Skip to main content
Heliyon logoLink to Heliyon
. 2022 Sep 28;8(10):e10786. doi: 10.1016/j.heliyon.2022.e10786

Pan-cancer analysis of LncRNA XIST and its potential mechanisms in human cancers

Wei Han a,b,1, Chun-tao Shi c,1, Jun Ma d,1, Hua Chen a, Qi-xiang Shao e, Xiao-jiao Gao f, Ying Zhou c, Jing-feng Gu f, Hao-nan Wang g,∗
PMCID: PMC9535293  PMID: 36212008

Abstract

Background

X-inactive specific transcript (XIST), it has been found, is abnormal expression in various neoplasms. This work aims to explore its potential molecular mechanisms and prognostic roles in types of malignancies.

Methods

This research comprehensively investigated XIST transcription across cancers from Oncomine, TIMER 2.0 and GEPIA2. Correlations of XIST expression with prognosis, miRNAs, interacting protens, immune infiltrates, checkpoint markers, mutations of tumor-associated genes and promoter methylation were also analyzed by public databases. In addition, 98 BRCA samples were collected to investigate XIST expression and evaluate its clinicopathological value.

Results

In public databases, compared to normal tissues, XIST was lower in BRCA, CESC, COAD and so on, but increased in KIRC and PRAD. Databases also showed that XIST was a good indicator of prognosis in BRCA, COAD and so on, but a bad one in KIRC, KIRP and so on. From starBase, we found 29 proteins interacting with XIST, and identified 4 miRNAs which might be sponged by XIST in cancers. Furthermore, XIST was linked with immune infiltration, especially T cell CD4+, and was related to over 20 immune checkpoint markers. Moreover, several tumor-associated gene mutations and promoter methylation were negatively related to its expression. In addition, IHC showed that XIST in BRCA was obviously lower in comparison of normal tissues and was negatively related to lymph node invasion and TNM stage.

Conclusion

In summary, abnormal expression of XIST influenced prognosis, miRNAs and immune infiltration across cancers, especially BRCA.

Keywords: XIST, Pan-cancer analysis, Prognosis, miRNA, ceRNA, Tumor immunity


XIST; Pan-cancer analysis; Prognosis; miRNA; ceRNA; Tumor immunity.

1. Introduction

Neoplasm has become a global health problem and a leading cause of death worldwide, with about 20 millions new cases and 10 million deaths in 2020 [1]. Although operation, radiotherapy, chemotherapy, targeted therapy and immunotherapy are the main treatment options for carcinomas, patients at the advanced stage still have poor prognosis [2]. Therefore, exploring novel biomarkers is essential for preventing chemo-resistance and improving survival rates of cancer patients.

With a length of more than 200 nucleotides, long non-coding ribonucleic acids (LncRNAs) are a highly heterogeneous group of transcripts, and are involved in various biological functions through the epigenetic regulation of genes and the interaction with proteins and RNAs [3, 4]. Due to its regulation, abnormal expressions of LncRNAs lead to the development and progression of many diseases, especially malignant tumors [5, 6]. Therefore, more and more LncRNAs are considered as novel biomarkers to predict chemoresistance and evaluate prognosis of cancer patients [7, 8].

LncRNA X-inactive specific transcript (XIST) locates at Xq13.2 and coats the X chromosome in cis during X chromosome inactivation (XCI) [9]. Emerging investigations report that abnormal expression of XIST takes part in the regulation of various diseases, including solid tumors [10, 11, 12]. Previous researches reported that XIST could induce biological behavior and pathological appearance by interacting with several proteins and micro ribonucleic acids (miRNAs), and could play key roles in the generation, progression and prognosis of tumors [13, 14]. Recent studies have demonstrated that XIST is down-regulated in several cancers and suppresses the progression of tumors, especially breast cancer [15, 16]. However, some studies showed that XIST promoted growth and invasion of colorectal cancer cells, and silencing XIST could repress chemoresistance of acute myeloid leukemia [17, 18]. These entirely different roles of XIST in carcinomas resulted in discrepancies of its prognostic value among previous researches [19, 20].

The tumor microenvironment (TME) is a complex milieu in which immune infiltration can activate or restrain tumor progression and metastasis, which forms the tumor immune microenvironment (TIME) [21, 22]. Previous studies discovered that XIST and its downstream regulators were correlated with TIME and PD-L1 expression, and played critical roles in invasion and metastasis of cancers [16, 23, 24, 25].

Gene mutation is regarded as a crucial factor for malignant transformation and tumor progression [26]. In addition, Gene mutation, such as BRCA1 and BRCA2, affected immune cell infiltration and response to immunotherapy [26]. Abnormal expression of XIST was also related to the mutation of several tumor-associated genes [27, 28]. For example, dysregulation of XIST and 53BP1 affected the survival of breast carcinoma patients with BRCA1 mutation [27]. However, whether the mutation of BRCA1 or other genes leads to abnormal expression of XIST is still obscure.

In view of the outstanding contradictions and vagueness above, we conducted a pan-cancer analysis of XIST to elucidate its potential molecular mechanisms and prognostic roles in multiple cancers. In addition, 98 cases of breast cancer were also collected to assess the clinicopathological role of XIST in BRCA.

2. Materials and methods

2.1. Pan-cancer analysis of XIST transcription

Oncomine (https://www.oncomine.org/), Tumor Immune Estimation Resource 2.0 (TIMER 2.0, https://timer.cistrome.org/), Gene Expression Profiling Interactive Analysis 2 (GEPIA2, https://gepia2.cancer-pku.cn/) were performed to analyze XIST transcription in multiple cancers. The first database was Oncomine which consisted of more than 80,000 samples of over 20 types of cancers. The threshold in this research was set as the following criteria: gene rank: Top 10%, fold change: 2, and P value: 1E-4. The second one was TIMER 2.0 containing more than 10 thousand samples of over 30 cancer types from The Cancer Genome Atlas (TCGA) [29, 30]. The next one was GEPIA2 which was a newly developed database for analyzing the RNA sequencing expression data of more than 9,000 tumors and 8,000 normal tissues from the TCGA and the Genotype-Tissue Expression (GTEx) projects [31].

Names and abbreviations of types of cancers were all listed as follow: ACC: adrenocortical carcinoma; BLCA: bladder urothelial carcinoma; BRCA: breast invasive carcinoma; CESC: cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL: cholangio carcinoma; COAD: colon adenocarcinoma; DLBC: lymphoid neoplasm diffuse large B-cell lymphoma; ESCA: esophageal carcinoma; GBM: glioblastoma multiforme; HNSC: head and neck squamous cell carcinoma; KICH: kidney chromophobe; KIRC: kidney renal clear cell carcinoma; KIRP: kidney renal papillary cell carcinoma; LAML: acute myeloid leukemia; LGG: brain lower grade glioma; LIHC: liver hepatocellular carcinoma; LUAD: lung adenocarcinoma; LUSC: lung squamous cell carcinoma; MESO: mesothelioma; OV: ovarian serous cystadenocarcinoma; PAAD: pancreatic adenocarcinoma; PCPG: pheochromocytoma and paraganglioma; PRAD: prostate adenocarcinoma; READ: rectum adenocarcinoma; SARC: sarcoma; SKCM: skin cutaneous melanoma; STAD: stomach adenocarcinoma; TGCT: testicular germ cell tumors; THCA: thyroid carcinoma; THYM: thymoma; UCEC: uterine corpus endometrial carcinoma; UCS: uterine carcinosarcoma; and UVM: uveal melanoma.

2.2. Prognosis analysis

The correlation of XIST expression with prognosis of patients in multiple cancers was analyzed through three public databases, GEPIA2, PrognoScan (http://dna00.bio.kyutech.ac.jp/PrognoScan/index.html) and Kaplan-Meier Plotter (https://kmplot.com/analysis/). Data of PrognoScan mostly came from the Gene Expression Omnibus (GEO) database, and Kaplan-Meier Plotter utilized Affymetrix microarray data from TCGA [32, 33]. We used heat maps, forest plots and KaplanMeier curves to visualize the survival data of cancer patients. Overall survival (OS), disease free survival (DFS), relapse free survival (RFS), disease specific survival (DSS), distant metastasis free survival (DMFS), progression free survival and distant recurrence free survival were main outcomes. The hazard ratio (HR) and 95% confidence interval (CI) were calculated through univariate analysis.

2.3. Exploration of proteins and miRNAs interacting with XIST

We performed starBase (http://starbase.sysu.edu.cn/starbase2/index.php) to identify candidate proteins and miRNAs potentially interacting with XIST by Pearson correlation analyses [34]. In addition, the ceRNA network of starBase was conducted to search for possible RNAs that could compete with XIST for miRNAs binding. Next, a network of LncRNA - miRNAs - mRNAs was scheduled by the software named GEPHI.

2.4. Tumor immune microenvironment analysis

TIMER 2.0 was utilized to analyzed the relationship of XIST expression with the abundance of infiltrating immune cell types in multiple cancers by Spearman correlation analyses. In addition, we evaluated the correlations of XIST with immune checkpoint markers and immune cell types in each type of cancers by Spearman correlation analysis.

2.5. Pan-cancer analysis of representative gene mutation

We performed TIMER 2.0 to analyze the correlation of XIST expression with representative gene mutation by Spearman correlation analyses. 47 representative genes were listed as follow: AKT1, ALK, APC, AR, ARID1A, ASXL1, ATM, BAP1, BARD1, BRAF, BRCA1, BRCA2, BRIP1, CCND1, CDK4, CDKN2A, CHEK2, EGFR, EPCAM, ERBB2, ERBB3, FANCA, FAT1, FBXW7, FGFR1, KDR, KIT, KRAS, MET, MTOR, NBN, NTRK1, NTRK2, NTRK3, PALB2, PIK3CA, PTEN, RAD51C, RAD51D, RB1, RET, ROS1, SMO, STK11, TP53, TP53BP1 and TSC1.

2.6. Methylation analysis of XIST promoter

Firstly, EPD (eukaryotic promoter database, https://epd.epfl.ch//index.php), a set of species-specific databases of experimentally validated promoters, was performed to identified XIST promoter [35]. Then, we put the XIST promoter sequence into MethPrimer 2.0 (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) to detect the CpG islands in XIST promoter. Another database EWAS Data Hub (https://ngdc.cncb.ac.cn/ewas/datahub/index), a data hub of DNA methylation array data and metadata, was also utilized to analyze the relationship between survival time and XIST promoter methylation level, and the relationship between XIST expression and promoter methylation level across 39 types of cancers [36].

2.7. Patients and breast cancer samples

Specimens from a total of 98 female invasive breast cancer patients who underwent mastectomy in Wuxi Xishan People’s Hospital from January, 2015 to January, 2020 were collected with a mean age of 55.45 ± 12.02 years. Each case consisted of breast tumor and its corresponding adjacent normal tissue, which were identified via hematoxylin-eosin (HE) staining by XJG and JFG, and were used for real-time quantitative polymerasechain reaction (RT-qPCR). This research had received the approval of Wuxi Xishan People’s Hospital Ethics Committee. Every patient signed the informed consent form.

2.8. RT-qPCR

Tissues were collected to isolate total RNA through Trizol regent (Thermo Fisher Scientific, USA). A total of 2 μg RNA of each sample was reverse transcribed using the HiScript III RT SuperMix for qPCR (Vazyme-innovation in enzyme technology, China). cDNA was subjected to quantitative PCR using primers specific for XIST and GAPDH. PCR primers were designed as follow: XIST, Forward primer (5’-3’), CTAAGGGCGTGTTCAGATTGT, Reverse primer (5’-3’), ACCTGCTATCATCCATCTTGC (123 bp); GAPDH, Forward primer (5’-3’), GAAGGTGAAGGTCGGAGT, Reverse primer (5’-3’), GAAGATGGTGATGGGATTTC (226 bp). RNA was quantified with a real-time PCR machine (IQ5, Bio-Rad, USA) using the ChamQ Universal SYBR qPCR Master Mix (Vazyme-innovation in enzyme technology, China). Then, we used 2−ΔΔCt value to calculate the relative expression. The formula of ΔΔCt = (CtTumor-XIST - CtTumor-GAPDH) - (CtNormal-XIST - CtNormal-GAPDH).

2.9. Statistical analysis

Differences of levels of XIST transcription between tumors and normal samples were analyzed by t-tests. HRs and P value were calculated by univariate Cox regression model in PrognoScan, and by log rank test in GEPIA2 and Kaplan-Meier Plotter. Pearson or Spearman correlation analyses were utilized as above. The ROC curve was used to test the accuracy of XIST expression in the diagnosis of breast cancer and the maximum value of Uden's index (Uden's index = sensitivity + specificity-1) was used to identify the cut-off value. According to the cut-off value, we divided these patients into two groups, named as “positive group” and “negative group”. Then, Chi-squared test (χ2) was utilized to compare clinicopathological parameters in two groups by SPSS 20.0. The comparison of XIST in 98 samples between breast tumors and normal tissues was conducted by Graphpad 6.0. Above all, P < 0.05 was set as a statistically significant threshold.

3. Results

3.1. The RNA expression level of XIST in multiple cancers

Three databases, Oncomine, TIMER 2.0 and GEPIA2 displayed the transcription levels of XIST in various types of cancers. In Oncomine, compared to normal tissues, XIST expression was obviously lower in several cancers, such as BRCA, COAD, LUAD, lymphoma and OV (Figure 1A). The details of XIST expression in cancers were shown in Table 1. In TIMER 2.0, XIST expression was also decreased in BRCA in comparison of normal tissues (Figure 1B). In addition, XIST was down-regulated in KICH, THCA and UCEC (Figure 1B). However, it seemed that XIST expression was higher in KIRC and PRAD (Figure 1B). As shown in Figure 1C, the expression levels of XIST seemed to be skimble-scamble in different types of human cancers in GEPIA2. Concretely, XIST expression was decreased significantly in CESC, COAD, OV, READ, STAD, UCEC and UCS; but it was up-regulated in five cancers, including ACC, DLBC, LUAD, TGCT and THCA. However, there were no significant differences between other tumors and normal tissues in GEPIA2, including BRCA. On the whole, XIST was abnormally expressed in different cancers, especially in BRCA, OV, COAD and READ.

Figure 1.

Figure 1

XIST transcript in pan-cancer. (A) The transcription levels of XIST in different cancers in Oncomine with exact thresholds (gene rank = 10%, fold change = 2, and P < 0.0001). The cell number represented the dataset number with blue for low expression and red for high expression. (B) Differential XIST expression between tumors and normal tissues in TIMER 2.0. Red represented tumors and blue represented normal tissues. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001. (C) Comparison of XIST expression between tumors and normal tissues in GEPIA2. Compared with normal tissues, red represented cancer samples and significantly higher expression in tumors, green represented normal samples and significantly lower expression in tumors, and black represented no significance.

Table 1.

Datasets of XIST transcript across cancers in Oncomine.

Cancer Site Dataset Types of Cancer vs Normal N of normal N of cancer Fold change t-test p-value
Breast TCGA Male Breast Carcinoma 61 3 -927.150 -38.493 3.13E-9
Richardson et al. Ductal Breast Carcinoma 7 40 -3.990 -6.837 9.31E-9
Curtis et al. Invasive Breast Carcinoma 144 21 -2.083 -7.369 4.69E-8
Invasive Ductal Breast Carcinoma 144 1556 -2.124 -20.652 3.87E-52
Invasive Ductal and Invasive Lobular Breast Carcinoma 144 90 -2.100 -12.619 1.77E-26
Breast Carcinoma 144 14 -2.195 -6.996 1.72E-6
Medullary Breast Carcinoma 144 32 -2.420 -8.520 1.09E-10
Finak et al. Invasive Breast Carcinoma Stroma 6 53 11.738 18.041 1.50E-24
Colon Skrzypczak et al. Colon Adenoma 10 5 -4.884 -16.820 2.40E-10
Colon Carcinoma 10 5 -6.720 -16.677 2.55E-10
Colon Adenoma Epithelia 10 5 -10.737 -12.261 1.73E-8
Colon Carcinoma Epithelia 10 5 -18.031 -14.500 2.58E-9
Blood Choi et al.∗ Chronic Adult T-Cell Leukemia/Lymphoma 6 19 6.115 5.988 3.90E-6
Liver Chen et al. Hepatocellular Adenoma 74 2 12.984 14.540 1.43E-12
Lung Garber et al. Lung Adenocarcinoma 6 38 -3.124 -4.837 1.42E-5
Lymph Eckerle et al. Primary Cutaneous Anaplastic Large Cell Lymphoma 41 7 -7.205 -7.132 2.93E-9
Anaplastic Large Cell Lymphoma, ALK-Negative 41 4 -2.951 -5.351 1.60E-6
Classical Hodgkin's Lymphoma 41 4 -2.251 -5.701 7.60E-7
Anaplastic Large Cell Lymphoma, ALK-Positive 41 5 -2.914 -4.968 6.71E-6
Piccaluga et al. Angioimmunoblastic T-Cell Lymphoma 20 6 -2.333 -4.967 4.94E-5
Choi et al.∗ Chronic Adult T-Cell Leukemia/Lymphoma 6 19 6.115 5.988 3.90E-6
Ovary Welsh et al. Ovarian Serous Surface Papillary Carcinoma 4 28 -10.653 -5.545 2.78E-6
Testis Sperger et al. Testicular Seminoma 19 23 14.082 10.531 1.53E-11
Korkola et al. Seminoma, NOS 6 12 12.122 8.343 9.28E-7
∗

Choi et al. analyzed Chronic Adult T-Cell Leukemia/Lymphoma and Chronic Adult T-Cell Leukemia/Lymphoma at the same time.

3.2. Prognostic value of XIST in human pan-cancer

Then, we analyzed the prognostic role of XIST across cancers in GEPIA2, Kaplan-Meier Plotter and PrognoScan. In GEPIA2, higher expression of XIST indicated longer overall survival rates of patients with CESC and SKCM, but predicted worse prognosis of KIRP (Figure 2A). In addition, XIST expression was positively related to DFS in COAD (Figure 2B). In Kaplan-Meier Plotter, XIST indicated good prognosis of OS in ESCC (P = 0.008), PCPG (P = 0.0034) and STAD (P = 0.047, Figure 3A), and was a favourable factor for RFS in OV (P = 0.0059), STAD (P = 0.005) and UCEC (P = 0.048, Figure 3B). However, XIST was linked to poor outcomes for cancers of HNSC, KIRC, KIRP, LIHC and PAAD. PrognoScan also showed that XIST played an unfavourable prognostic role in several cancers, including BLCA (Figure 4A, OS: Cox P = 0.0192), non-small-cell lung cancer (NSCLC, Figure 4L, RFS: Cox P = 0.0084) and renal cell carcinoma (RCC, Figure 4N, OS: Cox P = 0.0327). But XIST played a protective role in other 6 cancer types, including LAML (Figure 4B, OS: Cox P = 0.0324), GBM (Figure 4C, OS: Cox P = 0.0285), BRCA (Figure 4D, RFS: Cox P = 0.0180; Figure 4E, DSS: Cox P = 0.0001; Figure 4F, DFS: Cox P = 0.0056), COAD (Figure 4H, OS: Cox P = 0.0229; Figure 4I, DSS: Cox P = 0.0228; Figure 4J, DFS: Cox P = 0.0343), LUAD (Figure 4K, OS: Cox P = 0.0004) and OV (Figure 4M, OS: Cox P = 0.0074). However, it seemed that XIST was not a favourable factor for DMFS in BRCA (Figure 4G, Cox P = 0.0231). The details of survival analyses in PrognoScan were listed in Table 2.

Figure 2.

Figure 2

Prognosis analyses of XIST across cancers in GEPIA. (A) OS; (B) DFS. Red represented high risk and blue represented low risk.

Figure 3.

Figure 3

Prognosis analyses of XIST across cancers in Kaplan-Meier Plotter. (A) OS; (B) RFS.

Figure 4.

Figure 4

Prognosis analyses of XIST across cancers in PrognoScan. (A) OS of BLCA; (B) OS of AML; (C) OS of GBM; (D) RFS of BRCA; (E) DSS of BRCA; (F) DFS of BRCA; (G) DMFS of BRCA; (H) OS of COAD; (I) DSS of COAD; (J) DFS of COAD; (K) OS of LUAD; (L) RFS of NSCLC; (M) OS of OV; (N) OS of Renal cell carcinoma.

Table 2.

Prognosis analyses of XIST expression across cancers by univariate Cox regression model in PrognoScan.

CANCER TYPE DATASET SUBTYPE ENDPOINT N CUTPOINT HR [95% CI] p-VALUE
Bladder cancer GSE5287 Overall Survival 30 0.57 1.09 [0.88–1.37] 0.424157
GSE13507 Overall Survival 165 0.78 1.18 [1.03–1.36] 0.019154
Transitional cell carcinoma Disease Specific Survival 165 0.82 1.20 [0.99–1.45] 0.060675
Blood cancer GSE12417-GPL96 AML Overall Survival 163 0.49 0.98 [0.88–1.09] 0.726558
GSE12417-GPL97 AML Overall Survival 163 0.12 1.60 [0.58–4.43] 0.36404
GSE12417-GPL570 AML Overall Survival 79 0.15 0.61 [0.39–0.96] 0.032417
GSE5122 AML Overall Survival 58 0.19 1.02 [0.87–1.20] 0.776297
GSE8970 AML Overall Survival 34 0.24 0.86 [0.68–1.09] 0.21609
GSE4475 B-cell lymphoma Overall Survival 158 0.23 1.03 [0.86–1.22] 0.769231
E-TABM-346 DLBCL Overall Survival 53 0.85 1.11 [0.91–1.36] 0.295587
DLBCL Event Free Survival 53 0.85 1.20 [0.99–1.45] 0.064109
GSE16131-GPL96 Follicular lymphoma Overall Survival 180 0.21 1.02 [0.96–1.09] 0.440844
GSE16131-GPL97 Follicular lymphoma Overall Survival 180 0.86 1.01 [0.95–1.08] 0.769404
GSE2658 Multiple myeloma Disease Specific Survival 559 0.19 0.98 [0.88–1.10] 0.751994
Brain cancer GSE4271-GPL96 Astrocytoma Overall Survival 77 0.4 0.94 [0.82–1.08] 0.395516
GSE4271-GPL97 Astrocytoma Overall Survival 77 0.27 0.87 [0.68–1.11] 0.272633
GSE7696 Glioblastoma Overall Survival 70 0.87 0.33 [0.13–0.89] 0.028511
MGH-glioma Glioma Overall Survival 50 0.44 1.00 [0.73–1.37] 0.984826
GSE4412-GPL96 Glioma Overall Survival 74 0.73 0.88 [0.76–1.02] 0.094787
GSE4412-GPL97 Glioma Overall Survival 74 0.62 0.91 [0.83–1.01] 0.073693
GSE16581 Meningioma Overall Survival 67 0.84 68.57 [2.29–2053.81] 0.014788
Breast cancer GSE19615 Distant Metastasis Free Survival 115 0.53 0.79 [0.45–1.38] 0.407813
GSE3143 Overall Survival 158 0.72 1.02 [0.68–1.53] 0.931487
GSE7849 Disease Free Survival 76 0.54 1.29 [0.57–2.94] 0.536705
GSE12276 Relapse Free Survival 204 0.49 0.77 [0.62–0.96] 0.018036
GSE6532-GPL570 Relapse Free Survival 87 0.76 5.11 [1.25–20.89] 0.02312
Distant Metastasis Free Survival 87 0.76 5.11 [1.25–20.89] 0.02312
GSE9195 Distant Metastasis Free Survival 77 0.52 0.85 [0.12–6.07] 0.868331
Relapse Free Survival 77 0.82 0.84 [0.50–1.42] 0.519039
GSE12093 Distant Metastasis Free Survival 136 0.34 0.88 [0.50–1.57] 0.670572
GSE11121 Distant Metastasis Free Survival 200 0.24 0.79 [0.54–1.16] 0.2262
GSE1378 Relapse Free Survival 60 0.6 1.03 [0.82–1.30] 0.796121
GSE1379 Relapse Free Survival 60 0.45 0.88 [0.59–1.30] 0.514418
GSE2034 Distant Metastasis Free Survival 286 0.77 0.98 [0.74–1.30] 0.905737
GSE1456-GPL96 Overall Survival 159 0.4 0.82 [0.53–1.28] 0.391112
Relapse Free Survival 159 0.48 0.64 [0.43–0.94] 0.023968
Disease Specific Survival 159 0.4 0.64 [0.40–1.03] 0.063692
GSE1456-GPL97 Overall Survival 159 0.53 0.83 [0.56–1.22] 0.334743
Relapse Free Survival 159 0.53 0.62 [0.45–0.86] 0.004468
Disease Specific Survival 159 0.53 0.62 [0.42–0.91] 0.013672
GSE7378 Disease Free Survival 54 0.56 0.97 [0.63–1.50] 0.900162
E-TABM-158 Overall Survival 117 0.74 1.07 [0.73–1.59] 0.7209
Distant Metastasis Free Survival 117 0.74 1.35 [0.79–2.33] 0.272623
Relapse Free Survival 117 0.74 1.07 [0.73–1.59] 0.7209
Disease Specific Survival 117 0.74 1.22 [0.76–1.96] 0.418075
GSE3494-GPL96 Disease Specific Survival 236 0.17 0.43 [0.28–0.64] 0.000054
GSE3494-GPL97 Disease Specific Survival 236 0.23 0.34 [0.21–0.55] 0.000009
GSE4922-GPL96 Disease Free Survival 249 0.17 0.68 [0.46–0.99] 0.043122
GSE4922-GPL97 Disease Free Survival 249 0.1 0.53 [0.35–0.81] 0.003717
GSE2990 Relapse Free Survival 62 0.16 0.81 [0.61–1.07] 0.144443
Distant Metastasis Free Survival 125 0.49 1.00 [0.64–1.56] 0.985741
GSE7390 Overall Survival 198 0.15 1.00 [0.84–1.18] 0.974118
Relapse Free Survival 198 0.15 0.96 [0.84–1.10] 0.555227
Distant Metastasis Free Survival 198 0.15 0.99 [0.84–1.16] 0.901166
Colorectal cancer GSE12945 Disease Free Survival 51 0.33 1.02 [0.70–1.50] 0.899923
Overall Survival 62 0.26 1.10 [0.87–1.40] 0.424702
GSE17536 Disease Specific Survival 177 0.72 0.29 [0.10–0.84] 0.022846
Overall Survival 177 0.54 0.31 [0.11–0.86] 0.024521
Disease Free Survival 145 0.74 0.25 [0.07–0.90] 0.034334
GSE14333 Disease Free Survival 226 0.11 0.97 [0.88–1.06] 0.485628
GSE17537 Disease Specific Survival 49 0.27 0.02 [0.00–0.74] 0.033358
Overall Survival 55 0.11 0.07 [0.01–0.73] 0.026241
Disease Free Survival 55 0.31 0.09 [0.01–1.03] 0.053347
Esophagus cancer GSE11595 Adenocarcinoma Overall Survival 34 0.38 0.24 [0.05–1.12] 0.070138
Eye cancer GSE22138 Uveal melanoma Distant Metastasis Free Survival 63 0.14 0.92 [0.79–1.07] 0.294872
Head and neck cancer GSE2837 Squamous cell carcinoma Relapse Free Survival 28 0.68 0.45 [0.01–36.57] 0.722659
Lung cancer jacob-00182-CANDF Adenocarcinoma Overall Survival 82 0.15 0.85 [0.66–1.09] 0.192625
jacob-00182-HLM Adenocarcinoma Overall Survival 79 0.9 1.01 [0.89–1.15] 0.835337
jacob-00182-MSK Adenocarcinoma Overall Survival 104 0.44 0.99 [0.83–1.18] 0.866824
GSE13213 Adenocarcinoma Overall Survival 117 0.62 0.95 [0.91–1.00] 0.053709
GSE31210 Adenocarcinoma Overall Survival 204 0.5 0.93 [0.81–1.07] 0.290452
Adenocarcinoma Relapse Free Survival 204 0.1 0.95 [0.89–1.01] 0.131322
jacob-00182-UM Adenocarcinoma Overall Survival 178 0.6 0.81 [0.73–0.91] 0.000391
GSE3141 NSCLC Overall Survival 111 0.83 1.06 [0.91–1.25] 0.439928
GSE14814 NSCLC Overall Survival 90 0.57 0.96 [0.69–1.32] 0.798698
NSCLC Disease Specific Survival 90 0.12 1.05 [0.75–1.46] 0.795286
GSE4716-GPL3694 NSCLC Overall Survival 50 0.2 0.74 [0.41–1.33] 0.312198
GSE4716-GPL3696 NSCLC Overall Survival 50 0.84 0.56 [0.28–1.11] 0.096181
GSE8894 NSCLC Relapse Free Survival 138 0.83 2.57 [1.27–5.19] 0.008419
GSE4573 Squamous cell carcinoma Overall Survival 129 0.87 0.90 [0.75–1.07] 0.223413
Ovarian cancer GSE9891 Overall Survival 278 0.14 0.51 [0.32–0.84] 0.007439
DUKE-OC Overall Survival 133 0.14 0.87 [0.79–0.96] 0.00412
GSE26712 Disease Free Survival 185 0.78 0.92 [0.81–1.03] 0.152434
Overall Survival 185 0.75 0.92 [0.81–1.05] 0.232231
GSE17260 Progression Free Survival 110 0.15 0.93 [0.82–1.06] 0.29524
Overall Survival 110 0.15 0.91 [0.77–1.07] 0.245215
GSE14764 Overall Survival 80 0.34 0.74 [0.54–1.01] 0.058791
Renal cell carcinoma E-DKFZ-1 Overall Survival 59 0.39 2.37 [1.07–5.21] 0.032722
Skin cancer GSE19234 Melanoma Overall Survival 38 0.13 1.07 [0.82–1.41] 0.61023
Soft tissue cancer GSE30929 Liposarcoma Distant Recurrence Free Survival 140 0.63 0.99 [0.88–1.11] 0.862006

3.3. Interactions of XIST with proteins and miRNAs across cancers

StarBase discovered that XIST could potentially interact with 29 proteins (Figure 5A) and 191 miRNAs (Figure 5B) across cancers. Over 8 proteins were significantly related to XIST in 4 types of cancers, including BRCA, KIRC, OV and UCEC (Figure 5A). Among them, TNRC6, DGCR8, C17ORF85, ZC3H7B, SFRS1 and TIA1, were obviously positively associated with XIST in ≥3 cancers; while eIF4AIII, FXR1, FXR2 and C22ORF28 were significantly negatively correlated with XIST in ≥3 cancers (Figure 5A). Although these miRNAs might be sponged by XIST according to the prediction of LncRNA - miRNA interactions from starBase, their expression levels were different among tumors (Figure 5B). Over 10 miRNAs were negatively related to XIST in KIRC, LAML, COAD and READ, while over 10 miRNAs were positively associated with XIST in KICH, LUAD and OV (Figure 5B). In addition, there were more than a dozen miRNAs both negatively and positively correlated with XIST (≥10, respectively) in BLCA, BRCA, SKCM and UCEC (Figure 5B). Then, we selected out 4 miRNAs, including miR-103a-3p, miR-107, miR-130b-3p and miR-96–5p, which were all negatively related to XIST expression in more than 3 types of cancers. Furthermore, 128 ceRNAs were found to compete with XIST for miRNAs binding and were positively related to XIST across cancers, especially BRCA and UCEC (Figure 6A). Particularly, expressions of ZFX and TXLNG were both positively correlated with XIST in over 10 cancers. According to TargetScan, miRBase and starBase, we scheduled a network of LncRNA - miRNAs - mRNAs (Figure 6B).

Figure 5.

Figure 5

Correlations of XIST with predicted XIST-interacting proteins and miRNAs in starBase. (A) Predicted XIST-interacting proteins; (B) Predicted XIST-interacting miRNAs. Red represented positive correlation and blue represented negative correlation. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

Figure 6.

Figure 6

Correlations of XIST with ceRNAs in starBase. (A) ceRNAs. Red represented positive correlation and blue represented negative correlation. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001. (B) A ceRNA network.

3.4. Correlation between XIST and immune infiltration levels in multiple cancers

To determine the role of XIST in TIME, we analyzed the correlation of XIST expression with immune infiltration through TIMER 2.0 database. Its expression was positively related to infiltration levels of T cell CD4+ memory resting, T cell CD4+ memory, T cell CD4+, Tregs and mast cell in over 8 types of cancers, while it was negatively correlated with T cell CD4+ Th1, Macrophage and T cell NK in more than 8 types (Figure 7A). Hence, XIST might influence immune infiltration in the TME.

Figure 7.

Figure 7

Correlations of XIST with immune infiltration levels and checkpoint markers across cancers in TIMER2. (A) Immune infiltration levels; (B) Immune checkpoint markers. Red represented positive correlation and blue represented negative correlation. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.5. Correlation between XIST and immune checkpoint markers in multiple cancers

To investigate the immunoregulatory mechanism of XIST, we investigated more than 40 common immune checkpoint markers in TIMER 2.0 across cancers. Generally, XIST expression was positively related to about half of these markers in various cancers, such as CD2000, CD200R1, CD274, members of the tumor necrosis factor (TNF) ligand family, and so on (Figure 7B). Figure 8 showed the correlation of XIST expression with 35 immune cell types. Notably, its expression was positively related to most of these cell types (>20) in BRCA. In addition, XIST expression was also positively associated with over 10 cell types in CESC, ESCA, LIHC, LUAD, LUSC, PAAD, PRAD, SKCM-Metastasis, STAD, TGCT and THYM. However, XIST expression was negatively linked with some immune cell types in several cancers, including KIRC (7 cell types), SARC (5 cell types) and TGCT (5 cell types). These results implied that abnormal expression of XIST might become a vital factor for survival of cancer patients through its regulation on the TIME.

Figure 8.

Figure 8

Correlations of XIST with immune cell types in multiple cancers in TIMER2. Red represented positive correlation and blue represented negative correlation. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.6. Correlation between XIST and representative gene mutation across cancers

Next, we analyzed the relationship of XIST expression with 47 types of tumor-associated gene mutation to further explore the mechanism of carcinogenesis of dysregulation of XIST. Generally, theses mutations were weakly related to only several types of cancers (<5 cancer types for each gene mutation, Figure 9). However, in PRAD, XIST expression was significantly negatively associated with mutations of FAT1 and RB1. In READ, its expression was negatively related to 6 gene mutations, including BRCA1, BRIP1, FANCA, NTRK3, PALB2 and TSC1. In addition, XIST was slightly negatively associated with 5 gene mutations in BRCA (APC, ASXL1, BRCA2, ERBB3 and TP53), but positively related to mutation of PIK3CA. These findings reflected that XIST expression might be affected by tumor-associated gene mutation in several cancers, especially BRCA and READ.

Figure 9.

Figure 9

Correlations of XIST with mutations of representative tumor-associated genes across cancers in TIMER2. Red represented positive correlation and blue represented negative correlation. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

3.7. Roles of XIST promoter methylation in expression and prognosis

From EPD and MethPrimer, we identified two CpG islands in XIST promoter (Figure 10A). Among 39 types of cancers, only four cancers, BRCA, UCEC, KIRC and osteosarcoma, had differences of survival time between high and low methylation levels (Figure 10B). Concretely, higher methylation level of XIST indicated shorter overall survival rates of patients with BRCA, UCEC and osteosarcoma, but predicted better prognosis of KIRC (Figure 10B). In these four cancers, XIST promoter methylation was negatively correlated with XIST expression, which indicated that methylation of XIST promoter might contribute to down-regulated expression of XIST in cancers (Figure 10C).

Figure 10.

Figure 10

Methylation analysis of XIST promoter. (A) MethPrimer analysis of XIST promoter; (B) Significant differences of survival time between high and low XIST promoter methylation in EWAS Data Hub; (C) Correlation between XIST promoter methylation and its expression in EWAS Data Hub.

3.8. Clinicopathological role of XIST in breast cancer

Due to these functions of XIST in BRCA in public databases, we selected 98 breast cancer samples to assess its clinicopathological role. Tumors and normal tissues were observed by HE staining (Figure 11A). Compared to normal tissues, XIST expression was obviously lower via qRT-PCR (t = 13.05, P < 0.001, Figure 11B). According to its expression, a ROC curve was conducted in Figure 11C. The AUC (Area Under The Curve) value of XIST was 0.893 (95%CI: 0.837–0.950). The maximum value of Youden's index was 0.827 and the corresponding XIST expression was 0.9928. Thus, samples with expression value ≥0.9928 were included into “positive group” and those with expression value <0.9928 were included into “negative group”. As shown in Table 3, expression of XIST was negatively related to lymph node invasion (P = 0.004) and TNM stage (P = 0.029), but was unrelated to age, tumor size and histopathologic grade.

Figure 11.

Figure 11

Correlation analysis of XIST between breast tumors and normal tissues. (A) Microscopic observation of breast cancer and adjacent tissues with HE staining (×100); (B) Comparison of XIST expression between breast cancer and normal tissues; (C) The ROC curve of XIST. ∗∗∗P < 0.001.

Table 3.

Relationship between XIST expression and clinicopathological parameters of breast cancer.

Parameters n XIST positive expression χ2 p
Total 98 17
Year
≤55 58 9 0.332 0.565
>55 40 8
Tumor size
≤2cm 32 8 2.728 0.256
2–5 cm 34 6
>5 cm 32 3
Histological grade
1 26 5 4.050 0.132
2 41 10
3 31 2
Lymph node invasion
No 29 10 8.435 0.004
Yes 69 7
TNM stage
I 12 4 9.059 0.029
II 50 12
III 29 1
IV 7 0

4. Discussion

LncRNAs were initially described as mere “transcriptional noise”, but now increasing studies have demonstrated that LncRNAs act as critical modulators in a variety of physiological activities [37]. However, only a relatively limited number of LncRNAs have been confirmed to have critical biological functions, and molecular mechanisms of most LncRNAs have not been illustrated [38]. XIST is a pivotal initiator of imprinted and random X-chromosome inactivation in mammals, and it silences one X chromosome in order to avoid the excessive activation of genes [39]. When dysregulation of XIST occurs, varieties of diseases will emerge due to the escape from X chromosome inactivation [39]. But its mechanisms for pathogenesis are more than that. Recent studies have demonstrated that loss of XIST promotes tumor growth and invasion of BRCA due to the reduction of endogenous competition against onco-miRNAs [16, 40]. However, its functions on tumors were not consistent in previous studies. Several researches showed that growth and metastasis of cancer cells were facilitated due to the abnormal upregulation of XIST [17, 18, 41]. This inconformity resulted in failure to determine whether XIST could become a strong prognostic indicator of cancer patients.

From three databases, Oncomine, TIMER and GEPIA, we found relative expression levels of XIST were different among multiple cancers. Particularly, XIST was down-regulated and predicted a good prognosis in BRCA, COAD and OV, but its expression was inconsistent with outcomes in other cancers. For instance, prognostic roles of XIST between BRCA and kidney neoplasms were opposite, which might attribute to different types of cells, sources of germ layers and effects of hormone. Therefore, we demonstrated that XIST might become a good molecular biological indicator for prognosis of patients with BRCA, COAD and OV, though with the heterogeneity of prognostic results among different databases. Our research also showed that XIST expression was obviously lower than that in normal tissues from 98 breast cancer samples and its expression was negatively related to lymph node invasion and TNM stage. However, several studies showed that XIST was up-regulated in these tumors and was negatively linked with survival rates of patients [42, 43, 44]. Hence, more samples are essential to further researches which will be conducted to verify the prognostic roles of XIST in other cancers.

It is well known that LncRNAs can function as sponges for multiple tumor-associated miRNAs and indirectly regulate expression of targeted mRNAs [13]. In this research, 191 miRNAs were found to be possibly interacted with XIST. However, not all of them were negatively related to XIST expression, which might be affected by other factors. Only 4 miRNAs, including miR-103a-3p, miR-107, miR-130b-3p and miR-96–5p, were negatively linked with XIST in more than 3 types of cancers. All of these 4 miRNAs played promoting roles in carcinogenesis by targeting mRNAs [45, 46, 47, 48]. Therefore, XIST might function as a tumor suppressor LncRNA by sponging these onco-miRNAs. In addition, these miRNAs could be in turn interacting with lncRNA XIST, which suggested that up-regulation of them might repress XIST expression in tumor cells.

LncRNAs also played fundamental roles in diverse biological and pathological processes by interacting with specific proteins [3]. To search the proteins combined with XIST, we performed the starBase database and preliminarily determined 29 candidate proteins. Among them, only 6 ones were co-expressed with XIST, including TNRC6, DGCR8, C17ORF85 (NCBP3), ZC3H7B, SFRS1 and TIA1, all of which were involved in the development and progression of diverse tumors [49, 50, 51, 52, 53, 54]. Thus, we identified that these six proteins potentially interacted with XIST. However, further studies need to be performed to confirm whether these proteins can cooperate with XIST to affect biological behaviors and epigenetic pathways of cancers.

Currently, XIST is emerging as a critical immune-related LncRNA and silences a subset of X-linked immune genes [55]. The escape of XIST-dependent genes induced the genesis and recurrence of tumors through diverse perplexing mechanisms [55]. This present research found that XIST was related to infiltration levels of T cell CD4+, Tregs, mast cell, Th1, macrophage and T cell NK in more than 8 types of cancers. One previous study of early-stage LUAD showed that XIST was positively linked with B cells, dendritic cells, follicular helper T cells, mast cells, T cell CD4+/CD8+ effector memory and eosinophil, but was negatively correlated with macrophage, Th2 [56]. In addition, XIST expression was positively related to more than 20 immune checkpoint markers and over 10 immune cell types across cancers. Therefore, we demonstrated that XIST could become a immune-related LncRNA and played a pivotal role in immune-oncology.

Genetic variation is associated with various diseases, especially carcinomas [26]. Mutations of tumor-associated genes appear in carcinomas, including base substitution and frameshift mutation, and regulate expression of downstream genes [26]. Cancer is essentially a genetic disease where cells either die or cancerate, when a certain number of genetic mutations accumulate in the cells. Our research also showed that XIST might be regulated by gene mutation (including APC, BRCA1, BRCA2, TP53 and PIK3CA) in several cancers, especially BRCA, PRAD and READ. Mutations of these genes modulate expressions of diverse downstream genes and have become important therapeutic targets for anticancer drug development [57, 58]. For instance, PARP inhibitors have been used for cancer patients with BRCA1/BRCA2 mutation. The XIST RNA domain number in BRCA1 breast tumor was associated with chromosomal genetic abnormalities, and XIST might become a predictive biomarker for prognosis of patients with BRCA1 breast tumor [27, 59, 60]. But BRCA1 was dispensable for XIST RNA coating of the X chromosome [59]. These findings provided clues on the association between XIST and mutation of tumor-associated genes. Hence, future researches should be conducted to explore possible mechanisms of XIST in multiple cancers.

Besides gene mutation, promoter methylation also contributes to regulation of genes [61]. Our research revealed that expression of XIST was negatively linked with its promoter methylation level. Notably, in BRCA, high level of XIST promoter methylation correlated with a poor prognosis, while high expression of XIST predicted a well outcome. Thus, in a sense, low expression of XIST might arise from its promoter methylation, which became an important factor for progression and metastasis of tumors, especially BRCA. Therefore, we need to conduct further researches to verify the effect of XIST promoter methylation. In addition, methylation of promoter of XIST theoretically correlated with immune infiltration. However, no databases were found to access relationships between methylation of promoter and immune infiltration in cancers. Therefore, more researches, like chromatin immunoprecipitation, need to be conducted to confirm the correlation between methylation of XIST promoter and immune infiltration in BRCA.

Admittedly, this research still had some limitations. First, it was difficult to analyze the prognostic value of XIST in sub-types of cancers through public datasets. Secondly, since this study was based on pan-cancer data, we failed to prove all the ideas at the same time. Thirdly, our results lacked external validation in other public databases or in vitro and in vivo researches. This theoretical work remains to be verified. For example, more cancer patients will be selected out and divided into groups by sub-types with 5-year or 10-year follow-up, so that we can confirm the prognostic roles both of expression and methylation of XIST in sub-types of cancers.

5. Conclusion

In conclusion, dysregulation of LncRNA XIST was significantly associated with prognosis, miRNAs, immune cell infiltration, mutations of tumor-associated genes and its promoter methylation in multiple cancers, especially BRCA and colorectal cancer. XIST may act as a novel biomarker for survival and immunotherapy across cancers in the immediate future.

Declarations

Author contribution statement

Wei Han: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Chun-tao Shi; Jun Ma: Performed the experiments; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Hua Chen; Ying Zhou; Jing-feng Gu: Performed the experiments.

Qi-xiang Shao: Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data.

Xiao-jiao Gao: Performed the experiments; Analyzed and interpreted the data.

Hao-nan Wang: Conceived and designed the experiments; Analyzed and interpreted the data.

Funding statement

Dr. Hao-nan Wang was supported by Wuxi Municipal Bureau on Science and Technology [Y20212039].

Wei Han was supported by Suzhou Scientific and Technological Development Plan (People's Livelihood Science and Technology - Basic Research Project of Medical Treatment and Health Application) [SYS2020060], Kunshan Major Project of Social Research and Development [KS19038].

Qi-xiang Shao was supported by High-Level Medical Talents in Kunshan [ksgccrc2007].

Data availability statement

Data included in article/supplementary material/referenced in article.

Declaration of interest’s statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.

Acknowledgements

Not applicable.

References

  • 1.Sung H., Ferlay J., Siegel R.L., et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2021:1–41. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
  • 2.Cao W., Chen H.D., Yu Y.W., et al. Changing profiles of cancer burden worldwide and in China: a secondary analysis of the global cancer statistics 2020. Chin. Med. J. 2021;134(7):783–791. doi: 10.1097/CM9.0000000000001474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhou S., Zeng H., Huang J., et al. Epigenetic regulation of melanogenesis. Ageing Res. Rev. 2021;69 doi: 10.1016/j.arr.2021.101349. [DOI] [PubMed] [Google Scholar]
  • 4.Zhong Q., Lu M., Yuan W., et al. Eight-lncRNA signature of cervical cancer were identified by integrating DNA methylation, copy number variation and transcriptome data. J. Transl. Med. 2021;19(1):58. doi: 10.1186/s12967-021-02705-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Su G., Yan Z., Deng M. Sevoflurane inhibits proliferation, invasion, but enhances apoptosis of lung cancer cells by wnt/beta-catenin signaling via regulating lncRNA PCAT6/miR-326 Axis. Open Life Sci. 2020;15:159–172. doi: 10.1515/biol-2020-0017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pathania A.S., Challagundla K.B. Exosomal long non-coding RNAs: emerging players in the tumor microenvironment. Mol. Ther. Nucleic Acids. 2020;23:1371–1383. doi: 10.1016/j.omtn.2020.09.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bai Y., Lin H., Chen J., et al. Identification of prognostic glycolysis-related lncRNA signature in tumor immune microenvironment of hepatocellular carcinoma. Front. Mol. Biosci. 2021;8 doi: 10.3389/fmolb.2021.645084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wu H., Zhang Z.Y., Zhang Z., et al. Prediction of bladder cancer outcome by identifying and validating a mutation-derived genomic instability-associated long noncoding RNA (lncRNA) signature. Bioengineered. 2021;12(1):1725–1738. doi: 10.1080/21655979.2021.1924555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Boeren J., Gribnau J. Xist-mediated chromatin changes that establish silencing of an entire X chromosome in mammals. Curr. Opin. Cell Biol. 2021;70:44–50. doi: 10.1016/j.ceb.2020.11.004. [DOI] [PubMed] [Google Scholar]
  • 10.Xu J., Li H., Lv Y., et al. Silencing XIST mitigated lipopolysaccharide (LPS)-induced inflammatory injury in human lung fibroblast WI-38 cells through modulating miR-30b-5p/CCL16 axis and TLR4/NF-kappaB signaling pathway. Open Life Sci. 2021;16(1):108–127. doi: 10.1515/biol-2021-0005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Ma T., Jia H., Ji P., et al. Identification of the candidate lncRNA biomarkers for acute kidney injury: a systematic review and meta-analysis. Expert Rev. Mol. Diagn. 2021;21(1):77–89. doi: 10.1080/14737159.2021.1873131. [DOI] [PubMed] [Google Scholar]
  • 12.Xu Y., Fu Z., Gao X., et al. Long non-coding RNA XIST promotes retinoblastoma cell proliferation, migration, and invasion by modulating microRNA-191-5p/brain derived neurotrophic factor. Bioengineered. 2021;12(1):1587–1598. doi: 10.1080/21655979.2021.1918991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Li H.L., Han P.H., Pan D.Q., et al. LncRNA XIST regulates cell proliferation, migration and invasion of glioblastoma via regulating miR-448 and ROCK1. J. Biol. Regul. Homeost. Agents. 2020;34(6):2049–2058. doi: 10.23812/20-558-L. [DOI] [PubMed] [Google Scholar]
  • 14.Ma S.Q., Wang Y.C., Li Y., et al. LncRNA XIST promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by downregulating miR-27b-3p. J. Biol. Regul. Homeost. Agents. 2020;34(6):1993–2001. doi: 10.23812/20-222-A. [DOI] [PubMed] [Google Scholar]
  • 15.Li X., Hou L., Yin L., et al. LncRNA XIST interacts with miR-454 to inhibit cells proliferation, epithelial mesenchymal transition and induces apoptosis in triple-negative breast cancer. J. Biosci. 2020;45:45. [PubMed] [Google Scholar]
  • 16.Xing F., Liu Y., Wu S.Y., et al. Loss of XIST in breast cancer activates MSN-c-met and reprograms microglia via exosomal miRNA to promote brain metastasis. Cancer Res. 2018;78(15):4316–4330. doi: 10.1158/0008-5472.CAN-18-1102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang N., He J.X., Jia G.Z., et al. The lncRNA XIST promotes colorectal cancer cell growth through regulating the miR-497-5p/FOXK1 axis. Cancer Cell Int. 2020;20(1):553. doi: 10.1186/s12935-020-01647-4. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 18.Wang C., Li L., Li M., et al. Silencing long non-coding RNA XIST suppresses drug resistance in acute myeloid leukemia through down-regulation of MYC by elevating microRNA-29a expression. Mol. Med. 2020 Nov 24;26(1):114. doi: 10.1186/s10020-020-00229-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang X., Zhang S., He C., et al. METTL14 suppresses proliferation and metastasis of colorectal cancer by down-regulating oncogenic long non-coding RNA XIST. Mol. Cancer. 2020;19(1):46. doi: 10.1186/s12943-020-1146-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li W., He Y., Cheng Z. Long noncoding RNA XIST knockdown suppresses the growth of colorectal cancer cells via regulating microRNA-338-3p/PAX5 axis. Eur. J. Cancer Prev. 2021;30(2):132–142. doi: 10.1097/CEJ.0000000000000596. [DOI] [PubMed] [Google Scholar]
  • 21.Olalekan S., Xie B., Back R., et al. Characterizing the tumor microenvironment of metastatic ovarian cancer by single-cell transcriptomics. Cell Rep. 2021;35(8) doi: 10.1016/j.celrep.2021.109165. [DOI] [PubMed] [Google Scholar]
  • 22.Yin W., Zhu H., Tan J., et al. Identification of collagen genes related to immune infiltration and epithelial-mesenchymal transition in glioma. Cancer Cell Int. 2021;21(1):276. doi: 10.1186/s12935-021-01982-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang Y.P., Li H.Q., Chen J.X., et al. Overexpression of XIST facilitates cell proliferation, invasion and suppresses cell apoptosis by reducing radio-sensitivity of glioma cells via miR-329-3p/CREB1 axis. Eur. Rev. Med. Pharmacol. Sci. 2020;24(6):3190–3203. doi: 10.26355/eurrev_202003_20686. [DOI] [PubMed] [Google Scholar]
  • 24.Witusik-Perkowska M., Jaskólski D.J., Liberski P.P., et al. If artificial in vitro microenvironment can influence tumor drug resistance network via modulation of lncRNA expression?-comparative analysis of glioblastoma-derived cell culture models and initial tumors in vivo. Cell. Mol. Neurobiol. 2020;42(4):1005–1020. doi: 10.1007/s10571-020-00991-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hamed M.M., Handoussa H., Hussein N.H., et al. Oleuropin controls miR-194/XIST/PD-L1 loop in triple negative breast cancer: new role of nutri-epigenetics in immune-oncology. Life Sci. 2021;277 doi: 10.1016/j.lfs.2021.119353. [DOI] [PubMed] [Google Scholar]
  • 26.Samstein R.M., Krishna C., Ma X., et al. Mutations in BRCA1 and BRCA2 differentially affect the tumor microenvironment and response to checkpoint blockade immunotherapy. Nat. Can. (Que.) 2021;1(12):1188–1203. doi: 10.1038/s43018-020-00139-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Schouten P.C., Vollebergh M.A., Opdam M., et al. High XIST and low 53BP1 expression predict poor outcome after high-dose alkylating chemotherapy in patients with a BRCA1-like breast cancer. Mol. Cancer Therapeut. 2016;15(1):190–198. doi: 10.1158/1535-7163.MCT-15-0470. [DOI] [PubMed] [Google Scholar]
  • 28.Yu X., Wang D., Wang X., et al. CXCL12/CXCR4 promotes inflammation-driven colorectal cancer progression through activation of RhoA signaling by sponging miR-133a-3p. J. Exp. Clin. Cancer Res. 2019;38(1):32. doi: 10.1186/s13046-018-1014-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li T., Fu J., Zeng Z., et al. TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res. 2020;48(W1):W509–W514. doi: 10.1093/nar/gkaa407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Li T., Fan J., Wang B., et al. TIMER: a web server for comprehensive analysis of tumor-infiltrating immune cells. Cancer Res. 2017;77(21):e108–e110. doi: 10.1158/0008-5472.CAN-17-0307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tang Z., Kang B., Li C., et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Res. 2019;47(W1):W556–W560. doi: 10.1093/nar/gkz430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mizuno H., Kitada K., Nakai K., et al. PrognoScan: a new database for meta-analysis of the prognostic value of genes. BMC Med. Genom. 2009;2:18. doi: 10.1186/1755-8794-2-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Lánczky A., Győrffy B. Web-based survival analysis tool tailored for medical research (KMplot): development and implementation. J. Med. Internet Res. 2021;23(7) doi: 10.2196/27633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li J.H., Liu S., Zhou H., et al. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 2014;42:D92–D97. doi: 10.1093/nar/gkt1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Dreos R., Ambrosini G., Groux R., et al. The eukaryotic promoter database in its 30th year: focus on non-vertebrate organisms. Nucleic Acids Res. 2017;45(D1):D51–D55. doi: 10.1093/nar/gkw1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Xiong Z., Li M., Yang F., et al. EWAS Data Hub: a resource of DNA methylation array data and metadata. Nucleic Acids Res. 2020;48(D1):D890–D895. doi: 10.1093/nar/gkz840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yadav B., Pal S., Rubstov Y., et al. LncRNAs associated with glioblastoma: from transcriptional noise to novel regulators with a promising role in therapeutics. Mol. Ther. Nucleic Acids. 2021;24:728–742. doi: 10.1016/j.omtn.2021.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang Y., Chen S., Li W., et al. Associating divergent lncRNAs with target genes by integrating genome sequence, gene expression and chromatin accessibility data. NAR Genom Bioinform. 2020;2(2):lqaa019. doi: 10.1093/nargab/lqaa019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Senner C.E., Nesterova T.B., Norton S., et al. Disruption of a conserved region of Xist exon 1 impairs Xist RNA localisation and X-linked gene silencing during random and imprinted X chromosome inactivation. Development. 2011;138(8):1541–1550. doi: 10.1242/dev.056812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liu B., Luo C., Lin H., et al. Cancer Biother Radiopharm; 2020 Jul 29. Long Noncoding RNA XIST Acts as a ceRNA of miR-362-5p to Suppress Breast Cancer Progression. [DOI] [PubMed] [Google Scholar]
  • 41.He X., Luo X., Dong J., et al. Long non-coding RNA XIST promotes wilms tumor progression through the miR-194-5p/YAP Axis. Cancer Manag. Res. 2021;13:3171–3180. doi: 10.2147/CMAR.S297842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu C., Lu Z., Liu H., et al. LncRNA XIST promotes the progression of laryngeal squamous cell carcinoma via sponging miR-125b-5p to modulate TRIB2. Biosci. Rep. 2020;40(4) doi: 10.1042/BSR20193172. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 43.Zhou X., Xu X., Gao C., et al. XIST promote the proliferation and migration of non-small cell lung cancer cells via sponging miR-16 and regulating CDK8 expression. Am J Transl Res. 2019;11(9):6196–6206. [PMC free article] [PubMed] [Google Scholar]
  • 44.Zuo K., Zhao Y., Zheng Y., et al. Long non-coding RNA XIST promotes malignant behavior of epithelial ovarian cancer. OncoTargets Ther. 2019;12:7261–7267. doi: 10.2147/OTT.S204369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tian T., Yang Q., Zhang C., et al. MiRNA-107 enhances the malignant progression of pancreatic cancer by targeting TGFBR3. PLoS One. 2021;16(5) doi: 10.1371/journal.pone.0249375. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 46.Yan W., Wang Y., Chen Y., et al. Exosomal miR-130b-3p promotes progression and tubular formation through targeting PTEN in oral squamous cell carcinoma. Front. Cell Dev. Biol. 2021;9 doi: 10.3389/fcell.2021.616306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zhang M.L., Sun W.H., Wu H.Q., et al. Knockdown of microRNA-103a-3p inhibits the malignancy of thyroid cancer cells through Hippo signaling pathway by upregulating LATS1. Neoplasma. 2020;67(6):1266–1278. doi: 10.4149/neo_2020_191224N1331. [DOI] [PubMed] [Google Scholar]
  • 48.Wang B., Liu X., Meng X. miR-96-5p enhances cell proliferation and invasion via targeted regulation of ZDHHC5 in gastric cancer. Biosci. Rep. 2020;40(4) doi: 10.1042/BSR20191845. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 49.Li Y., Wang L., Rivera-Serrano E.E., et al. TNRC6 proteins modulate hepatitis C virus replication by spatially regulating the binding of miR-122/Ago2 complexes to viral RNA. Nucleic Acids Res. 2019;47(12):6411–6424. doi: 10.1093/nar/gkz278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhang C., Chen H., Deng Z., et al. DGCR8/miR-106 Axis enhances radiosensitivity of head and neck squamous cell carcinomas by downregulating RUNX3. Front. Med. 2020;7 doi: 10.3389/fmed.2020.582097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lu B., Chen J., Shao Y., et al. Two cases of ZC3H7B-BCOR high grade endometrial stromal sarcoma with an extension on its morphological features. Pathology. 2020;52(6):708–712. doi: 10.1016/j.pathol.2020.05.007. [DOI] [PubMed] [Google Scholar]
  • 52.Kavunja H.W., Voss P.G., Wang J.L., et al. Identification of lectins from metastatic cancer cells through magnetic glyconanoparticles. Isr. J. Chem. 2015;55(3-4):423–436. doi: 10.1002/ijch.201400156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wen W., Zhao Q., Yin M., et al. Seneca valley virus 3C protease inhibits stress granule formation by disrupting eIF4GI-G3BP1 interaction. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.577838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Yang Z., Pan Y., Chen T., et al. Cytotoxicity and immune dysfunction of dendritic cells caused by graphene oxide. Front. Pharmacol. 2020;11:1206. doi: 10.3389/fphar.2020.01206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yu B., Qi Y., Li R., et al. B cell-specific XIST complex enforces X-inactivation and restrains atypical B cells. Cell. 2021;184(7):1790–1803. doi: 10.1016/j.cell.2021.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Mu L., Ding K., Tu R., et al. Identification of 4 immune cells and a 5-lncRNA risk signature with prognosis for early-stage lung adenocarcinoma. J. Transl. Med. 2021;19(1):127. doi: 10.1186/s12967-021-02800-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Machado C.B., Da Silva E.L., Dias Nogueira B.M., et al. PARP1 is overexpressed in hematological malignant cell lines: a framework for experimental oncology. Anticancer Res. 2021;41(5):2397–2402. doi: 10.21873/anticanres.15014. [DOI] [PubMed] [Google Scholar]
  • 58.Saraf R., Agah S., Datta A., et al. Drug target ranking for glioblastoma multiforme. BMC Biomed Eng. 2021;3(1):7. doi: 10.1186/s42490-021-00052-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Vincent-Salomon A., Ganem-Elbaz C., Manié E., et al. X inactive-specific transcript RNA coating and genetic instability of the X chromosome in BRCA1 breast tumors. Cancer Res. 2007;67(11):5134–5140. doi: 10.1158/0008-5472.CAN-07-0465. [DOI] [PubMed] [Google Scholar]
  • 60.Katopodis P., Dong Q., Halai H., et al. Silico and in vitro analysis of lncRNA XIST reveals a panel of possible lung cancer regulators and a five-gene diagnostic signature. Cancers. 2020;12(12):3499. doi: 10.3390/cancers12123499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Bennett M., Cleaves K., Hewezi T. Expression patterns of DNA methylation and demethylation genes during plant development and in response to phytohormones. Int. J. Mol. Sci. 2021;22(18):9681. doi: 10.3390/ijms22189681. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data included in article/supplementary material/referenced in article.


Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES