Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2001 Dec;183(23):6943–6946. doi: 10.1128/JB.183.23.6943-6946.2001

IS186 Insertion at a Hot Spot in the lon Promoter as a Basis for Lon Protease Deficiency of Escherichia coli B: Identification of a Consensus Target Sequence for IS186 Transposition

L SaiSree 1, Manjula Reddy 1, J Gowrishankar 1,2,*
PMCID: PMC95536  PMID: 11698384

Abstract

The radiation sensitivity of Escherichia coli B was first described more than 50 years ago, and the genetic locus responsible for the trait was subsequently identified as lon (encoding Lon protease). We now show that both E. coli B and the first reported E. coli K-12 lon mutant, AB1899, carry IS186 insertions in opposite orientations at a single site in the lon promoter region and that this site represents a natural hot spot for transposition of the insertion sequence (IS) element. Our analysis of deposited sequence data for a number of other IS186 insertion sites permitted the deductions that (i) the consensus target site sequence for IS186 transposition is 5′-(G)≥4(N)3–6(C)≥4-3′, (ii) the associated host sequence duplication varies within the range of 6 to 12 bp and encompasses the N(3–6) sequence, and (iii) in a majority of instances, at least one end of the duplication is at the G-N (or N-C) junction. IS186-related sequences were absent in closely related bacterium Salmonella enterica serovar Typhimurium, indicating that this IS element is a recent acquisition in the evolutionary history of E. coli.


The heritability of radiation sensitivity and radiation resistance traits in bacteria was first studied by Evelyn Witkin more than 50 years ago (26, 27), at a time when the genetic basis of inheritance in these organisms was still a matter of debate (14, 26, 27). Her choice of Escherichia coli B as the strain for these studies was historically significant, not least because it is the most radiation sensitive of all natural isolates of E. coli (14). In 1964, Howard-Flanders et al. (12) reported isolation of the first E. coli K-12 lon mutant, AB1899, and stated that “as regards sensitivity to radiation, … K-12 lon resemble strains B… ” That E. coli B (as well as its radiation-resistant suppressor derivative E. coli B/r [26, 27]) is also a natural lon mutant was shown subsequently by Donch and Greenberg (9). Deficiency of the Lon protease (encoded by lon) in the B strains is one reason that they have been developed as E. coli hosts of choice for overproduction of recombinant heterologous proteins (2, 24, 28).

We now report that the lon mutations in both E. coli B and AB1899 (E. coli K-12) were caused by IS186 insertions in opposite orientations at a single site within the spacer region of the lon promoter and that this site is a natural hot spot for IS186 transposition. An unusual feature of this insertion sequence (IS) element is that, unlike most other transposons (7, 25), it is associated with a variable length of duplication of the flanking host sequence at the sites of its insertion (5, 23).

Independent lon::IS186 insertions at a single site in four strains.

We showed earlier (21) that K-12 strain GJ1823 had suffered a spontaneous and unselected IS186 insertion at the same site in the spacer region of the lon promoter as that identified by Ignatov and Chistyakova (13) on a plasmid derivative (pBLI) with the cloned lon gene. The genotype description for strain AB1899 at the E. coli Genetic Stock Center website (http://cgsc.biology.yale.edu) indicates, as a personal communication from D. A. Vlazny and C. W. Hill, that the lon-1 mutation in the strain is caused by IS186 insertion although its position is not specified.

These facts provided us the rationale to compare, at the molecular level, the features of the lon mutation in strains AB1899, B/r, and GJ1823 with that published earlier for the plasmid pBLI by Ignatov and Chistyakova (13). We initially performed PCRs using pairwise combinations of the following three primers, designated A, B, and C, respectively: 5′-TGACCAAGCAGTATCAGG-3′, 5′-AAGATCGTTTACACCCGGCT-3′, and 5′-GAGAAGCTGATTATATCGT-3′. Primers A and B were designed to amplify in PCR the region from −392 to +277 of lon (relative to the start site of lon transcription, taken as +1). Primer C is complementary to a site within the 1.34-kb IS186 element, situated 0.6 kb away from one of its ends. With primer pair A and B, the PCR product obtained with genomic DNA of wild-type E. coli strain MG1655 as the template was 1.3 kb smaller than that obtained with genomic DNA from each of the lon mutants AB1899, GJ1823, and B/r (Fig. 1). With the DNA templates from the three lon mutant strains, primer pair A and C on the one hand and pair B and C on the other behaved mutually exclusively, in that a PCR amplification product was obtained only with the latter for strains AB1899 and GJ1823 and only with the former for strain B/r (Fig. 1). From these findings and from the calculated sizes of the PCR products, one could conclude that all three strains have suffered IS186 insertion mutations in the vicinity of the lon promoter (data not shown) and that the orientation of IS186 in strains AB1899 and GJ1823 was opposite to that in E. coli B/r.

FIG. 1.

FIG. 1

PCR analysis of lon locus in various E. coli strains. Primers A and B (corresponding to two sites in lon) and primer C (corresponding to an internal site in IS186) were used for PCR in the pairwise combinations indicated with genomic DNA templates of the following strains: 1, MG1655 (K-12 wild type); 2, GJ1823 (K-12 lon); 3, AB1899 (K-12 lon); 4, B/r (lon). Methods for PCR and electrophoresis on 0.9% agarose gel were as described previously (22). At the left are shown the positions of DNA markers (sizes in kilobases). Estimated sizes of the observed PCR products were as follows: MG1655 (primers A and B), 0.7 kb; all lon mutants (primers A and B), 2.0 kb; AB1899 and GJ1823 (primers B and C), 1.0 kb; E. coli B/r (primers A and C), 1.1 kb.

DNA sequence analysis of the PCR products obtained above allowed the precise determination of both the site of lon::IS186 insertion and the extent of the flanking target sequence duplication for strains AB1899, GJ1823, and B/r. These data are compared in Fig. 2 with the findings for the lon::IS186 mutation on plasmid pBLI reported earlier (13). The results indicate that, although all four insertions occurred at a single site in the spacer region of the lon promoter (given that the sequences reading from the left to the start of IS186 in all of them are identical), each insertion is molecularly distinct from the other three in terms of IS186 orientation or length of target sequence duplication or both. The inferred pair of sites of staggered endonucleolytic cleavage of the lon target sequence during the process of IS186 transposition in each of the four instances are depicted in Fig. 2.

FIG. 2.

FIG. 2

Molecular identities of various lon:: IS186 insertions. Shown on top is the (double-stranded) sequence of the relevant region of the wild-type lon+ locus (4), and the −10 motif in its promoter region is overlined. Beneath are given (lines 1 through 4) the lon locus sequences determined in this study (using an automated DNA sequencer and associated protocols) for K-12 strains AB1899 and GJ1823 and for E. coli B/r, as well as that reported earlier (13) for plasmid pBLI. In each case, the IS186 sequence (uppercase) is denoted in an abbreviated form by a few nucleotides from the inverted repeat at either end and by the orientation of IS insertion (marked, respectively, as I or II depending on whether the PstI site in IS186 is to the left or to the right of the BamHI site within the element); the orientation in pBLI (∗) was not reported (13). The IS186 sequence itself is represented as having a 25-bp pair of inverted repeats as its ends (15). The flanking host sequence duplications are boxed. Arrows, postulated pairs of staggered endonucleolytic cleavage sites (1 through 4, as above) in the target to generate the four different IS186 insertions.

Copy number of IS186 in different strains.

Whole-genome sequence analysis of wild-type E. coli K-12 strain MG1655 has shown that there are three copies of IS186 in its chromosome (4) (Table 1), and a previous Southern blot hybridization study came to the same conclusion (15). The latter study also reported that E. coli B has the same IS186 copy number as K-12. Our present results (that E. coli B is a lon::IS186 mutant) therefore raised the possibility that IS186 transposition into lon may have occurred by a cut-and-paste mechanism (7) from another chromosomal site in the B strain, followed by the rejoining (that is, recircularization) of the two ends of the broken donor backbone at the latter site. However, such rejoining is considered to be very rare in bacteria (7).

TABLE 1.

Target site sequences for IS186 insertion

Accession no.a Target site sequence (5′–3′)b
AL512784 AGGGGGCGGGGGCAGCACCCCCCTCC
AL392173 TGTGGGG↓TTGGTGCCCCCGCA
AL049646 GGCGGGGGCTG↓CCCCCACC
AL080249 AGGTGGGGGGCAGCCCCCGTCC
AC007999 CGGGGGGCTGA↓CCCCCT
AL390241 GGTGGGGGG↓CAGCCCCC↓GCCCGG
AL355498 GGCGGGGAACATCCC↓ACCCC
AL445189 GGGGGAGGGGGTATAA↓CCCCACCCC
AC006487 CGGGGGGCGG↓CCCCCG
AC004448 GGCGGGGGCTGA↓CCCCCACC
Z97985 CCGGGCGGGGGGCTGA↓CCCCCCCACC
AC006137 CGCGGGGCTCCG↓CCCCCGCC
AF211971 TGGGGGGGTCAGCCCCCCGCC
AC074331 TGGGGGGCAGCCCCCGCC
Z78058 GGGCGGGGGTAGTGACCCCGCC
AE000112c AGTGGCGGGG↓ATCACT↓CCCCGCCGTT
AE000163c TTGTGCGGGG↓AGTAAT↓CCCCGCATCC
AE000327c AAAGCCGGGG↓ATAATT↓CCCCGGTTTT
a

Accession numbers are taken from entries in the GenBank sequence database. 

b

Vertical arrows demarcate the host sequence that underwent duplication following IS186 transposition. The runs of Gs and Cs which are postulated to define the consensus for IS186 insertion (see text) are underlined. It has been assumed that the IS186 element carries a pair of 25-bp inverted repeats at its ends (15). 

c

Entry pertaining to the native IS186 insertions in the wild-type E. coli K-12 chromosome. 

To address this issue further, we examined the chromosomal IS186 copy number in MG1655, K-12 lon::IS186 mutants AB1899 and GJ1823, and E. coli B derivatives B/r and BL21 (24) by Southern blot hybridization. A radiolabeled BamHI-PstI fragment of IS186 was used as probe for hybridization with genomic DNA preparations of the various strains after digestion with enzyme EcoRV, BglI, or PvuII, none of which cuts within the IS186 element. The results, shown in Fig. 3, clearly demonstrate that MG1655 has three copies of IS186 and that K-12 lon::IS186 derivatives AB1899 and GJ1823 each have an additional copy which correlates with the insertion in lon. The two E. coli B derivatives each have five copies of IS186, the most plausible explanation for which is that they represent insertions in the loci homologous to the three of wild-type K-12, with additional copies in lon and near hokX (16). In another study, Birkenbihl and Vielmetter (3) also concluded that an IS186 insertion into a new locus in a K-12 strain represented an additional (fourth) copy of the IS element.

FIG. 3.

FIG. 3

Southern blot hybridization of genomic-DNA preparations from various strains using the IS186 probe. Experimental methods were as described previously (22). The DNA preparations were digested with EcoRV, BglI, or PvuII as indicated and subjected to Southern blot hybridization with a 32P-labeled PstI-BamHI internal fragment of IS186 (obtained from plasmid pHYD138 [21]), followed by autoradiography. Strains employed: 1, MG1655 (K-12 wild type); 2, B/r; 3, AB1899 (K-12 lon); 4, GJ1823 (K-12 lon); 5, BL21 (E. coli B); 6, S. enterica LT2. At the left are shown the positions of migration of DNA markers (sizes in kilobases). Arrows, lon-specific bands in the lanes corresponding to AB1899 and GJ1823; their sizes (5.6 [EcoRV] and 8.4 kb [BglI]) are consistent with those expected from IS186 insertion in the cognate lon-bearing restriction fragments of wild-type K-12 (4, 20).

In the Southern blot hybridization experiment (Fig. 3), we also included bacterial genomic DNA from strain LT2 of closely related organism Salmonella enterica serovar Typhimurium and observed no signal for the IS186 probe. Our finding is consistent with the fact that IS186 sequences have not so far been detected in the unfinished genome sequence of S. enterica (http://www.tigr.org). IS186 has also not been detected in the genome of E. coli O157:H57 (10, 17) or in any of the other sequenced bacterial genomes, indicating that this IS element, much like others such as IS2, IS4, and IS30 (8), may be a recent acquisition in the evolutionary history of E. coli. The findings of Pedersen and Gerdes (16) suggest that IS186 is present in E. coli C and also in not less than 44 of the 72 natural E. coli isolates of the ECOR collection.

Consensus sequence for IS186 transposition.

Different IS elements are known to vary in the extent to which they exhibit target site selectivity for transposition (7, 25). A consensus sequence for IS186 transposition has not previously been determined, although it is known that the insertions occur in G-C rich target sequences (5, 15, 23, 25). Because many eukaryotic sequences cloned in E. coli hosts are G-C rich, several instances of IS186 insertions in them are identified in the GenBank database. We analyzed all the deposited entries to deduce that sequence 5′-(G)≥4(N)3–6(C)≥4-3′ is the consensus target recognition site for IS186 transposition (Table 1). The lon hot spot fits the consensus, as do all but one of the entries listed in Table 1. Our analysis also indicates that, even as its length varies between 6 and 12 bp, the associated host sequence duplication always encompasses the (N)3–6 sequence of the target recognition site. Furthermore, in more than half of the instances examined at least one end of the duplication (that is, at least one site of endonucleolytic cleavage during transposition) is at the G-N (or N-C) junction (Table 1).

These findings may offer approaches to study the mechanism of IS186 transposition, of which at present little is known. Our analysis suggests that, in IS186 transposition, there is an initial specificity in target sequence recognition by transposase but that the sites where subsequent endonucleolytic cleavages occur are less constrained; such a phenomenon invites comparisons with both the mechanism of type I restriction endonuclease action (18) and that of rearrangements of the immunoglobulin genes mediated by the RAG1 and RAG2 proteins, where a preference for G-C-rich sequences at the target sites (11) and the generation of duplications of variable length (1) have also been observed.

It has been suggested that IS186 belongs to the IS4 family of insertion elements (5, 15, 19, 25), but the family as currently defined includes members that generate variable (IS4 and IS186) as well as fixed lengths of target site duplications. The length of the duplications associated with transposition of IS50 (Tn5), which is another member of the IS4 family, is usually 9 bp but rarely could also be 10 bp (6). Finally, IS1 is also known to generate host sequence duplications of various lengths (25) but is not a member of the IS4 family.

Acknowledgments

We thank Mary Berlyn for bacterial strains and acknowledge the assistance of Mehar Sultana and N. Nagesh with oligonucleotide synthesis and DNA sequencing, respectively. We also thank one of the anonymous reviewers for suggesting the analogy between IS186 transposition on the one hand and restriction endonuclease action and antibody gene rearrangement on the other.

J. G. is an honorary faculty member of the Jawaharlal Nehru Centre for Advanced Scientific Research.

REFERENCES

  • 1.Agrawal A, Eastman Q M, Schatz D G. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature. 1998;394:744–751. doi: 10.1038/29457. [DOI] [PubMed] [Google Scholar]
  • 2.Bhandari P, Gowrishankar J. An Escherichia coli host strain useful for efficient overproduction of cloned gene products with NaCl as the inducer. J Bacteriol. 1997;179:4403–4406. doi: 10.1128/jb.179.13.4403-4406.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Birkenbihl R P, Vielmetter W. Completion of the IS map in E. coli: IS186 positions on the E. coli K12 chromosome. Mol Gen Genet. 1991;226:318–320. doi: 10.1007/BF00273620. [DOI] [PubMed] [Google Scholar]
  • 4.Blattner F R, Plunkett III G, Bloch C A, Perna N T, Burland V, Riley M, Collado-Vides J, Glasner J D, Rode C K, Mayhew G F, Gregor J, Davis N W, Kirkpatrick H A, Goeden M A, Rose D J, Mau B, Shao Y. The complete genome sequence of Escherichia coli K-12. Science. 1997;277:1453–1462. doi: 10.1126/science.277.5331.1453. [DOI] [PubMed] [Google Scholar]
  • 5.Chong P, Hui I, Loo T, Gillam S. Structural analysis of a new GC-specific insertion element IS186. FEBS Lett. 1985;192:47–52. doi: 10.1016/0014-5793(85)80040-5. [DOI] [PubMed] [Google Scholar]
  • 6.Chu C C, Clark A J. A 10- rather than 9-bp duplication associated with insertion of Tn5 in Escherichia coli K-12. Plasmid. 1989;22:260–264. doi: 10.1016/0147-619x(89)90010-3. [DOI] [PubMed] [Google Scholar]
  • 7.Craig N L. Transposition. In: Neidhardt F C, Curtiss III R, Ingraham J L, Lin E C C, Low K B, Magasanik B, Reznikoff W S, Riley M, Schaechter M, Umbarger H E, editors. Escherichia coli and Salmonella: cellular and molecular biology. 2nd ed. Washington, D.C.: American Society for Microbiology; 1996. pp. 2339–2362. [Google Scholar]
  • 8.Deonier R C. Native insertion sequence elements: locations, distributions, and sequence relationships. In: Neidhardt F C, Curtiss III R, Ingraham J L, Lin E C C, Low K B, Magasanik B, Reznikoff W S, Riley M, Schaechter M, Umbarger H E, editors. Escherichia coli and Salmonella: cellular and molecular biology. 2nd ed. Washington, D.C.: American Society for Microbiology; 1996. pp. 2000–2011. [Google Scholar]
  • 9.Donch J, Greenberg J. Ultraviolet sensitivity gene of Escherichia coli B. J Bacteriol. 1968;95:1555–1559. doi: 10.1128/jb.95.5.1555-1559.1968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han C-G, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 2001;8(Suppl.):47–52. doi: 10.1093/dnares/8.1.11. [DOI] [PubMed] [Google Scholar]
  • 11.Hiom K, Melek M, Gellert M. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell. 1998;94:463–470. doi: 10.1016/s0092-8674(00)81587-1. [DOI] [PubMed] [Google Scholar]
  • 12.Howard-Flanders P, Simson E, Theriot L. A locus that controls filament formation and sensitivity to radiation in Escherichia coli K-12. Genetics. 1964;49:237–246. doi: 10.1093/genetics/49.2.237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ignatov K B, Chistyakova L G. Integration of the insertion element IS186 into the −10 region of the heat shock promoter of the Escherichia coli lon gene. Bioorg Khim. 1997;23:18–20. . (In Russian.) [PubMed] [Google Scholar]
  • 14.Kelner A, Bellamy W D, Stapleton G E, Zelle M R. Symposium on radiation effects on cells and bacteria. Bacteriol Rev. 1955;19:22–44. doi: 10.1128/br.19.1.22-44.1955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kothary R K, Jones D, Candido E P M. IS186: an Escherichia coli insertion element isolated from a cDNA library. J Bacteriol. 1985;164:957–959. doi: 10.1128/jb.164.2.957-959.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Pedersen K, Gerdes K. Multiple hok genes on the chromosome of Escherichia coli. Mol Microbiol. 1999;32:1090–1102. doi: 10.1046/j.1365-2958.1999.01431.x. [DOI] [PubMed] [Google Scholar]
  • 17.Perna N T, Plunkett III G, Burland V, Mau B, Glasner J D, Rose D J, Mayhew G F, Evans P S, Gregor J, Kirkpatrick H A, Posfai G, Hackett J, Klink S, Boutin A, Shao Y, Miller L, Grotbeck E J, Davis N W, Lim A, Dimalanta E T, Potamousis K D, Apodaca J, Anantharaman T S, Lin J, Yen G, Schwartz D C, Welch R A, Blattner F R. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature. 2001;409:529–533. doi: 10.1038/35054089. [DOI] [PubMed] [Google Scholar]
  • 18.Redaschi N, Bickle T A. DNA restriction and modification systems. In: Neidhardt F C, Curtiss III R, Ingraham J L, Lin E C C, Low K B, Magasanik B, Reznikoff W S, Riley M, Schaechter M, Umbarger H E, editors. Escherichia coli and Salmonella: cellular and molecular biology. 2nd ed. Washington, D.C.: American Society for Microbiology; 1996. pp. 773–781. [Google Scholar]
  • 19.Rezsöhazy R, Hallet B, Delcour J, Mahillon J. The IS4 family of insertion sequences: evidence for a conserved transposase motif. Mol Microbiol. 1993;9:1283–1295. doi: 10.1111/j.1365-2958.1993.tb01258.x. [DOI] [PubMed] [Google Scholar]
  • 20.Rudd K E. Linkage map of Escherichia coli K-12, edition 10: the physical map. Microbiol Mol Biol Rev. 1998;62:985–1019. doi: 10.1128/mmbr.62.3.985-1019.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.SaiSree L, Reddy M, Gowrishankar J. lon incompatibility associated with mutations causing SOS induction: null uvrD alleles induce an SOS response in Escherichia coli. J Bacteriol. 2000;182:3151–3157. doi: 10.1128/jb.182.11.3151-3157.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory; 1989. [Google Scholar]
  • 23.Sengstag C, Iida S, Hiestand-Nauer R, Arber W. Terminal inverted repeats of prokaryotic transposable element IS186 which can generate duplications of variable length at an identical target sequence. Gene. 1986;49:153–156. doi: 10.1016/0378-1119(86)90395-1. [DOI] [PubMed] [Google Scholar]
  • 24.Studier F W, Moffatt B A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol. 1986;189:113–130. doi: 10.1016/0022-2836(86)90385-2. [DOI] [PubMed] [Google Scholar]
  • 25.Syvanen M. Bacterial insertion sequences. In: Kucherlapati R, Smith G R, editors. Genetic recombination. Washington, D.C.: American Society for Microbiology; 1988. pp. 331–356. [Google Scholar]
  • 26.Witkin E M. Inherited differences in sensitivity to radiation in Escherichia coli. Proc Natl Acad Sci USA. 1946;32:59–68. doi: 10.1073/pnas.32.3.59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Witkin E M. Genetics of resistance to radiation in Escherichia coli. Genetics. 1947;32:221–248. doi: 10.1093/genetics/32.3.221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Young R A, Davis R W. Efficient isolation of genes by using antibody probes. Proc Natl Acad Sci USA. 1983;80:1194–1198. doi: 10.1073/pnas.80.5.1194. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES