Macleaya cordata extract modulates inflammation via inhibition of the NF-κB and MAPK signaling pathways in porcine alveolar macrophages induced by Glaesserella parasuis

Abstract

Glässer’s disease in pigs is associated with infection by Glaesserella parasuis and is characterized by pneumonia-like symptoms, fibrinous polyserositis, polyarthritis, and meningitis. Macleaya cordata, a commonly used traditional Chinese medication, has been shown to have anti-inflammatory, antiviral, antioxidative, antimicrobial, insecticidal, and antitumor properties. However, the anti-inflammatory effects of M. cordata on G. parasuis stimulation are still poorly understood. This study explored the anti-inflammatory effects and mechanisms of M. cordata extract on G. parasuis-induced inflammatory responses, via the nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways, in porcine alveolar macrophages (PAMs). Porcine alveolar macrophages, when stimulated with G. parasuis, initiated transcription of interleukin (IL)-1α, IL-1β, IL-6, IL-8, and tumor necrosis factor alpha (TNF-α). Furthermore, p65, IκBα, p38, extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) phosphorylation were upregulated via the NF-κB and MAPK signaling pathways. However, treatment with M. cordata extract inhibited transcription of IL-1α, IL-1β, IL-6, IL-8, and TNF-α and reduced p65, IκBα, p38, ERK, and JNK phosphorylation, by inhibiting activation of the NF-κB and MAPK signaling pathways in PAMs induced by G. parasuis. These findings reveal that M. cordata extract can reverse the inflammatory effect initiated by G. parasuis in vitro and that it possesses significant immunosuppression activity; thus, it may offer a novel strategy for controlling and treating G. parasuis infection.

Introduction

Glaesserella parasuis, a member of the family Pasteurellaceae, is a common commensal extracellular bacterium that colonizes the upper respiratory tract of swine. Glaesserella parasuis is considered the causative agent of Glässer’s disease in pigs, a disorder that is characterized by pneumonia-like symptoms, fibrinous polyserositis, polyarthritis, and meningitis (1). Glaesserella parasuis infection causes a significant increase in mortality and morbidity in swine, giving rise to significant economic losses in the pork industry worldwide (2,3). So far, at least 15 serovars of G. parasuis have been identified, but up to 25% of the isolates in certain countries have not yet been serotyped (4,5). In China, G. parasuis serovars 4 and 5 are the most prevalent, followed by serovars 12, 13, and 14 (6,7). Serovar 5 is regarded as highly virulent, resulting in high mortality and morbidity, whereas serovar 4 is moderately virulent in swine (6). Since pathogenesis of G. parasuis infection is ill-defined and considering the lack of cross-immunity protection between different G. parasuis serovars, control of infections caused by G. parasuis has become increasingly difficult.

Macleaya cordata is a member of the family Papaveraceae and known to contain various active alkaloids, such as sanguinarine and chelerythrine (8,9). As a traditional medical herb widely used in China, many studies have explored the biological activities of M. cordata, such as anti-inflammatory, antiviral, antioxidative, antimicrobial, insecticidal, and antitumor activities (8,10,11,12). The active ingredient of M. cordata, sanguinarine, was reported to be anti-inflammatory and to inhibit activation of nuclear factor-kappa B (NF-κB), the key regulator of inflammatory response (13,14,15). A recent study determined that isoquinoline alkaloids derived from M. cordata protected broilers from necrotic enteritis, thereby suggesting that these compounds have the potential to be a promising alternative to antibiotics (16). Recent studies have demonstrated that G. parasuis infection could stimulate the production of inflammatory cytokines released through the NF-κB and mitogen-activated protein kinase (MAPK) signaling pathways (17,18). Collectively, these results suggest that M. cordata might disrupt the inflammatory response induced by G. parasuis.

Therefore, in the present study, the effect of M. cordata extract on the activation of the NF-κB and MAPK signaling pathways in porcine alveolar macrophages (PAMs) during G. parasuis stimulation was explored. The results discussed herein demonstrate that G. parasuis could trigger activation of the NF-κB and MAPK signaling pathways in PAMs and that M. cordata extract could inhibit the inflammatory response by inhibiting the activation of NF-κB and MAPK signaling pathways, which may provide a novel strategy for controlling and treating G. parasuis infection in pigs.

Materials and methods

Bacterial strains, growth conditions, and reagents

Glaesserella parasuis strain SW124, which is a highly virulent serovar 4 strain, was obtained from the China Veterinary Culture Collection Center. Glaesserella parasuis was grown in trypticase soy broth or trypticase soy agar (Hope Bio-Technology, Qinghai, China) supplemented with 10 μg/mL of nicotinamide adenine dinucleotide (Solarbio, Beijing, China) and 5% (v/v) inactivated bovine serum, with incubation at 37°C in a 5% CO₂ enriched atmosphere.

Macleaya cordata extract was obtained from Hunan Micolta Bioresource (Changsha, China). Macleaya cordata extract, a solid powder with 40% sanguinarine and 20% chelerythrine, was stored in a dark and dry place. Macleaya cordata extract was dissolved and diluted in RPMI 1640 medium (Invitrogen, Carlsbad, California, USA).

Cell culture conditions

Porcine alveolar macrophages (PAMs) (3D4/2; ATCC, Manassas, Virginia, USA) were cultured in RPMI 1640 medium (Invitrogen) containing 10% (v/v) heat-inactivated fetal bovine serum (Invitrogen). Cells were cultured in a humidified atmosphere at 37°C with 5% CO₂. Cells were sub-cultured upon reaching 90% confluence.

Dosing schedule effect on in vitro PAMs viability

Viability of PAMs was measured using the Cell Counting Kit-8 (CCK8) (Dojindo Molecular Technologies, Tokyo, Japan) (19). The PAMs were seeded in 96-well plates (Costar, New York, New York, USA) at 1 × 10⁵ cells/well and treated with M. cordata extract at final concentrations (0, 6.25, 12.5, 25, 50, 100, 200, 400, 800 ng/mL) for 24 h at 37 °C with 5% CO₂. Subsequently, 10 μL of CCK8 was added to each well and incubated for 2 h at 37°C. Optical density was measured at 450 nm. Cell viability was calculated according to the following formula:

$$\text{cell\hspace{0.17em}viability\hspace{0.17em}}(\%)=(\text{experimental\hspace{0.17em}well}-\text{blank\hspace{0.17em}well}/\text{control\hspace{0.17em}well}-\text{blank\hspace{0.17em}well})\times 100\%.$$

Data were expressed as mean ± standard error of mean (SEM) of samples measured in triplicate. Experiments were repeated at least 3 times independently.

PAMs model of G. parasuis stimulation

To explore the multiplicity of infection (MOI) of G. parasuis in PAMs, 1 × 10⁷ cells were seeded in 24-well plates (Costar). Subsequently, G. parasuis (10⁶, 10⁷, and 10⁸ CFU/mL) was added to each well and the mixture was incubated under 5% CO₂ at 37°C for 3, 6, 12, and 24 h, respectively. Inflammatory cytokines TNF-α and interleukin 1 beta (IL-1β) from the supernatant were quantified by enzyme-linked immunosorbent assay (R&D Systems, Minneapolis, Minnesota, USA) to determine MOI and optimal interaction time.

Quantitative real-time PCR (qRT-PCR)

To determine expression levels of inflammatory cytokines (IL-1α, IL-1β, IL-6, IL-8, and TNF-α) in PAMs induced by G. parasuis, PAMs at 1 × 10⁷ were seeded in 24-well plates (Costar) and incubated with M. cordata extract at final concentrations of 0, 12.5, 25, 50, 100, and 200 ng/mL for 4 h, followed by inoculation of G. parasuis at 1 × 10⁷ CFU/mL for 12 h. Porcine alveolar macrophages were collected and total cellular RNA was extracted using TRIzol (Invitrogen). Obtained RNA was reverse-transcribed to cDNA using a PrimeScript RT reagent Kit (TaKaRa, Dalian, China). Real-time PCR (RT-PCR) was performed with intron-spanning primer pairs (Table I) using SYBR Premix Ex Taq II (TaKaRa) in a CFX96 RT-PCR detection system (Bio-Rad, Berkeley, California, USA). Ribosomal protein L4, stably expressed in PAMs, was used as a reference gene for normalization of gene expression (20). Data were analyzed using the 2^−ΔΔCT method in triplicates of 3 independently conducted experiments.

Table I.

Sequences of oligonucleotides used in qRT-PCR performed in this study.

Target gene	Primer name	Neucleotide sequence (5′–3′)	Length (bp) efficiency	Amplification
IL-1β	IL-1β-F	ACCTGGACCTTGGTTCTCTG	83	95.3%
	IL-1β-R	CATCTGCCTGATGCTCTTGT
IL-1α	IL-1α-F	GAAGAAGAGACGGTTGAG	109	96.5%
	IL-1α-R	GCTGTATGTTGCTGATCT
IL-6	IL-6-F	AATCCAGACAAAGCCACCAC	79	97.4%
	IL-6-R	TCCACTCGTTCTGTGACTGC
IL-8	IL-8-F	TAGGACCAGAGCCAGGAAGA	92	94.8%
	IL-8-R	AGCAGGAAAACTGCCAAGAA
TNF-α	TNF-α-F	CCACCAACGTTTTCCTCACT	82	93.5%
	TNF-α-R	TTGATGGCAGAGAGGAGGTT
TLR4	TLR4-F	TGGAACAGGTATCCCAGAGG	125	94.9%
	TLR4-R	CAGAATCCTGAGGGAGTGGA

Western blot analysis

Porcine alveolar macrophages at 1 × 10⁷ were seeded in 24-well plates (Costar) and pretreated with M. cordata extract (at final concentrations of 0, 12.5, 25, 50, 100, and 200 ng/mL) for 4 h. Glaesserella parasuis at 1 × 10⁷ CFU/mL was added to the wells, followed by incubation for 12 h. Cells were harvested and protein was extracted using a total protein extraction kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Protein concentration was determined using a bicinchoninic acid kit for protein determination (Sigma-Aldrich, St. Louis, Michigan, USA). Proteins were heated with 5 × loading buffer, separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk at room temperature for 2 h. After 3 consecutive washes with tris buffered saline with tween 20 (TBST), the PVDF membranes were incubated with antibodies against p65, p-p65, IκBα, p-IκBα, p38, p-p38, extracellular signal-regulated kinase (ERK), p-ERK, c-Jun N-terminal kinase (JNK), p-JNK, and β-actin (Cell Signaling Technology, Boston, Massachusetts, USA) (1:1000 dilution) at 4°C overnight. After 3 consecutive washes with TBST, the PVDF membranes were incubated with HRP-conjugated goat anti-mouse or goat anti-rabbit antibody (Abbkine, Santa Cruz, California, USA) (1:5000 dilution) at room temperature for 2 h and visualized using an electrochemiluminescence solution (Beyotime Biotechnology). β-actin was used as an inner loading control. Gray value was analyzed, and the relative expression of protein was obtained.

Statistical analysis

Statistical analysis was performed using 1-way analysis of variance with SPSS version 16.0 software (IBM, Chicago, Illinois, USA). Duncan’s multiple comparison test was used to identify differences among groups. P-values < 0.05 were considered statistically significant.

Results

Effect of M. cordata extract on in vitro viability of PAMs

The optimal concentration of M. cordata extract was determined by evaluating the viability of PAMs exposed to different concentrations of M. cordata extract. As the concentration of M. cordata extract decreased from 200 to 6.25 ng/mL, PAM viability increased (from 95.69 to 99.01%) and significant cytotoxicity was not induced (P > 0.05) (Figure 1). However, when the concentration of M. cordata extract was 400 and 800 ng/mL, viability of PAMs was 85.82 and 76.16%, respectively, with significant cytotoxicity (P < 0.01) (Figure 1). Thus, treatment with M. cordata extract at 200 ng/mL was considered safe and could therefore be used in the next studies.

Figure 1.

Effect of Macleaya cordata extract on in vitro viability of porcine alveolar macrophages (PAMs). The PAMs were seeded in 96-well plates at 1 × 10⁵ cells/well and then treated with M. cordata extract at final concentrations (0, 6.25, 12.5, 25, 50, 100, 200, 400, and 800 ng/mL) for 24 h at 37°C with 5% CO₂. Subsequently, 10 μL of CCK8 was added to each well, followed by incubation for 2 h at 37°C. Optical density was measured at 450 nm. Data are expressed as mean ± SEM of triplicate measurements of at least 3 independent experiments.

** P < 0.01 compared with the control.

Determination of a stimulation model of PAMs by G. parasuis

A stimulation model was established in the present study to determine the optimal MOI between G. parasuis and PAMs. When MOI was 1:1 and 10:1, production of TNF-α and IL-1β increased significantly compared with the control group at all time points (P < 0.01) (Figure 2). When MOI was 1:1 and 10:1, and cells were stimulated for 12 and 24 h, concentrations of TNF-α and IL-1β in the cell culture supernatant increased significantly compared to cells incubated for 3 h (P < 0.01) (Figure 2). Therefore, concentration of G. parasuis at 1 × 10⁷ CFU/mL (MOI = 1:1) and incubation time of 12 h were chosen as the parameters for the stimulation model to trigger the inflammatory response in PAMs.

Figure 2.

Determination of a model of infection of porcine alveolar macrophages (PAMs) by G. parasuis. The 1 × 10⁷ cells were seeded in 24-well plates and G. parasuis (10⁶, 10⁷, and 10⁸ CFU/mL) was added to each well and incubated under 5% CO₂ at 37°C for 3, 6, 12, and 24 h, respectively. Inflammatory cytokines TNF-α and IL-1β in the supernatant were measured to determine optimal multiplicity of infection (MOI) and interaction time. Data are expressed as mean ± SEM of triplicate measurements of at least 3 independent experiments.

* P < 0.05 and ** P < 0.01, compared with cells incubated for 3 h.

^# P < 0.05 and ^## P < 0.01, compared with the control.

Effect of M. cordata extract on the expression of proinflammatory cytokines triggered by G. parasuis in PAMs

To evaluate G. parasuis-induced cytokine expression, PAMs were induced by G. parasuis and levels of mRNA expression of cytokines IL-1α, IL-1β, IL-6, IL-8, and TNF-α were determined by qRT-PCR. Levels of mRNA expression of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were significantly upregulated in PAMs following stimulation with G. parasuis for 12 h (P < 0.01) (Figure 3). Moreover, levels of mRNA expression of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were inhibited by pretreatment with M. cordata extract (at final concentrations of 12.5, 25, 50, 100, and 200 ng/mL) in a dose-dependent manner, compared with cells induced by G. parasuis (P < 0.05) (Figure 3).

Figure 3.

Effect of M. cordata extract on the expression of proinflammatory cytokines expression triggered by G. parasuis in porcine alveolar macrophages (PAMs). The 1 × 10⁷ of PAMs were seeded in 24-well plates and pre-treated with M. cordata extract (at final concentrations of 0, 12.5, 25, 50, 100, and 200 ng/mL) for 4 h. Then, 1 × 10⁷ CFU/mL of G. parasuis was added to the wells and incubated for 12 h. Cells were collected and total cellular RNA was isolated and reverse-transcribed to cDNA. Individual transcripts in each sample were measured 3 times independently; RPL4 was used as an internal control. Data are expressed as mean ± SEM of triplicate measurements of at least 3 independent experiments.

** P < 0.01 compared with the control.

^# P < 0.05 and ^## P < 0.01, compared with the model.

Effect of M. cordata extract on the activation of the NF-κB and MAPK signaling pathways induced by G. parasuis in PAMs

Western blot analysis was performed to confirm whether M. cordata extract was involved in the activation of the NF-κB signaling pathway induced by G. parasuis in PAMs. Exposure to G. parasuis for 12 h markedly increased phosphorylation levels of p65 and IκBα (P < 0.01) (Figure 4 B, D); however, protein levels of p65 and IκBα were comparable between the control sample and G. parasuis incubation alone (P > 0.05) (Figure 4 C, E). After pretreatment of PAMs with M. cordata extract, protein expression of p-p65 and p-IκBα were downregulated at all concentrations of M. cordata extract tested in the study in a dose-dependent manner (P < 0.01) (Figure 4 B, D).

Figure 4.

Effect of the pretreatment with Macleaya cordata extract on the activation of the NF-κB signaling pathway induced by G. parasuis stimulation in porcine alveolar macrophages (PAMs). The 1 × 10⁷ PAMs were seeded in 24-well plates and pre-treated with M. cordata extract at different concentrations (0, 12.5, 25, 50, 100, and 200 ng/mL) for 4 h. Then, 1 × 10⁷ CFU/mL of G. parasuis was added into the wells followed by incubation for 12 h. (A) Western blot analysis of p-p65, p65, p-IκBα, and IκBα. Western blot analysis of the aforementioned proteins and quantification of (B) p-p65, (C) p65, (D) p-IκBα, and (E) IκBα; β-actin was used as a loading control. Bar graphs show the relative protein expression obtained from 3 separate experiments. Values presented are mean ± SEM.

** P < 0.01 compared with the control.

^## P < 0.01 compared with the model.

In addition, the effect of the pretreatment with M. cordata extract on the expression of proteins related to the MAPK signaling pathway was measured in PAMs induced by G. parasuis. Protein expression of p-ERK, ERK, p-JNK, JNK, p-p38, and p38 were determined by western blot. Incubation with G. parasuis led to a significant increase in protein levels of p-ERK, p-JNK, and p-p38 (P < 0.01) (Figure 5 B, D, F), whereas protein levels of ERK, JNK, and p38 did not significantly change (P > 0.05) (Figure 5 C, E, G). After PAMs were pretreated with M. cordata extract, expression levels of p-JNK and p-p38 were downregulated when M. cordata extract was used at all tested concentrations (P < 0.05) (Figure 5 D, F) and expression of p-ERK decreased when PAMs were treated with M. cordata extract at 25, 50, 100, and 200 ng/mL (P < 0.01) (Figure 5 B).

Figure 5.

Effect of the pretreatment with M. cordata extract on the activation of the MAPK signaling pathway induced by G. parasuis stimulation in porcine alveolar macrophages (PAMs). The 1 × 10⁷ PAMs were seeded in 24-well plates and pre-treated with M. cordata extract at different concentrations (0, 12.5, 25, 50, 100, and 200 ng/mL) for 4 h. Then, 1 × 10⁷ CFU/mL of G. parasuis was added into the wells followed by incubation for 12 h. (A) Western blot analysis of p-ERK, ERK, p-JNK, JNK, p-p38, and p38. Western blot of the aforementioned proteins and quantification of (B) p-ERK, (C) ERK, (D) p-JNK, (E) JNK, (F) p-p38, and (G) p38. β-actin was used as a loading control. Bar graphs show the relative protein expression obtained from 3 separate experiments. Values presented are mean ± SEM.

** P < 0.01 compared with the control.

^# P < 0.05 and ^## P < 0.01, compared with the model.

Discussion

Previous studies have demonstrated that there is an inflammatory response in the host due to G. parasuis infection (21,22). However, the signaling mechanisms underlying induction of the inflammatory response by G. parasuis remain largely unknown. In this study, it was demonstrated that G. parasuis stimulation induced IL-1α, IL-1β, IL-6, IL-8, and TNF-α transcription via the NF-κB and MAPK signaling pathways in PAMs. Moreover, it was also shown that M. cordata extract could inhibit activation of the NF-κB and MAPK signaling pathways triggered by G. parasuis stimulation, describing the anti-inflammatory effect of M. cordata extract against G. parasuis stimulation for the first time.

Previous studies have showed that G. parasuis can trigger an innate immune response and induce the production of inflammatory cytokines in pig kidney epithelial cells 15, porcine brain microvascular endothelial cells, piglet mononuclear phagocytes, porcine aortic vascular endothelial cells, and PAMs (2,23,24,25,26). Glaesserella parasuis infection effectively induces autophagy in PAMs and is positively associated with internalization of virulent G. parasuis via the AMP-activated protein kinase pathway (2). It has also been shown that the rfaD and rfaF genes mediate lipooligosaccharide induction of proinflammatory cytokines in PAMs by regulating the NF-κB and MAPK signaling pathways during G. parasuis infection (27). Inflammatory cytokines (TNF-α, IL-1β, and IL-6) are considered as important markers of inflammatory disease and they induce tissue injury due to uncontrolled and prolonged function of these proteins (12,28). It was speculated that M. cordata extract suppresses inflammation induced by G. parasuis. Therefore, mRNA expression of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were analyzed in PAMs during stimulation by G. parasuis.

Collectively, mRNA levels of IL-1α, IL-1β, IL-6, IL-8, and TNF-α increased in PAMs upon stimulation with G. parasuis. Furthermore, mRNA levels of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were significantly inhibited in PAMs pretreated with M. cordata extract, suggesting that M. cordata extract can suppress inflammatory responses induced by G. parasuis stimulation.

The NF-κB and MAPK signaling pathways have been known to regulate the expression of pro-inflammatory cytokines (18,29). The NF-κB transcription factor family consists of 5 subunits: p65 (RelA), RelB, c-Rel, NF-κB1 (p105 and its cleaved product, p50), and NF-κB2 (p100 and its cleaved product, p52) (30). Previous studies have indicated that MAPK, the upstream regulators of NF-κB, regulate NF-κB activation (31). The important MAPK family proteins (p38, JNK, and ERK) are major mediators targeting the NF-κB pathway, therefore, are critical in the regulation of inflammatory responses (32). In a recent study, it was suggested that the NF-κB and MAPK signaling pathways are involved in activating the inflammatory response upon G. parasuis infection (17,18). Herein, it was demonstrated that mRNA levels of IL-1α, IL-1β, IL-6, IL-8, and TNF-α increased significantly in PAMs induced by G. parasuis. However, mRNA levels of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were markedly attenuated in PAMs pretreated with M. cordata extract. Therefore, it can be inferred that M. cordata extract suppresses inflammation by inhibiting the NF-κB and MAPK signaling pathways. In addition, protein expression of p65, p-p65, IκBα, p-IκBα, p38, p-p38, ERK, p-ERK, JNK, and p-JNK was determined in the present study. Protein levels of p-p65, p-IκBα, p-p38, p-ERK, and p-JNK increased in PAMs during G. parasuis stimulation. However, treatment with M. cordata extract inhibited protein expression of p-p65, p-IκBα, p-p38, p-ERK, and p-JNK, suggesting that M. cordata extract suppresses inflammatory responses induced by G. parasuis by inhibiting the NF-κB and MAPK signaling pathways.

In summary, this study demonstrated for the first time that M. cordata extract exhibits anti-inflammatory activity in vitro and suppresses activation of the NF-κB and MAPK signaling pathways in PAMs induced by G. parasuis. Moreover, the results shown herein indicate that M. cordata extract may exert significant effects on the regulation of innate immune response, which could represent a promising therapeutic strategy for the treatment of infections caused by G. parasuis. Further studies will be conducted to validate the anti-inflammatory effect of M. cordata extract in a G. parasuis infection model in pigs.