Abstract
Porcine reproductive and respiratory syndrome (PRRS) is an important economical disease in the global swine industry. The accurate detection of the PRRS virus (PRRSV) antigen is essential for the disease control and prevention programme. In this study, an indirect enzyme-linked immunosorbent test (PRRSVCD163-iELISA) was developed for the detection of the PRRSV antigen in samples of post-mortem swine tissue using the recombinant pig CD163 receptor protein as the capture ligand. The test was found to be specific for PRRSV, with no cross-reactions with other prevalent pig viral pathogens. The assay was validated by testing 217 post-mortem porcine tissue samples and the results were found to be satisfactory with a relative accuracy of 88.88%. Our assay is also quite precise, with intra- and inter-assay CVs of 6% and 10%, respectively. These findings imply that the PRRSVCD163-iELISA developed is capable of detecting the PRRSV antigen in swine post-mortem tissue samples. This research showed that porcine CD163, the PRRSV cellular receptor, can be exploited to build a diagnostic technique for the detection of PRRSV antigen.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13205-022-03376-z.
Keywords: Porcine CD163, PRRSV, iELISA, Antigen, Post-mortem tissue samples
Introduction
Porcine reproductive and respiratory syndrome (PRRS) is one of the most important viral diseases afflicting the swine industry globally (Holtkamp et al. 2013; Neumann et al. 2005). Clinical symptoms of the disease include reproductive failure in breeding animals (gilts, sows, and boars) and respiratory illness in weaner, grower, and finisher pigs with a high mortality rate. Abortions, early farrowing, perinatal deaths, or the delivery of weak and congenitally infected piglets are the consequences of pre-weaning mortality brought on by the infection at late gestation (Singh et al. 2022). Porcine Reproductive and Respiratory Syndrome virus (PRRSV) is a 50–65 nm enveloped positive sense single-strand RNA virus that belongs to the Arteriviridae family, genus Arterivirus, and order Nidovirales (Dokland 2010). Clinical outbreaks of PRRS were first recorded in the late 1980s in the United States and in November 1990 in Germany (OIE 1992). In 1991 and 1992, the PRRS virus (PRRSV, type 1 [European] and type 2 [North American]) were isolated and demonstrated to induce disease and trigger the development of antibodies against the virus in injected animals, respectively (Collins et al. 1992; Terpstra et al. 1991; Wensvoort et al. 1991). Highly pathogenic porcine reproductive and respiratory disease (HP-PRRS) first appeared in Southern China in 2006, which was characterized by high fever (40–42 °C), severe morbidity (50–100%), and mortality (20–100%) in pigs of all ages (An et al. 2010). The first PRRS epidemic in India occurred in 2013 among the pig population of Mizoram state, India, and the virus was confirmed to have a close link with the Chinese-origin highly pathogenic version of PRRSV (HP-PRRSV) (Rajkhowa et al. 2016).
The PRRS disease in pigs has significant economic implications, necessitating the urgent need for an affordable, sensitive, and specific diagnostic. The availability of locally created diagnostic tests for large-scale screening in India is quite limited, and imported diagnostic tests are extremely costly (Kashyap et al. 2020). Viral isolation is the gold standard technique for detecting PRRSV (Leland and Ginocchio 2007); however, it takes a long time and requires sophisticated cell culture facilities. Other diagnostic methods for PRRSV detection include conventional and real-time reverse transcription PCR, serological methods, such as ELISA, Western blot, indirect immune-fluorescence assay, and immune-peroxidase monolayer assay (Christopher-Hennings et al. 1995; Gerber et al. 2013; Weesendorp et al. 2013; Kashyap et al. 2020). The PCR-based methods may not be appropriate for population surveys because they require specialized equipment, skilled labour, and are relatively expensive, despite having high sensitivity and being the method of choice for the rapid detection of viruses during outbreak situations. Methods, such as Western blotting, fluorescence-based methods, and immune-peroxidase methods, have limited use and are not very common methods for the detection of PRRSV. Moreover, serological tests have a drawback of being unsuitable for early detection of disease as antibody specific for PRRSV are produced after 7 days post-infection, but still this kind of screening is the most effective and efficient method to test the disease status in unvaccinated populations (Kashyap et al. 2020).
The role of host receptor in serodiagnostics of PRRSV is largely unexplored. The three cellular factors known as PRRSV entry sites are heparan sulphate (Jusa et al. 1997), CD163 (Crocker and Gordon 1986), and CD169 (Van Breedam et al. 2010). CD163 belongs to the scavenger receptor cysteine-rich (SRCR) family of macrophage differentiation antigens (Van Gorp et al. 2010). Defective CD163 in pigs has been shown to be highly resistant to PRRSV infection, demonstrating that CD163 is the virus's most critical receptor. In vivo studies with CD163 gene edited pigs (CD163-null pigs, CD163 domain swapping pigs, and CD163 SRCR5 deletion pigs) confirmed that CD163 is required for PRRSV infection as the primary receptor protein (Whitworth et al. 2016; Burkard et al. 2018; Chen et al. 2019; Huang et al. 2020). Based on this information, porcine CD163 protein could be used as an antigen capture ligand to create a better immunoassay for PRRSV detection. The objective of the present study was to express porcine CD163 receptor and development of an indirect ELISA (PRRSVCD163-iELISA) based on the expressed porcine CD163 to detect the PRRSV antigen.
Materials and methods
Preparation of post-mortem tissue triturate and positive control
Post-mortem tissue samples (lung, lymph nodes, and tonsils) were collected from sick pigs infected with PRRSV across Assam, India. All samples were collected in accordance with the institutional animal ethical regulations (NRCP/CPCSEA/1658/IAEC-59). Infected tissue samples were subjected for routine screening of different viral pathogens, viz., PRRSV, Classical Swine Fever virus (CSFV), Japanese Encephalitis Virus (JEV), Porcine Circovirus type 2 (PCV2), and Porcine Parvovirus (PPV), using OIE recommended as well as in house-built primers (data not shown here). A 10% triturated suspension of each tissue samples were homogenized followed by centrifugation for 10 min at 600×g, and the supernatant fluid was used as known/unknown test samples. Laboratory available cell culture-adapted purified HP-PRRSV viral suspension (TCID50/0.1 ml) (data not shown here) were used as positive control.
In silico analysis to identify the PRRSV docking site at porcine CD163 receptor gene
Data retrieval
CD163 protein sequences of porcine (HM991330), bovine (ACS87934), canine (AAY99765), fish (NP_955837), gallus (NP_001305912), and human (CAB45233) species were retrieved from NCBI. Similarly, GP2a (AJG42833) and GP4 (AJG42836) protein sequences of Indian isolate PRRSV were also derived from NCBI. All the retrieved sequences were utilized for in silico analysis to identify the PRRSV docking sites at porcine CD163 receptor gene.
Homology modelling
CD163 proteins of the different host species and GP2a/GP4 protein of PRRSV were modelled by homology modelling approach using Discovery Studio 4.1. Based on homology (> 40% sequence similarity), template proteins were identified using BLASTp against Protein Data Bank (PDB). 3D structural models (top five) of the said proteins were selected based on their associated energies and further the best models were selected based on Ramachandran plot in each case. Stereochemical quality of the models were further validated using ERRAT (Colovos and Yeates 1993), PDBSUM (Laskowski 2009), and Verify3D (Lüthy et al. 1992). Validated models for CD163 proteins from each case were used for the binding studies with their targeted substrates.
Docking and interaction of PRRSV GP2a/GP4 and CD163
Active sites of the validated CD163 proteins of different species were predicted using ZDOCK (Pierce et al. 2014) and further docked with PRRSV GP2a/GP4 protein to ease the flexible docking. Based on scores, the best docked complex was selected and the obtained interactions were analysed for viral host tropism, visualized using Discovery Studio 4.1. Further, using molecular dynamic simulations the stability of the docked complex was explored. Docked complexes were subjected to Optimized Potential for Liquid Simulations (OPLS) force field and placed on the center of the dodecahedron water box of SPC216 water model. To avoid the steric hindrance as well as high energy interactions, the system was subjected for initial energy minimization by steepest descent minimization for 50,000 steps until 10 kj/mol tolerance was achieved (Singh et al. 2019). Genion program of GROMACS (Abraham et al. 2015) was used to convert the whole system neutral and the energy-minimized structures were uncovered to position restrained dynamics for 15 ns. Further, the optimized system was subjected to MD run for 15 ns at 300 K and 1 atmospheric pressure. The root mean-square deviation (RMSD) was calculated using the integrated functions of GROMACS (Pronk et al. 2013).
Experimental validation of PRRSV tropism site at CD163 receptor among different Pig breeds
Whole blood samples were randomly obtained from adult sows kept at institutional pig farms that were either indigenous (Doom, n = 10; Mali, n = 10; Ghungroo, n = 10; and Niang Megha, n = 10) or exotic (White York Shire, n = 10). Genomic DNA was extracted from the collected samples by using phenol chloroform extraction method (Sambrook et al. 1989). A set of primers (Forward 5´ CTGCTCAGCCCACAGGAAAC 3´ and Reverse 5´ GCCATTCACCAAGCGGATTT3´) were designed to amplify the exonic region of CD163 having docked site for PRRSV interaction. Specificity of the primers were checked by ‘BLAST’ program. PCR reaction was carried out in a 25 µl reaction containing 100 ng of cDNA, 0.5 µM of each oligonucleotide primer, 1X PCR buffer (Sigma-Aldrich, USA), 1.5 mM MgCl2 (Sigma-Aldrich, USA), 200 µM dNTPs (Sigma-Aldrich, USA), and 1U Taq DNA Polymerase (Sigma-Aldrich, USA). Cycling conditions were kept as 94 °C for 4 min, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, and final extension at 72 °C for 10 min. Amplified products were gel purified and sequenced.
Cloning of porcine CD163 receptor in prokaryotic expression vector
The segment (2426 bp) of the porcine CD163 receptor gene (Accession number HM991330) encoding the PRRSV interacting domains was custom synthesized (GenScript inc., USA) and successfully cloned into the pET30a expression vector using Nde-I and Hind-III restriction enzymes in fusion with the 6 × his-tag at the C terminal region. The recombinant protein has a molecular weight of 86.978 kDa. The clone's orientation was determined using double digestion followed by Sanger sequencing. The recombinant plasmid was then used to transform in competent E. coli BL21 (DE3) cells, and the transformed cells were cultured at 37 °C at 200 rpm in Luria–Bertani (LB) medium plate containing 50 µg/ml of kanamycin. A single colony of freshly transformed E. coli with the constructed plasmid was cultured in 3 ml of LB liquid medium containing 50 µl/ml of kanamycin and incubated at 37 °C until the optical density (OD) at 600 nm reached 0.6–0.8. 1 or 0.5 mM isopropyl-β-d-thiogalactopyranoside (IPTG) was induced in the culture either at 37 °C for 4 h or 15 °C for 16 h. The fusion protein was then analysed using SDS-PAGE and purified using Ni–NTA affinity chromatography. The total amount of protein was determined using the BCA protein assay (Thermo Fisher Scientific, USA).
SDS PAGE and Western blotting
SDS-PAGE and Western blotting were used to determine the molecular weight of the recombinant porcine CD163 protein. Briefly, the recombinant protein was subjected to SDS-PAGE with a 12% resolving gel and a 5% stacking gel. The protein was then transferred to a polyvinylidene difluoride (PVDF) membrane and blocked in blocking buffer for 2–3 h at room temperature. The membrane was washed five times with Tris-buffered saline containing Tween-20 (TBST). The mouse anti-his monoclonal antibody (Thermofisher, USA) or PRRSV-specific porcine polyclonal sera was then added in a 1:1000 dilution and incubated at room temperature for 1 h. Following that, the membrane was washed and incubated for 1–2 h at room temperature with horseradish peroxidase (HRP)-labelled goat anti-mouse or anti-pig IgG (Thermofisher, USA) in 1:10,000 dilution. The membrane was then washed and coloured with an Immobilon western chemiluminescent HRP substrate (Merck, USA).
Optimization of coating and blocking buffer as well as recombinant CD163 protein
PRRSV laboratory isolates were used as a positive control and while Tris-buffered saline (TBS) was used as a negative control to optimize the PRRSVCD163-iELISA. Different ELISA recipes, like concentrations of recombinant protein, coating buffer, and blocking buffer, were chosen and optimized. Two types of coating buffer (Prajapati et al. 2020), namely, TBScm (0.85% saline with 0.02 M Tris, 0.002 M CaCl2, and 0.001 M MgCl2, pH value 7.6) and sodium bicarbonate/carbonate salts with pH 9.6, were used for the dilution of the recombinant CD163 protein and coated overnight at 4 °C to select the appropriate coating buffer. The following day, ELISA was performed, and the P/N value was computed to interpret the results. Different blocking buffers (Prajapati et al. 2020), such as 5% skimmed milk powder and 1% casein in TBScm, were used and chosen based on the P/N value to reduce background interference and improve the signal-to-noise ratio. Likewise, the recombinant CD163 protein was diluted twice and its working concentration was optimized.
PRRSVCD163-indirect ELISA (PRRSVCD163-iELISA)
Coating of microtiter ELISA wells with purified recombinant CD163 protein at pre-optimized concentrations was followed by an overnight incubation at 4 °C. The wells were washed four times with PBS containing 0.05% Tween-20 (PBST) the next day with gentle shaking. The plates were blocked for 1 h at 37 °C with a pre-optimized blocking buffer, consisting of 1% casein in TBScm and washed four times with PBST. For checkerboard titration, PRRSV-positive and PRRSV-negative control samples were diluted in TBScm buffer to the appropriate concentration. The plates were incubated at 37 °C for 1 h before being washed four times. Following that, 50 µl of PRRSV-positive antisera was added at a pre-optimized dilution and incubated at 37 °C for 1 h. Using goat anti-porcine IgG-horseradish peroxidase conjugate (Sigma-Aldrich, USA), the antigen/antibody complex was then identified. Finally, a stop solution was added after the substrate was added. In an ELISA reader machine, the absorbance values were measured at 490 nm. The ratio of the OD values of the test samples and the negative control (S/N) was used to express the results. The ratio was expressed in P/N for the positive control.
Specificity of the assay
Antigen cross-reactivity was used to evaluate the antigen specificity of PRRSVCD163-iELISA. Supernatant from different tissue triturate positive for porcine viral pathogens, viz., CSF, JEV, PCV, and PPV, were used in the antigen cross-reactivity test. Each positive sample was tested three times, and PRRSV-positive and -negative samples served as controls.
Inter- and intra-assay coefficient of variation
Following the indirect ELISA, the inter- and intra-assay coefficient of variation was determined for different pre-optimized PRRSVCD163 concentrations. For this purpose, we took five samples with different antigen concentrations and estimated the level in different wells of same plate and in different plates.
Validation of the assay
A total 217 number of porcine post-mortem tissue samples collected during disease outbreaks from different parts of the North-Eastern region of India was subjected for validation of the assay. Until the time of processing, the samples were kept at − 80 °C. To remove any blood particles, tissue samples were cut into small pea-size pieces and rinsed in PBS (pH 7.6). Tissues were cut into small pieces using sterile scissors, and PBS was added to the fine samples to make a 10% tissue suspension, which was then incubated overnight at 4 °C. The tissue samples were tested for PRRSV infection using the developed iELISA and OIE recommended conventional RT-PCR-based assay (Wernike et al. 2012) using the synthesized primers, viz., forward: ATGGCCAGCCAGTCAATCA and reverse: TCGCCCTAATTGAATAGGTGACT.
Results and discussion
Assessment of serostatus of swine herds’ for the presence of PRRSV is crucial for disease monitoring and surveillance in majority of pigs producing countries. Since ELISA is simple to use and can be used for large-scale screening, it has been the most popular method for detecting PRRSV, as opposed to other serologic tests, which have the costly and time-consuming drawback of requiring PRRSV to be propagated in cell culture. Recombinant CD163 protein, a well-known PRRSV receptor, was used in the current study as a capture ligand for the development of an indirect ELISA (PRRSVCD163-iELISA) for the detection of PRRSV antigen.
The viral envelope consists of the structural proteins GP2a, GP3, GP4, and GP5, which are N glycosylated (de Lima et al. 2009). Along with GP2a, GP4 protein functions as the viral attachment protein, mediating interactions with CD163 for virus entry into receptive host cells (Das et al. 2010). The structure of CD163 was modelled by ab initio modelling using I-TASSER tool as structural template homologue is not available in structure database. Ramachandran plot is showing 97% residues in allowed region (Fig. 1-I). The virus–host tropism is studied through protein–protein interaction (PPI) between CD163 and PRRSV GP2–GP4 protein (Fig. 1-II). The GP2 glycoprotein of virus was well accommodated and interacted with the CD163 protein (Fig. 1-III). The key amino acid residues of Sus scrofa CD163, viz., Arg 478, Asp 503, Lys 476, Trp 498, Cys 591, and His 610, were found to participate in binding with different amino acid residues of GP2 protein, namely Asp 299, Lys 102, Tyr 183, Glu 109, Val 46, and Ser 41. The Sus scrofa CD163 motifs, namely, 21SAHLS25, 355NHNEDA360, 476KPRLV480, 487SGRVEVQHGDTWGTVCD503, and545QCEGHES551, are found to interact with GP2–GP4 dimer. It was illustrated that, two motifs, namely, 21SAHLS25 and 355NHNEDA360 of Sus scrofa CD163 interact with GP4 motifs, viz., 55HGDSSSPTIRK64 and 91LHSSD95, while other three motifs (476KPRLV480, 487SGRVEVQHGDTWGTVCD503, and 545QCEGHES551) of CD163 interacting with GP2 motifs, namely, 1MQWG4, 41SQSPV45, 98LWHHKVSTLIDE109, and 113RRMYRIME120. Only GP4 mediates the interaction in Sus scrofa, generating a bridge-like structure between CD163 and GP2, whereas GP4 is not engaged in interaction in other species (Fig. 1-IV). However, in Bos taurus, GP2 shows only modest interactions with CD163, and the GP4–GP2 dimer is not involved in interactions at all. Multiple sequence alignment of CD163 protein in Sus scrofa, Bos taurus, canis, gallus, fish, and Homo sapiens reveals that exon 7 is not conserved and that amino acid diversity exists (Fig. 2). The interaction site at exon 7 of porcine CD163 was identified using flanking primer sequences in different indigenous and exotic pig breed of India (data not shown here). Readers can refer to the gene bank accession numbers MW558365-69 that we submitted to NCBI. In vivo deletion of the CD163 gene utilizing gene editing methods revealed that CD163 is primarily necessary for PRRSV-2 infection as well as highly pathogenic PRRSV-2 (HP-PRRSV) infection (Whitworth et al. 2016; Yang et al. 2018). CD163 has been demonstrated to express at a greater level on the surface of macrophage cells (Shi et al. 2015) and to operate as a "fusion receptor" for PRRSV, with the scavenger receptor cysteine-rich domain 5 (SRCR5) region being the viral contact site (Law et al. 1993). The SRC5 encoded by exon 7 of porcine CD163 is reported to be essential for PRRSV entry in host cells (Whitworth et al. 2016; Burkard et al. 2018). Based on multiple sequence alignments, it was observed that exon 7 region of porcine CD163 receptor is almost conserved among different swine breeds.
Fig. 1.
I Homology modelling of Sus scrofa CD163 receptor protein with the Ramachandran plot depicting the residues in an allowed region. II Interaction of PRRSV GP2–GP4 dimer with Sus scrofa CD163 at 7th exonic region. CD163 protein-PRRSV complex front view backside view. III Interaction between GP2–GP4 dimer and CD163 protein of Sus scrofa. Interaction between CD163 and GP2 protein of GP2–GP4 dimer. Interaction between CD163 and GP4 protein of GP2–GP4 dimer of PRRSV. Green colour: CD163; Purple colour: Protein domain encoded by exon 7 of CD163; Red colour: GP2 protein; Grey colour: GP4 protein. IV Docking of CD163 protein of different species with PRRSV GP2–GP4 complex. Green colour: CD163; Red colour GP2; Grey colour: GP4
Fig. 2.
Multiple sequence alignment of CD163 protein in different species
Porcine CD163 CDS encoding the PRRSV genes interactome domain along with purification tag (6 × histidine residues) was successfully synthesized (Fig S1). SDS-PAGE analysis revealed that inducing the recombinant protein with 0.5 mM IPTG for 16 h at 15 °C can illustrate better visualization of the expressed protein with predetermined molecular weight (Fig. 3-I) having the yield of 20 mg/ml with < 1% solubility. Western blotting with anti-his antibodies confirmed the reactivity of the purified recombinant porcine CD163 protein (Fig. 3-II).
Fig. 3.

I SDS-PAGE analysis of recombinant porcine CD163 receptor protein expressed in pET-30a (+) expression vector. Lane M: Protein marker; Lane 1: BSA (1 μg); Lane 2: BSA (2 μg); Lane 3: Cell lysate without induction; Lane 4: Cell lysate with induction for 16 h at 15 °C; Lane 5: Cell lysate with induction for 4 h at 37 °C; Lane 6: Supernatant of cell lysate without induction; Lane 7: Supernatant of cell lysate with induction for 16 h at 15 °C; Lane 8: Supernatant of cell lysate with induction for 4 h at 37 °C; Lane 9: Pellet of cell lysate without induction; Lane 10: Pellet of cell lysate with induction for 16 h at 15 °C; Lane 11: Pellet of cell lysate with induction for 4 h at 37 °C. II Western blotting analysis to detect reactivity of anti-his antibody (Lane 1 & 2) with the CD163-his tag fusion protein. Lane-M: pre-stained molecular weight marker
The TBScm coating buffer with a pH of 7.6 was chosen as the coating buffer for the developed ELISA since it has the highest P/N value when compared to the sodium bicarbonate/carbonate buffer (Fig. 4A). Similarly, when different blocking buffers were compared, 1% casein in the TBScm buffer produced the least non-specific binding for antigen detection ELISA (Fig. 4B). The highest dilution at which the maximum difference in OD between positive and negative controls was produced was 0.6 ng/well, according to the optimum working concentration of rCD163 (data not shown). Coating and blocking buffers were optimized so as to minimize the non-specific binding and the concentration of coating receptor was optimized at 0.6 ng/well which is very low as compared to the amount of antigen to be coated in other studies (Chu et al. 2009; Chen et al. 2013) reflecting the good affinity of our recombinant protein with the host receptor as compared to the antigen–antibody interaction in those assays.
Fig. 4.
The parameters of the CD163 PRRSV-iELISA were optimized. A Coating buffer optimization. The P/N values of different concentrations of recombinant CD163 protein coated in TBScm coating buffer with a pH of 7.6 and sodium carbonate/bicarbonate salts with a pH of 9.6 were compared. B Blocking buffer optimization; 1% casein and 5% skimmed milk powder (SMP) were used. *,**Different superscripts differ significantly at p < 0.05
The estimated cut-off value was 0.26, which was calculated as the ratio of the mean OD value of the samples to the mean OD value of the negative control (S/N). Serial dilutions of known positive PRRSV isolates were tested in replicates to test the sensitivity of the CD163-PRRSV-iELISA. Cross-detection of other porcine viruses, such as CSF, PCV, PPV, and JEV, was used to test the assay's specificity. There was no cross-reaction, indicating that the assay was PRRSV specific (Fig. 5-I). The estimated cut-off was obtained at 0.26 which could be a factor responsible for the detection of certain false-negative cases as observed in our study. This in turn could have decreased the sensitivity of our assay to some extent.
Fig. 5.

I CD163PRRSV-iELISA antigenic cross-reactivity analysis. Triturated supernatant from post-mortem porcine tissue samples (positive for PRRSV, CSF, PCV, PPV, and JEV as well as negative for PRRSV) was used to test the developed iELISA. Except for PRRSV-positive samples, all had S/N values below the cut-off value of 0.26. (I Determination of intra- and inter-assay CV of CD163PRRSV-iELISA. The intra-assay CV was found to be < 6% and inter-assay CV < 10% (indicated by doted lines)
The sensitivity of the assay was 88.88% when PCR-based assay was used as gold standard test. Although RT-PCR method has high sensitivity and specificity, it would be better to use viral isolation or viral neutralization to select the positive reference and viral neutralization for negative reference selection. But these methods demand complex viral culture facility, so, we could not use these methods and used RT-PCR as gold standard test of choice. Although sensitivity of our assay was low, but it was higher when compared to a locally developed assays based on the recombinant nucleocapsid protein of the virus (Kashyap et al. 2020). Nevertheless, the sensitivity of our test needs to be improved further. Additionally, since our assay does not cross-react with tissue samples infected with other viruses, it was found to be highly specific for PRRSV detection. A total of 217 post-mortem porcine tissue samples (lung, lymph nodes, and tonsils) were tested simultaneously by CD163PRRSV-iELISA and PCR for PRRSV detection in clinical samples collected from North Eastern region of India. Out of 217 samples, confirmed PRRSV-positive samples were 27 numbers. Using the developed iELISA, 24 samples (in replicates) were found to be PRRSV positive (cut-off value > 0.26), whereas all the 27 samples were PRRSV positive using the PCR-based assay. Our assay is very unique in using the recombinant host cell receptor as coating agent. The positive post-mortem samples which would be certainly having the PRRSV will bind specifically to the CD163 through GP2 and GP4 proteins and which could be further detected by PRRSV-specific antibody followed by substrate-labelled antibody. As it involves the specific host–virus interaction, this strategy ensures high sensitivity and specificity of the assay which is also reflected in the practical data showing 88.88% sensitivity and high specificity. The CV was computed for five samples with varying CD163-PRRSV levels, which included both low and high values. The intra-assay CVs were 3.84%, 4.48%, 4.23%, 4.39%, and 5.73%, with an overall value of 6%. The CV between tests was 6.68%, 8.80%, 5.12%, 7.55%, and 9.48%, with a total of 10% (Fig. 5-II).
Our assay is a unique type of iELISA which depend on a very specific interaction between the viral proteins, Gp2/4 with their receptor present in the host, CD163. The stereochemistry of the interaction was confirmed by in silico analysis. The assay was compatible with the post-mortem samples of various porcine tissues used in this study as evident from the validation experiment. Hence, RT-PCR is gold standard for the detection, but designing of primer for RT-PCR requires high technical skill as genetic difference between the PRRSV strain and the primers used for the PCR can greatly affect the result. For example, some primers detect the variant I but not the variant II and vice versa. Thus, good technical skills and laboratory practices are needed for reliability of RT-PCR. Furthermore, sensitivity and specificity of RT-PCR depend on several factors, such as RNA extraction method, primers, cycle optimization, and technician training (Christopher-Hennings et al. 2002).
To the best of our knowledge, this is a first study to identify PRRSV antigen using a highly specific and sensitive detection method which utilizes host protein. The developed PRRSVCD163-iELISA can be used safely in both endemic and non-endemic nations, and is especially useful when the disease is experiencing a large-scale outbreak and all samples can be tested simultaneously without any concerns. By assisting in the serological diagnosis of PRRS in resource-limited settings, developed assay is anticipated to facilitate the early deployment of control measures, like quarantine, vaccination, and possibly stamping out.
Supplementary Information
Below is the link to the electronic supplementary material.
Figure S1: Synthesized amino acid sequence of porcine CD163 receptor protein. Sequences under the rectangular boxes are the peptides interacting with PRRSV
Acknowledgements
The authors are thankful to the Director, ICAR-National Research Center on Pig, Guwahati, Assam, India for providing necessary facilities to conduct the research works. The authors also express sincere thanks to Indian Council of Agricultural Research, New Delhi, India for providing financial assistant for developing the diagnostic assay.
Author contributions
RD contributed to concept generated and manuscript drafted; AKD, GS, JS, LD, and SRP performed Laboratory experiments; IS and NL collected sample; SK, SP, and PJD were involved in in silico studies; PP, SR, and SP performed ELISA data analysis; VKG contributed to manuscript revision and overall assesment of the research works.
Declarations
Conflict of interest
The authors declare that there is no conflict of interest associated with this study.
Ethical approval
Experiment of the present study was approved by the Institutional animal ethical committee vide the approval number NRCP/CPCSEA/1658/IAEC-70.
Contributor Information
Rajib Deb, Email: drrajibdeb@gmail.com.
Vivek Kumar Gupta, Email: gupta.drvivek@gmail.com.
References
- Abraham MJ, Murtola T, Schulz R, Páll S, Smith JC, Hess B, Lindahl E. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX. 2015;1:19–25. doi: 10.1016/j.softx.2015.06.001. [DOI] [Google Scholar]
- An TQ, Jian TZ, Xiao Y. Origin of highly pathogenic porcine reproductive and respiratory syndrome virus. China. 2010;16(2):365–367. doi: 10.3201/eid1602.090005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burkard C, Opriessnig T, Mileham AJ, Stadejek T, Ait-Ali T, Lillico SG, Archibald AL. Pigs lacking the scavenger receptor cysteine-rich domain 5 of CD163 are resistant to porcine reproductive and respiratory syndrome virus 1 infection. J Virol. 2018;92(16):e00415–e418. doi: 10.1128/JVI.00415-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen C, Fan W, Jia X, Li J, Bi Y, Liu W. Development of a recombinant N-Gp5c fusion protein-based ELISA for detection of antibodies to porcine reproductive and respiratory syndrome virus. J Virol Methods. 2013;189(1):213–220. doi: 10.1016/j.jviromet.2013.02.003. [DOI] [PubMed] [Google Scholar]
- Chen J, Wang H, Bai J, Liu W, Liu X, Yu D, Li N. Generation of pigs resistant to highly pathogenic-porcine reproductive and respiratory syndrome virus through gene editing of CD163. Int J Biol Sci. 2019;15(2):481. doi: 10.7150/ijbs.25862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Christopher-Hennings J, Nelson EA, Nelson JK, Hines RJ, Swenson SL, Hill HT, Zimmerman JJ, Katz JB, Yaeger MJ, Chase CC. Detection of porcine reproductive and respiratory syndrome virus in boar semen by PCR. J Clin Microbiol. 1995;33(7):1730–1734. doi: 10.1128/jcm.33.7.1730-1734.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Christopher-Hennings J, Faaberg KS, Murtaugh MP, Nelson EA, Roof MB, Vaughn EM, Zimmerman JJ. Porcine reproductive and respiratory syndrome (PRRS) diagnostics: Interpretation and limitations. J Swine Health Prod. 2002;10(5):213–218. [Google Scholar]
- Chu JQ, Hu XM, Kim MC, Park CS, Jun MH. Development and validation of a recombinant nucleocapsid protein-based ELISA for detection of the antibody to porcine reproductive and respiratory syndrome virus. J Microbiol. 2009;47(5):582–588. doi: 10.1007/s12275-009-0033-x. [DOI] [PubMed] [Google Scholar]
- Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, Chladek D. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. J Vet Diagn Invest. 1992;4(2):117–126. doi: 10.1177/104063879200400201. [DOI] [PubMed] [Google Scholar]
- Colovos C, Yeates TO. Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci. 1993;2(9):1511–1519. doi: 10.1002/pro.5560020916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crocker PR, Gordon S. Properties and distribution of a lectin-like hemagglutinin differentially expressed by murine stromal tissue macrophages. J Exp Med. 1986;164(6):1862–1875. doi: 10.1084/jem.164.6.1862. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Das PB, Dinh PX, Ansari IH, de Lima M, Osorio FA, Pattnaik AK. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. J Virol. 2010;84(4):1731–1740. doi: 10.1128/JVI.01774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Lima M, Ansari IH, Das PB, Ku BJ, Martinez-Lobo FJ, Pattnaik AK, Osorio FA. GP3 is a structural component of the PRRSV type II (US) virion. Virology. 2009;390(1):31–36. doi: 10.1016/j.virol.2009.04.017. [DOI] [PubMed] [Google Scholar]
- Dokland T. The structural biology of PRRSV. Virus Res. 2010;154(1–2):86–97. doi: 10.1016/j.virusres.2010.07.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gerber PF, O'Neill K, Owolodun O, Wang C, Harmon K, Zhang J, Halbur PG, Zhou L, Meng XJ, Opriessnig T. Comparison of commercial real-time reverse transcription-PCR assays for reliable, early, and rapid detection of heterologous strains of porcine reproductive and respiratory syndrome virus in experimentally infected or noninfected boars by use of different sample types. J Clin Microbiol. 2013;51(2):547–556. doi: 10.1128/JCM.02685-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Holtkamp DJ, Kliebenstein JB, Neumann EJ, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod. 2013;21(2):72–84. [Google Scholar]
- Huang C, Bernard D, Zhu J, et al. Small molecules block the interaction between porcine reproductive and respiratory syndrome virus and CD163 receptor and the infection of pig cells. Virol J. 2020;17:116. doi: 10.1186/s12985-020-01361-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jusa ER, Inaba Y, Kouno M, Hirose O. Effect of heparin on infection of cells by porcine reproductive and respiratory syndrome virus. Am J Vet Res. 1997;58(5):488–491. [PubMed] [Google Scholar]
- Kashyap SP, Hiremath J, Vinutha S, Patil SS, Suresh KP, Roy P, Hemadri D. Development of recombinant nucleocapsid protein-based indirect enzyme-linked immunosorbent assay for sero-survey of porcine reproductive and respiratory syndrome. Vet World. 2020;13(12):2587. doi: 10.14202/vetworld.2020.2587-2595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laskowski RA. PDBsum new things. Nucleic Acids Res. 2009;37(suppl_1):D355–D359. doi: 10.1093/nar/gkn860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Law SA, Micklem KJ, Shaw JM, Zhang XP, Dong Y, Willis AC, Mason DY. A new macrophage differentiation antigen which is a member of the scavenger receptor superfamily. Eur J Immunol. 1993;23(9):2320–2325. doi: 10.1002/eji.1830230940. [DOI] [PubMed] [Google Scholar]
- Leland DS, Ginocchio CC. Role of cell culture for virus detection in the age of technology. Clin Microbiol Rev. 2007;20(1):49–78. doi: 10.1128/CMR.00002-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lüthy R, Bowie JU, Eisenberg D. Assessment of protein models with three-dimensional profiles. Nature. 1992;356(6364):83–85. doi: 10.1038/356083a0. [DOI] [PubMed] [Google Scholar]
- Neumann EJ, Kliebenstein JB, Johnson CD, Mabry JW, Bush EJ, Seitzinger AH, Zimmerman JJ. Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J Am Vet Med Assoc. 2005;227(3):385–392. doi: 10.2460/javma.2005.227.385. [DOI] [PubMed] [Google Scholar]
- OIE (Office International des Épizooties) World Animal Health 1991 (1992) Volume VII. Number 2. Animal Health Status and Disease Control Methods (Part One: Reports) vol. 126
- Pierce BG, Wiehe K, Hwang H, Kim BH, Vreven T, Weng Z. ZDOCK server: interactive docking prediction of protein–protein complexes and symmetric multimers. Bioinformatics. 2014;30(12):1771–1773. doi: 10.1093/bioinformatics/btu097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Prajapati M, Dou Y, Zhu X, Zhao S, Alfred N, Li Y, Zhang Z. Development of an enzyme-linked immunosorbent assay based on CD150/SLAM for the detection of peste des petits ruminant virus. Front Vet Sci. 2020;7:196. doi: 10.3389/fvets.2020.00196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pronk S, Páll S, Schulz R, Larsson P, Bjelkmar P, Apostolov R, Lindahl E. GROMACS 4.5: a high-throughput and highly parallel open source molecular simulation toolkit. Bioinformatics. 2013;29(7):845–854. doi: 10.1093/bioinformatics/btt055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rajkhowa TK, Jagan Mohanarao G, Gogoi A, Hauhnar L. Indian porcine reproductive and respiratory syndrome virus bears discontinuous deletion of 30 amino acids in nonstructural protein 2. Virusdisease. 2016;27(3):287–293. doi: 10.1007/s13337-016-0341-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sambrook J, Fritsch ER, Maniatis T (1989) Molecular Cloning: A Laboratory Manual (2nd ed.) Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
- Shi C, Liu Y, Ding Y, Zhang Y, Zhang J. PRRSV receptors and their roles in virus infection. Arch Microbiol. 2015;197(4):503–512. doi: 10.1007/s00203-015-1088-1. [DOI] [PubMed] [Google Scholar]
- Singh I, Deb R, Kumar S, Singh R, Andonissamy J, Smita S, Rai A. Deciphering foot-and-mouth disease (FMD) virus–host tropism. J Biomol Struct Dyn. 2019;37(18):4779–4789. doi: 10.1080/07391102.2019.1567386. [DOI] [PubMed] [Google Scholar]
- Singh N, Batra K, Chaudhary D, Punia M, Kumar A, Maan NS, Maan S. Prevalence of porcine viral respiratory diseases in India. Anim Biotechnol. 2022 doi: 10.1080/10495398.2022.2032117. [DOI] [PubMed] [Google Scholar]
- Terpstra C, Wensvoort G, Pol JMA. Experimental reproduction of porcine epidemic abortion and respiratory syndrome (mystery swine disease) by infection with Lelystad vims: Koch's postulates fulfilled. Vet Q. 1991;13(3):131–136. doi: 10.1080/01652176.1991.9694297. [DOI] [PubMed] [Google Scholar]
- Van Breedam W, Delputte PL, Van Gorp H, Misinzo G, Vanderheijden N, Duan X, Nauwynck HJ. Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage. J Gen Virol. 2010;91(7):1659–1667. doi: 10.1099/vir.0.020503-0. [DOI] [PubMed] [Google Scholar]
- Van Gorp H, Delputte PL, Nauwynck HJ. Scavenger receptor CD163, a Jack-of-all-trades and potential target for cell-directed therapy. Mol Immunol. 2010;47(7–8):1650–1660. doi: 10.1016/j.molimm.2010.02.008. [DOI] [PubMed] [Google Scholar]
- Weesendorp E, Morgan S, Stockhofe-Zurwieden N, Popma-De Graaf DJ, Graham SP, Rebel JM. Comparative analysis of immune responses following experimental infection of pigs with European porcine reproductive and respiratory syndrome virus strains of differing virulence. Vet Microbiol. 2013;163(1–2):1–12. doi: 10.1016/j.vetmic.2012.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wensvoort G, Terpstra C, Pol JMA, Ter Laak EA, Bloemraad M, De Kluyver EP, Braamskamp J. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q. 1991;13(3):121–130. doi: 10.1080/01652176.1991.9694296. [DOI] [PubMed] [Google Scholar]
- Wernike K, Bonilauri P, Dauber M, Errington J, LeBlanc N, Revilla-Fernández S, Hoffmann B. Porcine reproductive and respiratory syndrome virus: interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods. J Vet Diagn Invest. 2012;24(5):855–866. doi: 10.1177/1040638712452724. [DOI] [PubMed] [Google Scholar]
- Whitworth KM, Rowland RR, Ewen CL, Trible BR, Kerrigan MA, Cino-Ozuna AG, Prather RS. Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat Biotechnol. 2016;34(1):20–22. doi: 10.1038/nbt.3434. [DOI] [PubMed] [Google Scholar]
- Yang H, Zhang J, Zhang X, Shi J, Pan Y, Zhou R, Wu Z. CD163 knockout pigs are fully resistant to highly pathogenic porcine reproductive and respiratory syndrome virus. Antivir Res. 2018;151:63–70. doi: 10.1016/j.antiviral.2018.01.004. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1: Synthesized amino acid sequence of porcine CD163 receptor protein. Sequences under the rectangular boxes are the peptides interacting with PRRSV




