p < 0.05 vs. vehicle control

Taken together, our results determined that down-regulation of the respiratory complex mRNA levels results in significant decrease in OCR which, in turn, is dependent on the severity of the mitochondrial toxicant. These results indicate that the reduction in OCR caused by mitochondrial toxic drugs is linked to lower mRNA expression in the mitochondrial respiratory complexes, implying that drug-induced cardiac mitochondrial toxicity is due to dysfunction of the mitochondrial respiration.

Discussion

Mitochondria are multifunctional organelles that are primarily responsible for energy supply in mammalian cells, and mitochondrial dysfunction is linked to numerous afflictions [2]. It has been increasingly reported that the pathogenesis of drug-induced toxicity is linked to mitochondrial dysfunction [38]. Therefore, the early detection and prevention of probable drug-induced mitochondrial dysfunction are critical for avoiding mitochondrial dysfunction-related disorders. In order to determine drug-induced mitochondrial toxicity, the current study focuses on measuring the mitochondrial respiration rate, which probably represents various mitochondrial functions, including ATP production, which is the fundamental role of mitochondria. This OCR analysis can obtain an insight into cellular bioenergetics and the mechanism of mitochondrial toxicity by measuring mitochondrial stress [39].

In the present study, we employed the same concentration range for the measurements of cell viability and OCR. Since mitochondrial toxicity can cause dysfunction of the overall metabolism of the cell, it can also affect cell viability [40–42]. Thus, we normalized the results of OCR to cell viability to determine whether the decrease in OCR was due to cell viability or mitochondrial toxicity. Therefore, the OCR results demonstrated in the present study exclude the effect of cell viability. As results, we determined that the effects of test drugs on the cell viability of cardiomyocytes and their effects on OCR are not always consistent. Interestingly, Val and 4-OHT exerted no significant inhibition on the cell viability of both cardiomyocytes, but significantly decreased the mitochondrial OCR of AC16 cells in a concentration-dependent manner. This is thought to be because OCR is a direct measure of the mitochondrial respiration rate, and therefore better represents mitochondrial toxicity, even though the WST assay uses reduction of dehydrogenase, an enzyme present in the mitochondrial electron transport chain of metabolically active cells [43]. In other words, it is more acceptable to determine various mitochondrial function indicators by OCR analysis for the specific and precise measurement of the functional impairment of mitochondria.

Recently, many researchers have evaluated potential mitochondrial toxicity through OCR measurement. Although Dox is a potent anticancer agent for breast cancer, it is also associated with acute ventricular dysfunction, late-onset cardiomyopathy, and heart failure [44, 45]. It was reported that mitochondria isolated from chronically Dox-treated hearts revealed considerable mitochondrial OCR inhibition [46], and 0.7 μM Dox induced a significant reduction of OCR, both indicating an inhibition of ATP production [47]. In one study, OCR was measured for drugs with known and unknown mitochondrial toxicity; they proposed that implementation of OCR measurements early in the drug discovery process could reduce late stage attrition due to adverse mitochondrial effects [20]. To evaluate the mitochondrial toxicity of micropollutants in water, Maximilian E. Müller and colleagues measured OCR following exposure to micropollutants, using the HepG2 human hepatocyte carcinoma cell line [48]. Considering that numerous studies have measured OCR to determine drug-induced mitochondrial dysfunction at the cellular level, and to predict mitochondrial toxicity-mediated damage [49–51], we propose that measuring OCR, which is one of the extracellular fluxes of mitochondria, is a highly effective and predictive method to evaluate cardiac mitochondrial toxicity.

Since energy is produced and oxygen is consumed by the mitochondrial respiratory complex, we questioned whether drug-induced OCR changes are related to alterations at the transcriptional level of the mitochondrial respiratory complex enzymes. To answer this, we monitored the mRNA expression of mitochondrial respiratory complex enzymes through qPCR, and found that the severity of drug-induced mitochondrial toxicity and the mRNA expression levels of respiratory complexes are closely related. Also, in a previous study, skin fibroblasts isolated from patients with heterogeneous mitochondrial disorders were assessed for basal OCR, ATP-linked OCR, spare capacity, and proton leak, wherein a correlation between the enzymatic activities of the respiratory complexes and OCR was reported [18]. Another study measured the basal OCR and maximal OCR of cells, as well as respiratory gene expressions, to delineate that the physiological change in mitochondrial respiration in cancer cells is due to alterations in mitochondrial respiratory gene expression [52]. They concluded that with a sufficiently large decrease in the respiratory capacity, the basal respiration rate of cells would decrease because mitochondrial DNA (mtDNA) encodes an essential component of the respiratory chain [52]. These studies support the close association between OCR and respiratory complex enzymes found in our study, implying that evaluating OCR could represent drug-induced damage to mitochondrial OXPHOS. However, although most mitochondrial respiratory complexes are encoded by nuclear DNA (nDNA), some mitochondrial complexes are known to be encoded by nDNA. For example, the mammalian mitochondrial respiratory complex I consists of 45 monomers, 7 of which are encoded by mtDNA [53]. Since mtDNA was not separately analyzed in our study, further study needs to include analysis of changes in the mitochondrial respiratory complex at both mtDNA and nDNA levels according to changes in OCR.

In conclusion, our results determined that drug-induced changes in mitochondrial OCR in cardiomyocytes are closely related to changes in the mRNA levels of the mitochondrial respiratory complexes, indicating that OCR can be measured as a tool to predict the potential of mitochondrial toxicity. Based on these results, we established optimal experimental conditions for measuring mitochondria in cardiomyocytes (Table 2), and performed experiments for validation. Meanwhile, this study showed the distinct results in the two cell lines. Since AC16 cells are a human-derived cell line and H9C2 is a rat-derived cell line, these differences in susceptibility to 5 drugs may be species-dependent or due to differences in the physiological properties of cells. Given that mitochondrial dysfunction is associated with numerous cardiac diseases (such as atherosclerosis, ischemia–reperfusion injury, and myocardial infarction), we believe that mitochondrial OCR analysis has the potential to be used as a useful indicator for predicting cardiac diseases as well as mitochondrial toxicity of cardiomyocytes. Moreover, the development of highly specific and sensitive in vitro assays during early drug development will help detect compounds that affect the mitochondrial function [20]. Further studies are required, which include cardiomyocyte cell lines from various sources and more types of drugs, and it is necessary to carefully also consider the necessity of simultaneously measuring ECAR as an indicator of glycolysis.

Funding

This research was supported by grants from the Ministry of Food and Drug Safety in 2021 (20183MFDS525). In addition, this work was also supported by the Global Research and Development Center (GRDC) Program (2017K1A4A3014959) through the National Research Foundation (NRF) of Korea, funded by the Ministry of Science and ICT.

Declarations

Conflict of interest

The authors do not have any conflicts of interest to declare.