Abstract
Background
The production of androstenedione (AD) from phytosterols by Mycolicibacterium neoaurum is a multi-step biotransformation process, which requires degradation of sterol side chains, accompanied by the production of propionyl-CoA. However, the transient production of large amounts of propionyl-CoA can accumulate intracellularly to produce toxic effects and severely inhibit AD production.
Results
In the present study, the intracellular propionyl-CoA concentration was effectively reduced and the productivity of the strain was improved by enhancing the cytosolic methyl-branched lipid synthesis pathway and increasing the expression level of nat operator gene, respectively. Subsequently, the application of a pathway combination strategy, combined and the inducible regulation strategy, further improved AD productivity with a maximum AD conversion rate of 96.88%, an increase of 13.93% over the original strain.
Conclusions
Overall, we provide a new strategy for reducing propionyl-CoA stress during biotransformation for the production of AD and other steroidal drugs using phytosterols.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12934-022-01942-x.
Keywords: Mycolicibacterium neoaurum, Androstenone, Propionyl-CoA metabolic, Pathway Associates
Introduction
Androstenedione (AD) is an important steroid intermediate, and almost all steroid drugs such as adrenocorticotropic hormones, sex hormones and anabolic hormones can be produced from AD [1], and more than 100 kinds of related steroid hormone drugs have been synthesized from AD in the market, which has a broad market [2]. Microbial conversion of phytosterols for AD production is an environmentally friendly and low-cost production method to successfully replace the traditional chemical synthesis method [3]. Mycolicibacterium spp. are the main AD-producing genera due to their powerful sterol degradation system [4].
In the process of AD production by Mycolicibacterium neoaurum (MNR) using phytosterols as substrate, the initial oxidation and side-chain degradation will produce a large amount of propionyl-CoA in a short period of time, which makes the strain unable to degrade it rapidly through normal metabolism, thus leading to excessive accumulation of propionyl-CoA in the cell and thus inhibiting the growth of the bacterium [5–7]. Three propionyl-CoA metabolic pathways exist in Mycolicibacterium spp.: the 2-methylcitrate cycle pathway (MCC), the methylmalonyl cycle pathway (MMC) [5], and the cytosolic methyl-branched lipid synthesis pathway [5, 8]. Previous studies succeeded in reducing the intracellular propionyl CoA content by enhancing the first two pathways, ultimately resulting in a 28.4% increase in transformation efficiency compared to the original strain [6, 7].
High concentrations of substrate (phytosterols) and product (AD) during AD production can be toxic to microorganisms [9–11]. In Mycobacterium tuberculosis (MTB), through the cytosolic methyl-branched lipid synthesis pathway, propionyl-CoA /acetyl-CoA carboxylase (ACC) catalyzes the intracellular malonyl-CoA and acetyl-CoA to methylmalonyl-CoA and malonyl-CoA [12, 13]. Later, in the presence of polyketide synthase (PikA1), the two undergo an esterification condensation reaction to produce nabolone, which is an important component in the synthesis of the cytosolic methyl-branched lipid phthiocerol dimycocerates (PDIM) [14, 15]. When MTB infect the host, in order to improve its tolerance in the host, they produce sufficient acetyl-coenzyme A and malonyl coenzyme A by absorbing cholesterol from the host, and later express the ACC family genes at high levels to produce malonyl coenzyme A and methyl malonyl coenzyme A. The two, in the presence of a polyketide synthase complex, generate PDIM, which improves the tolerance of the strain [16]. Therefore, the cytosolic methyl-branched lipid synthesis pathway has the potential to be a potentially effective way to effectively reduce intracellular propionyl-CoA content and enhance the tolerance of the bacterium, however, there are few studies on the use of the cytosolic methyl-branched lipid synthesis pathway for AD production in MNR to date.
In addition to this, another potential propionyl-CoA metabolic pathway emerged in our view. In MTB and Mycolicibacterium smegmatis, there is a nat operon that encodes the Hsa family protein HsaA-D and N-acetyltransferase (NAT) protein that are directly involved in the cholesterol degradation pathway of MTB [17], where NAT uses acyl-coenzyme A to degrade cholesterol catabolic metabolites, such as acetyl-CoA and propionyl-CoA, to enrich the cellular acyl pool for normal life activities such as cell growth [18, 19]. In Mycolicibacterium smegmatis nat operon, expression of the hsaA-D gene activates the transcription factor AraC. Nat gene is regulated by AraC, which recognizes free amino groups on various intracellular arylamine and hydrazine structural scaffolds, and catalyzes the transfer of acetyl groups from acetyl-CoA to the arylamine scaffold, releasing free CoA and re-producing acetyl-CoA, succinyl-CoA, propionyl-CoA and malonyl-coenzyme A, etc. [20]. It has been shown that increasing intracellular coenzyme A levels is effective in improving cell viability and thus the accumulation of target products [21, 22]. However, whether the action of this operon is beneficial for AD production by Mycolicibacterium spp., to our knowledge, has not been reported.
Based on these mechanisms, this study shows for the first time that enhancement of the cytosolic methyl-branched lipid synthesis pathway with the nat operon can improve AD production in Mycolicibacterium (Fig. 1). The changes in cell growth and AD production by AccA1 and AccD1, key genes of the cytosolic methyl-branched lipid synthesis pathway, and nat, the key gene of the nat operon, as well as the transcription factor AraC, were investigated. Meanwhile, to further improve AD production, the two pathways were jointly enhanced to construct a tandem expression strain, and the expression of the key gene AccA1 was regulated by modifying the existing plasmid using the tetracycline operator according to the growth status of the bacteria. The resulting optimal strain achieved a 96.88% AD transformation rate. The multi-pathway combination addressed the toxic effects of propionyl-CoA for efficient AD production.
Fig. 1.
Pathways are used in combination to attenuate propionyl-CoA toxicity in MNR
Results and discussion
Effect of enhanced cytosolic methyl-branched lipid synthesis pathway on biotransformation and strain physiology performances
Construction of cytosolic methyl-branched lipid synthesis pathway enhancing recombinant strains
Previous studies have shown the presence of AccA1 and AccD1 in MTB, and they are key enzymes in the cytosolic methyl-branched lipid synthesis pathway of the MTB [12]. The AccA1 D174_19730 and AccD1 D174_19735 were localized on the MNR VKM Ac-1815D (TAX:700508) genome by bioinformatics methods. Based on the functions of AccA1 and AccD1, their expression in MNR was aimed at enhancing the cytosolic methyl-branched lipid synthesis pathway and reducing the intracellular propionyl-CoA content. The recombinant strains QC M3-A and QC M3-D were successfully constructed according to the method described in 4.2, containing AccA1 and AccD1, respectively.
Influence of AccA1 and AccD1 enhancement on cell growth indicators and conversion indicators
The effects of AccA1 and AccD1 on cell growth were investigated and compared with the parental strains. All strains had typical growth curves, but the recombinant strain QC M3-A was severely affected and its biomass was lower than WT, with QC M3-A being the most severely affected (Fig. 2a). This is due to the over-expression of AccA1 leading to accelerated synthesis of cell membrane methyl branched lipids in the pre-growth phase of the strain, which generates growth stress. Previously reported results may also support this phenomenon in the opposite direction [23, 24]. Although the above recombinant strains showed a decrease in biomass, the highest molar transformation rates of recombinant strains QC M3-A and QC M3-D were increased by 9.7% and 6.3%. Compared to the starting strain, AD accumulation was 3.19 ± 0.09 g/L and 3.08 ± 0.1 g/L under 5 g/L sterol conditions, respectively (Fig. 2b).
Fig. 2.
Recombinant growth status and AD conversion ratio of QC M3-A, QC M3-D. a Growth curves of WT, QC M3-A, and QC M3-D. b Time courses of phytosterol conversion ratio to AD by WT, QC M3-A, and QC M3-D. The folded line corresponds to AD concentration ration (left y-axis) and the bar corresponds to AD concentration (right y-axis). Error bars indicate the standard deviation from three independent experiments
Influence of AccA1 and AccD1 enhancement on substrate tolerance of recombinant strains
In the process of AD production by MNR, AD inhibits the growth and respiratory metabolic activities of the bacterium, and the gradually increasing AD concentration will produce more and more severe stress on the bacterium, which will severely inhibit its ability to convert sterols. To address this phenomenon, it was found that the intensity of AD production could be effectively improved by increasing the tolerance of the strain to AD [25, 26]. The growth of the strain was measured at different AD concentrations (Fig. 3a), and it was found that although the biomass of QC M3-A was lower compared to WT, it was less affected by AD concentration and showed better substrate tolerance compared to WT, which may be due to the overexpression of AccA1, which thickens the cell wall of the recombinant strain (Fig. 3b). The changes in these indicators are one of the reasons for the enhanced biotransformation capacity of QC M3-A.
Fig. 3.
Growth status and cell structure. a Biomass (based on OD) of QC M3-A and WT at 120 h for different AD concentrations. b TEM image of QC M3-A and WT. Error bars indicate the standard deviation from three independent experiments and the levels of statistical significance are indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001; ns, indicates no significant difference (p > 0.05)
Reconstitution of the nat operon to promote intracellular acyl coenzyme A cycling
Construction of a nat operon overexpressing recombinant strain
In order to achieve a high yield of the target product AD, the AD downstream transforming KsdD in the sterol metabolic pathway was knocked out so that the strain would not produce androsta-1,4-diene-3,17-dione (ADD), so the subsequent sterol parent nucleus degradation reaction would stop. In the presence of Hsa family genes, Mycobacterium accomplishes the complete degradation of the sterol parent nucleus. At the same time, the expression of Hsa family genes enhances the expression of the transcriptional regulator AraC [20, 27]. To reconstruct this operon and to investigate the role of AraC and Nat in sterol conversion, recombinant strains QC M3-C and QC M3-N were constructed, respectively. As shown in Fig. 4a, the transcriptional level of AraC in QC M3-C reached 19.64-fold higher than that of WT, and Nat transcription level increased nearly 40-fold. However, Nat did not show an upregulatory effect on AraC in QC M3-N. The regulation of the acyl-coenzyme cycle within the strain by the AraC gene relies mainly on the regulation of the expression of various downstream acyltransferases. The results of comparing the regulatory effect of AraC on Nat in different strains confirmed this conclusion that the expression of AraC does regulate the transcription of Nat, but no negative feedback regulation of intracellular Nat content on AraC was found for the time being.
Fig. 4.
Recombinant strain qRT-PCR analysis, growth status, and AD conversion ratio of WT, QC M3-C and QC M3-N. a qRT-PCR analysis of the expression variations of AraC and Nat. b Growth curves of WT, QC M3-C and QC M3-N. c Time courses of biotransformation ratio of AD by WT, QC M3-C and QC M3-N. The folded line corresponds to AD concentration ration (left y-axis) and the bar corresponds to AD concentration (right y-axis). Error bars indicate the standard deviation from three independent experiments and the levels of statistical significance are indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001; ns, indicates no significant difference (p > 0.05)
Growth indicators and conversion indicators
The effect of nat operon enhancement on cell growth and AD transformation was investigated. It was found that although all strains had the same growth trend, the biomass of the recombinant strains was reduced (Fig. 4b). As shown in Fig. 4c, the AD production capacity of the recombinant strains was higher than that of the starting strains. Both QC M3-C and QC M3-N bio-maximal molar conversion ratios were higher than that of the starting strains, and AD accumulation was up to 3.13 ± 0.02 g/L and 3.08 ± 0.05 g/L. The above results indicated that the overexpression of the nat operon increased the AD production capacity of MNR, with the transcription factor AraC overexpression having the optimal effect.
Effect of different pathways on intracellular propionyl-CoA
The intracellular propionyl-CoA levels of the recombinant strains in both pathways were examined (Fig. 5), and the results showed that the recombinant strains and the starting strains had similar trends of change. Meanwhile, the propionyl CoA content of all recombinant strains was lower than that of WT. Among them, QC M3-C had the lowest intracellular propionyl coenzyme A level, and its intracellular propionyl-CoA level decreased by 38.70% compared with the starting strain at 96 h of fermentation. At the same time, due to the overexpression of AraC, which accelerated the metabolism of intracellular propionyl-CoA and effectively promotes cellular coenzyme A circulation. This result could also well explain the better growth trend and AD productivity of QC M3-C relative to other recombinant strains. Combining the results of AD conversion rates of different strains in Figs. 2 and 4, we can find that all strains except recombinant strain QC M3-D had higher AD conversion rates than WT, although their biomass was lower than WT, which indicates that it is feasible to improve the conversion ability of strains by enhancing cytosolic methyl-branched lipid synthesis pathway and reconstitution of the nat operon.
Fig. 5.

Intracellular propionyl-CoA levels in the biotransformation process of WT, QC M3-A, QC M3-C, QC M3-D and QC M3-N strains. Error bars indicate the standard deviation from three independent experiments
Combined enhancement of propionyl-CoA metabolism to improve transformation performance of strains
Three new recombinant strains were constructed to further enhance the metabolism of propionyl-CoA and to obtain a more productive and rapidly growing strain. Firstly, to address the problem of AccA1 inhibition, the promoter element in the pMV261 plasmid was modified and its expression was regulated using the tetO operator to construct the overexpression strain QC M3-ATetO.
Based on the consideration of the slow growth of the strain, AccA1 was expressed in tandem with AraC to construct the tandem expression strain QC M3-AC. AraC could significantly improve the viability of the strain, and in order to cope with the problem of inhibition of strain growth by AccA1, a strong RBS sequence (aaagaggtgaca) was added before the AraC in the construction of the tandem gene plasmid [28], hoping to use a high level of AraC expression to counteract the growth stress caused by AccA1. In addition, the two schemes were combined to construct a regulated tandem expression strain, so that on the one hand, AraC relies on the hsp60 promoter for constitutive expression, allowing the bacterium to maintain high viability throughout all stages of fermentation, and on the other hand, the AccA1 is expressed in a regulated manner by the administration of an inducer at mid-fermentation, so that the two genes can work together at the highest intracellular propionyl-CoA level at mid-fermentation。
As the data in Fig. 6a show, all three modes of tandem transformation strains, compared to QC M3-A strains can enter the logarithmic growth period quickly; in the late stage of fermentation, the biomass of the tandem strains were significantly increased, and remained basically the same as QC M3-C (Fig. 6b).
Fig. 6.
Recombinant growth status and AD conversion ratio of QC M3-AC, QC M3-Ateto, QC M3-AtetoC. a Growth curves of QC M3-A, QC M3-C, QC M3-AC, QC M3-Ateto, QC M3-AtetoC. b Biomass (based on OD) of QC M3-A, QC M3-C, QC M3-AC, QC M3-Ateto, QC M3-AtetoC at 120 h for different AD concentrations. c Time courses of phytosterol conversion ratio to AD by QC M3-A, QC M3-C, QC M3-AC, QC M3-Ateto, QC M3-AtetoC. d Time courses of AD concentration by QC M3-A, QC M3-C, QC M3-AC, QC M3-Ateto, QC M3-AtetoC. Error bars indicate the standard deviation from three independent experiments and the levels of statistical significance are indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001; ns, indicates no significant difference (p > 0.05)
The tandem gene overexpression strains were constructed to improve the problem of the low AD conversion rate of AccA1 overexpression strains in the pre-fermentation stage (Fig. 6a). As can be seen from Fig. 6c, all three tandem overexpression strains solved this problem well. Moreover, the conversion rate of the strains was improved with the addition of an inducer at 72 h. At 96 h, the AD conversion rate of QC M3-AtetoC had reached 90.70%, which was close to the highest conversion rate of the single gene overexpression strain at 168 h and greatly shortened the conversion cycle. The bacterium showed excellent performance in AD conversion ability, and its highest AD conversion rate reached 96.88% at 168 h, which was 13.93% higher than that of the original bacterium WT, the final AD yield was 3.34 ± 0.02 g/L at a substrate concentration of 5 g/L. Meanwhile, the production rate was 1.3 times that of the original strain (Fig. 6c, Table 1). Compared to our previous work on propionyl-CoA regulation, we obtained similar or even higher production rate [6, 7]. The production efficiency of QC M3-ATetOC was lower than that of MNR-Fpcc-Fndh [6]. Although this phenomenon may be due to the different transformation systems, at the same time we speculate that this phenomenon may be due to the synergistic effect of simultaneous regulation of the two cofactors (NAD+/NADH and propionyl-CoA) in previous studies. Of course, in the subsequent work, we will also try to combine the regulation of multiple cofactors and explore the synergistic effect between cofactors to obtain higher conversion efficiency.
Table 1.
Comparison of the impact of various regulation strategies on AD production
| Strains | Regulation Strategies | Conversion yield (%) | Production rate (g/L/days) |
|---|---|---|---|
| QC M3-A | Overexpression AccA1 | 92.6 | 0.457 |
| QC M3-D | Overexpression AccD1 | 89.2 | 0.44 |
| QC M3-N | Overexpression NAT | 89.3 | 0.441 |
| QC M3-C | Overexpression AraC | 90.7 | 0.447 |
| QC M3-AC | Co-expression AccA1 and AraC | 94.1 | 0.464 |
| QC M3-ATetO | Inducible regulation AccA1 | 95.1 | 0.469 |
| QC M3-ATetOC | Inducible regulation AccA1 and overexpression AraC | 96.9 | 0.655 |
| MNR-prpR [7] | MCC enhancement | 90.6 | 0.628 |
| MNR-prpDBC/ΔglnR [7] | GlnR knockout and MCC enhancement | 94.3 | 0.654 |
| MNR-Fpcc [6] | MMC enhancement | 25.4 | 0.176 |
| MNR-Fpcc-Fndh [6] | Overexpression NDH-II and MCC enhancement | 96.4 | 0.669 |
Conclusion
The aim of this study was to improve the AD production efficiency of the strain. A rational strategy was developed through genetic engineering and dynamic regulation methods. Overexpression of AccA1, AccD1, AraC, and Nat in MNR can reduce the intracellular propionyl-CoA content, while the combination of multiple pathways can better improve the transformation ability of the strain, which is an effective strategy to improve the catalytic performance of the microorganism. For the first time, the inducible regulation strategy by tet operator in MNR was used for biotransformation, which provided a new idea to further improve the AD production efficiency of the strain.
Materials and methods
Strains, plasmids, and culture conditions
All strains and plasmids used in this study are listed in Table 2, E. coli DH5α was used for plasmid construction. Strain MNR was stored in Tianjin University of Science and Technology Culture Collection Center (TCCC), Tianjin, China, and used for constructing engineering strains. E.coli was cultured in an LB medium. The culture method and medium of MNR were performed as previously described [29]. The medium of recombinant Mycolicibacterium strains was supplemented with kanamycin (50 μg/mL). The pMV261 plasmid was modified using primers to construct an expression regulatory plasmid with a double promoter and containing a tet operator [28, 30], named pMV262, and the expression of the target gene was regulated by the addition of tetracycline during fermentation.
Table 2.
Strains, plasmids, and primers used in this study
| Strains, plasmids, and primers | Significant properties | Source or purpose |
|---|---|---|
| Strains | ||
| Escherichia coli DH5α | General cloning host | Transgen Biotech |
| M3 | Wild type Mycolicibacterium neoaurum TCCC 11u978 (MNR) | Tianjin University of Science and Technology Culture Collection Center (TCCC) |
| QC M3 | Deletion of KsdD in Mycolicibacterium neoaurum TCCC 11u978 | Lab of Systematic Microbiology and Biomanufacturing Engineering, Tianjin University of Science and Technology |
| QC M3-N | QC M3 containing plasmid pMV261-Nat | This work |
| QC M3-C | QC M3 containing plasmid pMV261-AraC | This work |
| QC M3-A | QC M3 containing plasmid pMV261-AccA1 | This work |
| QC M3-D | QC M3 containing plasmid pMV261-AccD1 | This work |
| QC M3- AC | QC M3 containing plasmid pMV261-AraC-AccA1 | This work |
| QC M3-ATetO | QC M3 containing plasmid pMV262-AccA1 | This work |
| QC M3-ATetOC | QC M3 containing plasmid pMV262-AccA1-AraC | This work |
| Plasmids | ||
| pMV261 | Shuttle vector, hsp60, Kan R | Dr. W. R. Jacobs Jr |
| pMV262 | Shuttle vector, Tet O, Tet R, Kan R | This work |
| pMV261-Nat | Nat was connected to pMV261 | This work |
| pMV261-AraC | AraC was connected to pMV261 | This work |
| pMV261-AccA1 | AccA1 was connected to pMV261 | This work |
| pMV261-AccD1 | AccD1 was connected to pMV261 | This work |
| pMV262-AccA1 | AccA1 was connected to pMV262 | This work |
| pMV261-AraC-AccA1 | AraC and AccA1 were Series connected to pMV261 | This work |
| pMV262-AraC-AccA1 | Adding tet operon between AraC and Acca1 at pMV262-AraC-AccA1 | This work |
| Primers | ||
| AccA1-f | gcggatccagctgcagaattcATGGTCAACGAACTCTTCCACAC | AccA1 amplification |
| AccA1-r | tacgtcgacatcgataagcttTCATCGTTGGGACTCCTTGC | AccA1 amplification |
| AccD1-f | gcggatccagctgcagaattcATGACGCATCGTGAAGCGC | AccD1 amplification |
| AccD1-r | tacgtcgacatcgataagcttTCACATCCTGAAGACGCCGT | AccD1 amplification |
| Nat-f | gcggatccagctgcagaattcATGACCGTCGATGTGGCCG | Nat amplification |
| Nat-r | tacgtcgacatcgataagcttTCAGTTCCCCAGCACGCG | Nat amplification |
| AraC-f | gcggatccagctgcagaattcGTGAATGCCCCTCGGCGT | AraC amplification |
| AraC-r | tacgtcgacatcgataagcttTCAGTTACCTCTCATCCATTCCAG | AraC amplification |
| TetO-f | ccgtggcgcggccgcggtaccGAATTCATAACTTCGTATAATGTATGCTATAC | TetO amplification |
| TetO-r | tcgaattctgcagctggatccCTGGATCCGCAATTGTCTTGG | TetO amplification |
| 16S-RT-F | GTAGGGTCCGAGCGTTGTC | Quantitative RT-PCR |
| 16S-RT-R | GCGTCAGTTACTGCCCAGAG | Quantitative RT-PCR |
| AraC-RT-F | TCCTCACCGGAAGTGTTCTC | Quantitative RT-PCR |
| AraC-RT-R | ATACGAGCGAACTCATCGGT | Quantitative RT-PCR |
| Nat-RT-F | GTCGCTACCTGTGTGACGTG | Quantitative RT-PCR |
| Nat-RT-R | CTGTACGTCTTCACCACCGA | Quantitative RT-PCR |
Construction of recombinant strains
The method of constructing recombinant strains has been reported in previous studies [7]. AccA1, AccD1, AraC and Nat were cloned from QC M3 genome and inserted into linearized pMV261 to construct recombinant plasmids named pMV261-AccA1, pMV261-AccD1, pMV261-AraC and pMV261-Nat, respectively, and the recombinant plasmids were dropped into the dedicated QC M3 to obtain recombinant strains, QC M3-N, QC M3-C, QC M3-A and QC M3-D. The tandem strain was constructed by inserting the fragment AraC into the linearized pMV261-AccA1 using the same method as in previous studies to construct the tandem recombinant plasmid pMV261-AraC-AccA1, and finally obtain the recombinant strain QC M3-AC. By using pMV262, AccA1 was regulated to construct pMV262-AccA1 and recombinant strain QC M3-AccA1TetO. Based on this, strong RBS was selected to construct pMV262-AraC-AccA1 and recombinant strain QC M3-ATetOC (Additional file 1: Fig. S1) [28].
Determination and analytical methods
The desired product was extracted from the fermentation broth according to the previously described method, and propionyl-CoA was extracted from the cells and detected by HPLC [7]. Measurements were performed using an HPLC system equipped with a UV detector. Chromatographic separation was performed on a reversed-phase C18 column (4.6 mm × 250 mm, 5 μm). AD detection was performed using 80% methanol aqueous solution as mobile phase and buffer A (acetonitrile) and buffer B (100 mM ammonium acetate, pH 5.8) as mobile phases for the detection of propionyl-CoA. The molar product yields of androstenedione were calculated using the following equation: androstenedione molar yield % = (CAD/MAD)/(CPS/MPS) × 100%, where CAD and CPS are the product concentrations (g/L) of AD and phytosterol, respectively; MAD and MPS are the molar masses of AD and phytosterol, respectively.
The intracellular propionyl CoA content was calculated using the external standard method with reference to the method of Zhang et al. [7]. Calibration curves were plotted with propionyl CoA standard working solution, and sample propionyl CoA concentrations were calculated from the standard curves using the interpolation method. Finally, the relative concentration of intracellular propionyl coenzyme A was calculated based on the cell dry weight of each sample.
RNA extraction and Real-time quantitative PCR (qRT-PCR) analysis
For qRT-PCR analysis, cells were cultured for 48 h and collected by centrifugation at 8000×g for 10 min at 4 °C. RNA isolation was performed according to the method described in our previous description [7]. qRT-PCR analysis was performed according to the previously described method. Primers for qRT-PCR are listed in Table 2. 16S rRNA gene messenger RNA (mRNA) levels were used as housekeeping genes (internal controls) to normalize sampling errors. Relative gene expression levels were calculated by comparing the Ct method (2−ΔΔCt method) [31].
Transmission electron microscope observation of cell structure
Fixation and observation of MNR using transmission electron microscopy (TEM) [32]. Ultrathin sections (90 nm) were obtained using a Leica EM U27 ultrathin sectioning machine and a Leica EN KMR3, and the sections were stained and observed on a Hitachi HT7700 transmission electron microscope. The cell wall thickness measurement using ImageJ [33].
Statistical analysis
Data represent the mean and standard deviation (SD) of three independent experiments. Student’s t-test were used to determine significant differences between the data. Differences between two groups were measured by the Student’s t-test. A p value less than 0.05 was defined statistically significant difference.
Supplementary Information
Additional file 1. Plasmid profiles of recombinant strains
Acknowledgements
Not applicable.
Abbreviations
- AD
Androstenedione
- ADD
Androsta-1,4-diene-3,17-dione
- MNR
Mycolicibacterium neoaurum
- MCC
2-Methylcitrate cycle pathway
- MMC
Methylmalonyl cycle pathway
- MTB
Mycolicibacterium tuberculosis
- ACC
Propionyl-CoA /acetyl-CoA carboxylase
- PikA1
Polyketide synthase
- PDIM
Phthiocerol dimycocerates
- NAT
N-acetyltransferase
- DCW
Dry cell weight
- LB
Luria–Bertani
- CoA
Coenzyme A
- qRT-PCR
Quantitative Reverse Transcription-PCR
- mRNA
Messenger RNA
- HPLC
High-performance liquid
- TEM
Transmission electron microscopy
Author contributions
ZS and ZZ contributed equally to this work. ZS and ZZ performed most of the experiments, data analyses, and interpretation. YS designed and supervised the research and edited the manuscript aspects of this work. YJ and CY designed and participated in the experimental aspects of this work. LS and XZ helped edit the manuscript. MW supervised the research and edited the manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by the National Key R&D Program of China, Synthetic Biology Research (No. 2019YFA0905300); the National Natural Science Foundation of China (21978221); the Tianjin Synthetic Biotechnology Innovation Capacity Improvement Project (TSBICIP-KJGG-001-08); and the Foundation (No. 2020KF003) of Key Laboratory of Industrial Fermentation Microbiology of Ministry of Education and Tianjin Key Lab of Industrial Microbiology (Tianjin University of Science & Technology).
Availability of data and materials
All data for this study are included in this published article and its additional file.
Declarations
Ethics approval and consent to participate
This article does not contain any studies involving human or animal participants.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Zhenhua Su and Zhenjian Zhang equal contributions to this work
Contributor Information
Yanbing Shen, Email: shenyb@tust.edu.cn.
Min Wang, Email: minw@tust.edu.cn.
References
- 1.Malaviya A, Gomes J. Androstenedione production by biotransformation of phytosterols. Bioresour Technol. 2008;99:6725–6737. doi: 10.1016/j.biortech.2008.01.039. [DOI] [PubMed] [Google Scholar]
- 2.Zhao A, Zhang X, Li Y, Wang Z, Lv Y, Liu J, Alam MA, Xiong W, Xu J. Mycolicibacterium cell factory for the production of steroid-based drug intermediates. Biotechnol Adv. 2021;53:107860. doi: 10.1016/j.biotechadv.2021.107860. [DOI] [PubMed] [Google Scholar]
- 3.Donova MV, Egorova OV. Microbial steroid transformations: current state and prospects. Appl Microbiol Biotechnol. 2012;94:1423–1447. doi: 10.1007/s00253-012-4078-0. [DOI] [PubMed] [Google Scholar]
- 4.Fernandez-Cabezon L, Galan B, Garcia JL. New insights on steroid biotechnology. Front Microbiol. 2018;9:958. doi: 10.3389/fmicb.2018.00958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Savvi S, Warner DF, Kana BD, McKinney JD, Mizrahi V, Dawes SS. Functional characterization of a vitamin B12-dependent methylmalonyl pathway in Mycobacterium tuberculosis: implications for propionate metabolism during growth on fatty acids. J Bacteriol. 2008;190:3886–3895. doi: 10.1128/JB.01767-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zhou X, Zhang Y, Shen Y, Zhang X, Zhang Z, Xu S, Luo J, Xia M, Wang M. Economical production of androstenedione and 9alpha-hydroxyandrostenedione using untreated cane molasses by recombinant mycobacteria. Bioresour Technol. 2019;290:121750. doi: 10.1016/j.biortech.2019.121750. [DOI] [PubMed] [Google Scholar]
- 7.Zhang Y, Zhou X, Wang X, Wang L, Xia M, Luo J, Shen Y, Wang M. Improving phytosterol biotransformation at low nitrogen levels by enhancing the methylcitrate cycle with transcriptional regulators PrpR and GlnR of Mycobacterium neoaurum. Microb Cell Fact. 2020;19:13. doi: 10.1186/s12934-020-1285-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bazet Lyonnet B, Diacovich L, Cabruja M, Bardou F, Quemard A, Gago G, Gramajo H. Pleiotropic effect of AccD5 and AccE5 depletion in acyl-coenzyme A carboxylase activity and in lipid biosynthesis in mycobacteria. PLoS ONE. 2014;9:e99853. doi: 10.1371/journal.pone.0099853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liu HH, Xu LQ, Yao K, Xiong LB, Tao XY, Liu M, Wang FQ, Wei DZ. Engineered 3-Ketosteroid 9alpha-Hydroxylases in Mycobacterium neoaurum: an Efficient Platform for Production of Steroid Drugs. Appl Environ Microbiol. 2018;84:78. doi: 10.1128/AEM.02777-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Donova MV. Transformation of steroids by actinobacteria: A review. Appl Biochem Microbiol. 2007;43:1–14. doi: 10.1134/S0003683807010012. [DOI] [PubMed] [Google Scholar]
- 11.Vidal M, Becerra J, Mondaca MA, Silva M. Selection of Mycobacterium sp strains with capacity to biotransform high concentrations of beta-sitosterol. Appl Microbiol Biotechnol. 2001;57:385–389. doi: 10.1007/s002530100693. [DOI] [PubMed] [Google Scholar]
- 12.Ehebauer MT, Zimmermann M, Jakobi AJ, Noens EE, Laubitz D, Cichocki B, Marrakchi H, Laneelle MA, Daffe M, Sachse C, et al. Characterization of the mycobacterial acyl-CoA carboxylase holo complexes reveals their functional expansion into amino acid catabolism. PLoS Pathog. 2015;11:e1004623. doi: 10.1371/journal.ppat.1004623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lyu M, Cheng Y, Han X, Wen Y, Song Y, Li J, Chen Z. AccR, a TetR family transcriptional repressor, coordinates short-chain acyl coenzyme a homeostasis in. Appl Environ Microbiol. 2020;86:89. doi: 10.1128/AEM.00508-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Geisel RE, Sakamoto K, Russell DG, Rhoades ER. In vivo activity of released cell wall lipids of Mycobacterium bovis bacillus Calmette-Guerin is due principally to trehalose mycolates. J Immunol. 2005;174:5007–5015. doi: 10.4049/jimmunol.174.8.5007. [DOI] [PubMed] [Google Scholar]
- 15.Quadri LE. Biosynthesis of mycobacterial lipids by polyketide synthases and beyond. Crit Rev Biochem Mol Biol. 2014;49:179–211. doi: 10.3109/10409238.2014.896859. [DOI] [PubMed] [Google Scholar]
- 16.Kaur D, Guerin ME, Škovierová H, Brennan PJ, Jackson M. Chapter 2 biogenesis of the cell wall and other glycoconjugates of Mycobacterium tuberculosis. Adv Appl Microbiol. 2009;9:23–78. doi: 10.1016/S0065-2164(09)69002-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ouellet H, Johnston JB, de Montellano PR. Cholesterol catabolism as a therapeutic target in Mycobacterium tuberculosis. Trends Microbiol. 2011;19:530–539. doi: 10.1016/j.tim.2011.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Thomas ST, VanderVen BC, Sherman DR, Russell DG, Sampson NS. Pathway profiling in Mycobacterium tuberculosis: elucidation of cholesterol-derived catabolite and enzymes that catalyze its metabolism. J Biol Chem. 2011;286:43668–43678. doi: 10.1074/jbc.M111.313643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Lack NA, Kawamura A, Fullam E, Laurieri N, Beard S, Russell AJ, Evangelopoulos D, Westwood I, Sim E. Temperature stability of proteins essential for the intracellular survival of Mycobacterium tuberculosis. Biochem J. 2009;418:369–378. doi: 10.1042/BJ20082011. [DOI] [PubMed] [Google Scholar]
- 20.Evangelopoulos D, Gupta A, Lack NA, Maitra A, ten Bokum AM, Kendall S, Sim E, Bhakta S. Characterisation of a putative AraC transcriptional regulator from Mycobacterium smegmatis. Tuberculosis (Edinb) 2014;94:664–671. doi: 10.1016/j.tube.2014.08.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Eoh H, Rhee KY. Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids. Proc Natl Acad Sci U S A. 2014;111:4976–4981. doi: 10.1073/pnas.1400390111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Russell DG, Cardona PJ, Kim MJ, Allain S, Altare F. Foamy macrophages and the progression of the human tuberculosis granuloma. Nat Immunol. 2009;10:943–948. doi: 10.1038/ni.1781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xiong LB, Liu HH, Xu LQ, Sun WJ, Wang FQ, Wei DZ. Improving the production of 22-hydroxy-23,24-bisnorchol-4-ene-3-one from sterols in Mycobacterium neoaurum by increasing cell permeability and modifying multiple genes. Microb Cell Fact. 2017;16:89. doi: 10.1186/s12934-017-0705-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Xiong LB, Liu HH, Zhao M, Liu YJ, Song L, Xie ZY, Xu YX, Wang FQ, Wei DZ. Enhancing the bioconversion of phytosterols to steroidal intermediates by the deficiency of kasB in the cell wall synthesis of Mycobacterium neoaurum. Microb Cell Fact. 2020;19:80. doi: 10.1186/s12934-020-01335-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Malaviya A, Trivedi P, Gomes J. Improvement in biotransformation efficiency of Mycobacterium sp. by chemical mutagenesis. In: Proceedings of Joint Indo–Korean Symposium on Biochemical Engineering and Biotechnology-BIOHORIZON. 2007. p. 33.
- 26.Perez C, Falero A, Llanes N, Hung BR, Herve ME, Palmero A, Marti E. Resistance to androstanes as an approach for androstandienedione yield enhancement in industrial mycobacteria. J Ind Microbiol Biotechnol. 2003;30:623–626. doi: 10.1007/s10295-003-0079-4. [DOI] [PubMed] [Google Scholar]
- 27.Sim E, Sandy J, Evangelopoulos D, Fullam E, Bhakta S, Westwood I, Krylova A, Lack N, Noble M. Arylamine N-acetyltransferases in mycobacteria. Curr Drug Metab. 2008;9:510–519. doi: 10.2174/138920008784892100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sun H, Yang J, Song H. Engineering mycobacteria artificial promoters and ribosomal binding sites for enhanced sterol production. Biochem Eng J. 2020;162:78. doi: 10.1016/j.bej.2020.107739. [DOI] [Google Scholar]
- 29.Shen YB, Wang M, Li HN, Wang YB, Luo JM. Influence of hydroxypropyl-beta-cyclodextrin on phytosterol biotransformation by different strains of Mycobacterium neoaurum. J Ind Microbiol Biotechnol. 2012;39:1253–1259. doi: 10.1007/s10295-012-1130-0. [DOI] [PubMed] [Google Scholar]
- 30.Seniya SP, Yadav P, Jain V. Construction of E coli-Mycobacterium shuttle vectors with a variety of expression systems and polypeptide tags for gene expression in mycobacteria. PLoS ONE. 2020;15:e0230282. doi: 10.1371/journal.pone.0230282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 32.Vijay S, Hai HT, Thu DDA, Johnson E, Pielach A, Phu NH, Thwaites GE, Thuong NTT. Ultrastructural analysis of cell envelope and accumulation of lipid inclusions in clinical mycobacterium tuberculosis isolates from sputum, oxidative stress, and iron deficiency. Front Microbiol. 2017;8:2681. doi: 10.3389/fmicb.2017.02681. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1. Plasmid profiles of recombinant strains
Data Availability Statement
All data for this study are included in this published article and its additional file.





