Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2022 Oct 3;96(20):e00682-22. doi: 10.1128/jvi.00682-22

Singapore Grouper Iridovirus VP131 Drives Degradation of STING-TBK1 Pathway Proteins and Negatively Regulates Antiviral Innate Immunity

Ya Zhang a,#, Xiaolin Gao a,#, Xinmei Yang a, Yu Wang a, Wenji Wang a, Xiaohong Huang a, Qiwei Qin a,b,✉, Youhua Huang a,✉
Editor: Felicia Goodrumc
PMCID: PMC9599571  PMID: 36190239

ABSTRACT

Iridoviruses are large DNA viruses which cause great economic losses to the aquaculture industry and serious threats to ecological diversity worldwide. Singapore grouper iridovirus (SGIV), a novel member of the genus Ranavirus, causes high mortality in grouper aquaculture. Previous work on genome annotation demonstrated that SGIV contained numerous uncharacterized or hypothetical open reading frames (ORFs), whose functions remained largely unknown. Here, we reported that the protein encoded by SGIV ORF131R (VP131) was localized predominantly within the endoplasmic reticulum (ER). Ectopic expression of GFP-VP131 significantly enhanced SGIV replication, while VP131 knockdown decreased viral infection in vitro, suggesting that VP131 functioned as a proviral factor during SGIV infection. Overexpression of GFP-VP131 inhibited the interferon (IFN)-1 promoter activity and mRNA level of IFN-related genes induced by poly(I:C), Epinephelus coioides cyclic GMP/AMP synthase (EccGAS)/stimulator of IFN genes (EcSTING), TANK-binding kinase 1 (EcTBK1), or melanoma differentiation-associated gene 5 (EcMDA5), whereas such activation induced by mitochondrial antiviral signaling protein (EcMAVS) was not affected. Moreover, VP131 interacted with EcSTING and degraded EcSTING through both the autophagy-lysosome pathway and ubiquitin-proteasome pathway, and targeted for the K63-linked ubiquitination. Of note, we also found that EcSTING significantly accelerated the formation of GFP-VP131 aggregates in co-transfected cells. Finally, GFP-VP131 inhibited EcSTING- or EcTBK1-induced antiviral activity upon red-spotted grouper nervous necrosis virus (RGNNV) infection. Together, our results demonstrated that the SGIV VP131 negatively regulated the IFN response by inhibiting EcSTING-EcTBK1 signaling for viral evasion.

IMPORTANCE STING has been identified as a critical factor participating in the innate immune response which recruits and phosphorylates TBK1 and IFN regulatory factor 3 (IRF3) to induce IFN production and defend against viral infection. However, viruses also distort the STING-TBK1 pathway to negatively regulate the IFN response and facilitate viral replication. Here, we reported that SGIV VP131 interacted with EcSTING within the ER and degraded EcSTING, leading to the suppression of IFN production and the promotion of SGIV infection. These results for the first time demonstrated that fish iridovirus evaded the host antiviral response via abrogating the STING-TBK1 signaling pathway.

KEYWORDS: SGIV, VP131, STING, TBK1, interferon, immune evasion

INTRODUCTION

Upon virus infection, host pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) and trigger the interferon (IFN)-mediated innate immune response to prevent virus invasion (1). The cytosolic DNA sensor cyclic GMP/AMP synthase (cGAS) recognizes cytosolic DNA, produces cyclic GMP-AMP (cGAMP), and then activates stimulator of IFN genes (STING) (2, 3), which recruits and phosphorylates TANK-binding kinase 1 (TBK1) and IFN regulatory factor 3 (IRF3) to induce the production of type I IFN and other proinflammatory cytokines (4, 5). In addition, the retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) including RIG-I (6) and melanoma differentiation-associated gene 5 (MDA5) (7) sense exogenous viral RNAs and interact with the mitochondrial antiviral signaling protein (MAVS, also known as VISA, IPS-1, or Cardif), thereby activating STING-TBK1 and leading to the phosphorylation of IRF3/7 to initiate the expression of IFN (8).

During the co-evolution of virus and host, viruses have developed multiple strategies to abrogate or evade the host immune system (9, 10). Viral proteins from both DNA and RNA viruses have been demonstrated to be involved in IFN regulation by targeting key adaptors in the RLR and cGAS/STING signaling pathways for viral immune evasion (9, 11, 12). Regarding RNA viruses, dengue virus (DENV) nonstructural (NS) 2A and NS4B inhibit RIG-I/MAVS signaling by blocking TBK1/IRF3 phosphorylation and IFN-β induction, thereby facilitating DENV replication and virulence (13); hepatitis C virus (HCV) NS4B suppresses IFN signaling by disrupting the interactions between STING and TBK1 (14), and NS3/4A cleaves MAVS to evade innate immunity (15); hepatitis B virus (HBV) X protein interacts with MAVS and promotes the degradation of MAVS in an ubiquitin (Ub)-proteasome manner, thus preventing the induction of IFN (16). Likewise, mammalian DNA virus-encoded proteins can also block IFN production mediated by the cGAS/STING and RLR signaling pathways. Human cytomegalovirus (HCMV) glycoprotein US9 evades type I IFN immune responses by promoting MAVS leakage from the mitochondria, and disrupting STING oligomerization and STING-TBK1 association in the endoplasmic reticulum (ER) (17). Herpes simplex virus 1 (HSV-1) UL41 and VP22 also abrogate cGAS/STING-mediated antiviral innate immunity for efficient replication (18, 19). Although great progress has been made in understanding countermeasures by mammalian viruses against the cGAS/STING-mediated immune response, few studies focused on fish viruses, especially large DNA viruses.

Iridoviruses are large, double-stranded DNA (dsDNA) viruses which are divided into six genera: Iridovirus, Megalocytivirus, Ranavirus, Lymphocystivirus, Chloriridovirus, and Decapodiridovirus (20, 21). Iridoviruses cause severe diseases in fish, reptiles, amphibians, and invertebrate species, resulting in heavy economic losses to marine aquaculture and serious threats to ecological diversity worldwide (22). Singapore grouper iridovirus (SGIV), a novel member of the genus Ranavirus, is isolated from the diseased brown-spotted grouper (Epinephelus tauvina) (23, 24), and causes more than 90% mortality in grouper aquaculture (25). SGIV genome consists of 140,131 bp, encoding 162 open reading frames (ORFs) (26, 27). Although the roles of functional SGIV proteins in viral replication and cell proliferation have been partly characterized (28–31), no reports focus on the regulatory roles on host IFN response by SGIV-encoded proteins. Our previous study reveals that SGIV infection inhibit the expression of IFN-related genes induced by poly(I:C) transfection. In addition, the IFN promoter reporter assays for high-throughput identification of viral immune evasion genes indicate that multiple viral proteins encoded by SGIV, such as VP131, a protein with the immunoglobulin (IG) domain, inhibit IFN-1 promoter activity upon induction by poly(I:C) or cGAS/STING (unpublished data), suggesting that SGIV might combat the cellular IFN-mediated antiviral activity in vitro (32). However, the mechanisms by which SGIV proteins target the STING-TBK1 axis for immune evasion remain unclear.

In this study, we screened and identified SGIV protein VP131, which could markedly inhibit poly(I:C)- or cGAS/STING-mediated IFN activation. The roles of VP131 during SGIV replication and the mechanism underlying the interaction between VP131 and STING were investigated. To our knowledge, this is the first report of an SGIV-encoded protein targeting the STING-TBK1 pathway to inhibit IFN production and facilitate virus replication. Our findings shed light on the immune evasion strategies by fish iridoviruses.

RESULTS

Subcellular localization of SGIV VP131.

SGIV VP131 (GenBank accession no. YP_164226.1), identified by LC-ESI-MS/MS in recent work (33), encoded a 184-amino-acid polypeptide which contains an IG domain (aa 39–130) and a TM domain (aa 142–164). No homologs in the NCBI database were found to share >25% identity with VP131, suggesting that SGIV VP131 is a novel gene present in fish iridoviruses. To clarify its potential function, we firstly examined its subcellular localization in vitro. Using confocal microscopy, we observed the distribution of GFP-VP131 after (i) co-transfection with different subcellular organelle marker plasmids, including pDsRed2-ER, pDsRed2-Mito, and pDsRed2-Golgi, or (ii) staining with the lysosome probe Lyso-Tracker. As shown in Fig. 1, the green fluorescence in pEGFP-N3-transfected cells was distributed throughout both the cytoplasm and the nucleus, while in pGFP-VP131-transfected cells, the green fluorescence was mainly distributed in the cytoplasm, and some fluorescent puncta were randomly distributed in the cytoplasm. Furthermore, the green fluorescence of GFP-VP131 was not colocalized with the red fluorescence from mitochondria (Fig. 1B) or lysosomes (Fig. 1D), while it predominantly overlapped with the red fluorescence signals of ER (Fig. 1A), and intracellular fluorescence aggregates partially colocalized with the Golgi apparatus (Fig. 1C). These results indicate that SGIV ORF131R encodes an ER-localized protein.

FIG 1.

FIG 1

The subcellular localization of GFP-VP131. (A to D) GS cells were seeded into glass bottom dishes (35 mm) and co-transfected with pGFP-VP131 or pEGFP-N3 with pDsRed2-ER (A), pDsRed2-Mito (B), or pDsRed2-Golgi (C) for 48 h. In addition, GS cells transfected with pGFP-VP131 or pEGFP-N3 for 48 h, were stained with Lyso-Tracker (1:1,000) (D) for 30 min. After staining with DAPI for 5 min, cells were imaged under a CLSM. Scale bar = 5 μm. n = 3. GS, grouper spleen; ER, endoplasmic reticulum; Mito, mitochondria; DAPI, 4,6-diamidino-2-phenylindole; CLSM, confocal laser scanning microscope.

VP131 acts as a proviral factor during SGIV replication.

To elucidate whether VP131 is essential for SGIV replication, GS cells were transfected with pGFP-VP131 or pEGFP-N3 for 24 h and then infected with SGIV. To confirm that GFP-VP131 was successfully overexpressed, the mRNA and protein levels of GFP-VP131 in the pGFP-VP131-overexpressing cells were examined by RT-PCR and IB (Fig. 2A). Compared to the control cells, overexpression of GFP-VP131 obviously accelerated the severity of the cytopathic effects (CPEs) induced by SGIV infection at 24 hpi (Fig. 2B). Consistently, the transcription levels of SGIV MCP, VP19, lipopolysaccharide-induced TNF-α factor (LITAF), and infected cell protein 18 (ICP18) in pGFP-VP131-overexpressing cells were significantly increased (Fig. 2C). In addition, the protein levels of SGIV MCP were also increased in GFP-VP131-overexpressing cells compared to control cells (Fig. 2D). The virus titer assay indicated that GFP-VP131 overexpression significantly increased SGIV production (Fig. 2E).

FIG 2.

FIG 2

GFP-VP131 overexpression significantly enhanced SGIV replication. (A) GS cells were cultured in 24-well plates and transfected with pGFP-VP131 or pEGFP-N3 for 24 h. Then cells were collected to detect the mRNA and protein levels of GFP-VP131 by RT-PCR and IB. M, DNA Ladder. (B to E) The effect of GFP-VP131 overexpression on the severity of CPEs induced by SGIV at 24 hpi. The white arrows showed cell rounding and aggregation of cells evoked by SGIV infection (B). Meanwhile, the infected cells were harvested to evaluate the mRNA (C) and protein levels (D) of SGIV by RT-qPCR and IB, respectively. The relative fold change values were calculated with the 2−ΔΔCt method with β-actin as an internal control. The intensity of proteins was quantified using ImageJ software and normalized to the expression of β-tubulin. In addition, virus titer was determined in GFP-VP131-transfected cells by TCID50 assay at 24 hpi. (E). n = 3, mean ± SD. *, P < 0.05. GS, grouper spleen; M, DNA maker; bp, base pair; SGIV, Singapore grouper iridovirus; RT-PCR, reverse transcription-PCR; RT-qPCR, reverse transcription-quantitative real-time PCR; IB, immunoblotting; CPEs, cytopathic effects; hpi, h postinfection; TCID50, 50% tissue culture infective dose; MCP, major capsid protein; ICP18, infected cell protein 18; LITAF, lipopolysaccharide-induced TNF-α factor; SD, standard deviation.

Subsequently, the effect of VP131 knockdown on SGIV replication was investigated by RT-qPCR and IB. Both RT-qPCR and RT-PCR results showed that siRNA1 and siRNA2 significantly reduced VP131 expression by 18% and 42%, respectively (Fig. 3A). Thus, siRNA2 was used in the subsequent experiments. The severity of CPEs induced by SGIV was obviously weakened in the siRNA-VP131-transfected cells (Fig. 3B). Knockdown of VP131 reduced the transcription levels of SGIV MCP, VP19, LITAF, and ICP18 (Fig. 3C). Moreover, the protein levels of SGIV MCP were decreased in the siRNA-VP131-transfected cells compared with siRNA-NC-transfected cells (Fig. 3D). In addition, the virus titer assay indicated that VP131 knockdown significantly decreased SGIV production (Fig. 3E). Taken together, these results indicate that VP131 may function as a proviral factor in SGIV infection.

FIG 3.

FIG 3

VP131 knockdown significantly inhibited SGIV replication. (A) GS cells were transfected with 3 specific siRNAs targeting VP131 or siRNA-NC, and the interference efficiency was determined by RT-qPCR and RT-PCR. M, DNA marker. siRNA2 was used for (B), (C), (D) and (E). (B to E) GS cells transfected with siRNA2-VP131 or siRNA-NC, were infected with SGIV (MOI = 2) and CPEs induced by SGIV at 24 hpi were observed. The white arrows show cell rounding and aggregation of cells evoked by SGIV infection (B). Besides, the effect of VP131 knockdown on the mRNA and protein levels of viral genes were analyzed by RT-qPCR (C) and IB (D). Virus titer was determined in siRNA-VP131-transfected cells by TCID50 assay at 24 hpi (E). n = 3, mean ± SD. *, P < 0.05. GS, grouper spleen; siRNAs, small interfering RNAs; siRNA-NC, Stealth RNAi Negative Control Medium GC Duplexes; M, DNA maker; bp, base pair; SGIV, Singapore grouper iridovirus; MOI, multiplicity of infection; RT-qPCR, reverse transcription-quantitative real-time PCR; RT-PCR, reverse transcription-PCR; IB, immunoblotting; CPEs, cytopathic effects; hpi, h postinfection; TCID50, 50% tissue culture infective dose; MCP, major capsid protein; ICP18, infected cell protein 18; LITAF, lipopolysaccharide-induced TNF-α factor; SD, standard deviation.

VP131 suppresses IFN activation mediated by EcSTING, EcTBK1, and EcMDA5.

To investigate the effects of SGIV VP131 on the host antiviral response, the IFN-1 promoter activity was determined by luciferase reporter assay and the transcripts of IFN-related genes were detected by RT-qPCR analysis. As shown in Fig. 4A, poly(I:C) (a mimic of viral RNA) stimulation induced the activation of IFN-1 promoter, and this activation was significantly inhibited by GFP-VP131 overexpression. RT-qPCR analysis showed that overexpression of GFP-VP131 reduced the poly(I:C)-induced gene expression of IRF3, IRF7, and Mx protein I (MxI) (Fig. 4B).

FIG 4.

FIG 4

GFP-VP131 inhibited the IFN activation induced by HA-EcSTING, Flag-EcTBK1, and HA-EcMDA5. (A, D, and G) GS cells were seeded into 48-well plates for overnight, and then co-transfected with poly(I:C) (A), pHA-EccGAS with pHA-EcSTING (A), pHA-EcSTING (D), pFlag-EcTBK1 (D), pHA-EcMDA5 (G), or pHA-EcMAVS (G), pGFP-VP131 or control vector, pRL-SV40 and pIFN-1-Luc plasmid. After 48 h, luciferase activities were monitored with pRL-SV40 as a control. (B, C, E, F, H, and I) GS cells were seeded into 24-well plates and co-transfected with inducer plasmids including poly(I:C) (B), pHA-EccGAS with pHA-EcSTING (C), pHA-EcSTING (E), pFlag-EcTBK1 (F), pHA-EcMDA5 (H), or pHA-EcMAVS (I) and pGFP-VP131 or control vector. At 48 h posttransfection, cells were harvested for RT-qPCR analysis and total RNA was extracted to determine the relative expression levels of IFN-related genes, including IRF3, IRF7, and MxI. n = 3, mean ± SD. *, P < 0.05. IFN, interferon; GS, grouper spleen; cGAS, cyclic GMP/AMP synthase; poly(I:C), polyinosinic:poly(C); STING, stimulator of IFN genes; TBK1, TANK-binding kinase 1; MDA5, melanoma differentiation-associated gene 5; MAVS, mitochondrial antiviral signaling protein; RT-qPCR, reverse transcription-quantitative real-time PCR; IRF3, IFN regulatory factor 3; IRF7, IFN regulatory factor 7; SD, standard deviation; ns, nonsignificant.

cGAS is a recently identified DNA sensor capable of activating the adaptor protein STING, which results in IFN production and host antiviral responses (34). To evaluate whether SGIV VP131 could regulate IFN activation mediated by EccGAS/EcSTING, the effects of GFP-VP131 overexpression on IFN-1 promoter activity triggered by co-transfection with pHA-EccGAS and pHA-EcSTING were examined. As shown in Fig. 4A, ectopic expression of HA-EccGAS alone could not activate the IFN-1 promoter, whereas co-transfection with pHA-EccGAS and pHA-EcSTING significantly activated the IFN-1 promoter. Compared to the control vector, GFP-VP131 overexpression significantly inhibited the activation of IFN-1 triggered by co-transfection with pHA-EccGAS and pHA-EcSTING (Fig. 4A). Furthermore, the mRNA levels of IFN-related genes were also measured through RT-qPCR when the cells were co-transfected with pHA-EccGAS and pHA-EcSTING, and pGFP-VP131 or the control vector. Similarly, overexpression of GFP-VP131 attenuated the HA-EccGAS/HA-EcSTING-induced transcription of IRF3, IRF7, and MxI (Fig. 4C). These findings indicate that GFP-VP131 efficiently downregulates the poly(I:C)- and EccGAS/EcSTING-mediated IFN signaling pathway response.

To further confirm whether VP131 blocks IFN-1 activation through regulating or interacting with key molecules of the cGAS/STING and RLR pathways, we co-transfected the control vector or pGFP-VP131 along with the pIFN-1-Luc plasmid and the plasmids expressing important adaptors in the cGAS/STING or RLR signaling pathway, including pHA-EcSTING, pFlag-EcTBK1, pHA-EcMDA5, and pHA-EcMAVS, into grouper cells. As shown in Fig. 4D and G, IFN-1 activation was induced by overexpression of all important adaptors, and ectopic expression of GFP-VP131 was shown to inhibit the activation of IFN-1 induced by HA-EcSTING (Fig. 4D), Flag-EcTBK1 (Fig. 4D) or HA-EcMDA5 (Fig. 4G), while the activation of IFN-1 induced by HA-EcMAVS was not affected by GFP-VP131 overexpression (Fig. 4G). Similarly, overexpression of GFP-VP131 decreased the expression of IFN-related genes induced by HA-EcSTING (Fig. 4E), Flag-EcTBK1 (Fig. 4F), or HA-EcMDA5 (Fig. 4H), while the HA-EcMAVS-induced expression of IFN-related genes was not affected (Fig. 4I). Therefore, our results suggest that VP131 represses the production of IFN through regulating EcSTING, EcTBK1, or EcMDA5.

VP131 colocalizes and interacts with EcSTING.

Given that GFP-VP131 negatively regulates the function of key adaptors in the cGAS/STING and RLR signaling pathways, the relationships between GFP-VP131 and key adaptors, including HA-EcSTING, HA-EcTBK1, HA-EcMDA5, and HA-EcMAVS, were clarified by confocal microscopy analysis and Co-IP. Firstly, GS cells co-transfected with pGFP-VP131 and the plasmids, including pHA-EcSTING, pHA-EcTBK1, pHA-EcMDA5, and pHA-EcMAVS, were fixed for IFA. Confocal microscopy analysis revealed that red signals from HA-EcSTING, HA-EcTBK1, HA-EcMDA5, and HA-EcMAVS were observed in the cytoplasm. In addition, both the uniform distribution and the green puncta of GFP-VP131 almost overlapped with the red signal of HA-EcSTING or HA-EcTBK1 (Fig. 5A and B), but not with that of HA-EcMDA5 or HA-EcMAVS (Fig. 5C and D), suggesting that GFP-VP131 colocalizes with HA-EcSTING or HA-EcTBK1. Next, the protein interactions between GFP-VP131 and key adaptors were assessed by Co-IP. As shown in Fig. 5E to H, HA-EcSTING or HA-EcTBK1 was recognized by anti-GFP Ab (Fig. 5E and F), whereas HA-EcMDA5 or HA-EcMAVS was not recognized by anti-GFP Ab (Fig. 5G and H), suggesting that GFP-VP131 interacts with HA-EcSTING or HA-EcTBK1 to regulate the IFN response.

FIG 5.

FIG 5

GFP-VP131 colocalized and interacted with HA-EcSTING. (A to D) GS cells seeded into glass bottom cell culture dishes (35 mm) were co-transfected with pGFP-VP131 or pEGFP-N3 and pHA-EcSTING (A), pHA-EcTBK1 (B), pHA-EcMDA5 (C), or pHA-EcMAVS (D). At 48 h posttransfection, GS cells were fixed, subjected to IFA, and imaged under a CLSM. Green signals represent GFP-VP131, red signals represent HA-EcSTING, HA-EcTBK1, HA-EcMDA5, or HA-EcMAVS, blue signals indicate the nucleus, and yellow signals in the merged image show that GFP-VP131 colocalized with HA-EcSTING or HA-EcTBK1. Scale bar = 5 μm. (E to H) GS cells were cultured in 10-cm2 dishes overnight and co-transfected with pHA-EcSTING (E), pHA-EcTBK1 (F), pHA-EcMDA5 (G), or pHA-EcMAVS (H) and pGFP-VP131 or pEGFP-N3 for 48 h. Cell lysates were immunoprecipitated with anti-GFP using the Dynabeads Protein G Immunoprecipitation Kit. Then the immunoprecipitates and WCLs were analyzed by IB with anti-GFP, anti-HA, and anti-β-tubulin. n = 3. GS, grouper spleen; STING, stimulator of IFN genes; TBK1, TANK-binding kinase 1; MDA5, melanoma differentiation-associated gene 5; MAVS, mitochondrial antiviral signaling protein; IFA, indirect immunofluorescence assay; CLSM, confocal laser scanning microscope; DAPI, 4,6-diamidino-2-phenylindole; WCLs, whole-cell lysates; IB, immunoblotting; IP, immunoprecipitation.

To explore the crucial regions involved in the VP131-STING interaction, the truncated mutant VP131-IG (aa 1–141), which lacking the N-terminal TM region was constructed (Fig. 6A). As shown in Fig. 6B, the green fluorescence of GFP-VP131-IG was localized both in the cytoplasm and nucleus, and also partly overlapped with the red fluorescence of DsRed-ER (Fig. 6B). The Co-IP assay indicated that the anti-GFP Ab-immunoprecipitated protein complexes containing wild-type GFP-VP131 or the truncated GFP-VP131-IG mutant, were both recognized by anti-HA Ab (Fig. 6C). Besides, the green fluorescence of GFP-VP131-IG was partly colocalized with the red fluorescence of HA-EcSTING (Fig. 6D), suggesting that IG region of VP131 is crucial for its interaction with EcSTING.

FIG 6.

FIG 6

The N-terminal immunoglobulin domain of GFP-VP131 interacted with the N-terminal transmembrane domain of EcSTING. (A) Schematic representation of mutants of VP131. VP131-IG mutant (aa 1–141) lacks the C-terminal TM. (B) The co-localization of GFP-VP131 or GFP-VP131-IG with DsRed-ER. GS cells were seeded into bottom cell culture dishes (35 mm), and co-transfected with pGFP-VP131 or pGFP-VP131-IG and pDsRed2-ER. Then the cells were stained with DAPI, and subjected to confocal microscopy analysis. (C) GFP-VP131 interacted with HA-EcSTING via its N-terminal IG region. GS cells were cultured in 10-cm2 dishes, and were co-transfected with pHA-EcSTING and pGFP-VP131, pGFP-VP131-IG, or pEGFP-N3. After 48 h, cell lysates were immunoprecipitated with anti-GFP using the Dynabeads Protein G Immunoprecipitation Kit, and analyzed by IB with anti-GFP, anti-HA, and anti-β-tubulin, respectively. (D) GFP-VP131-IG colocalized with the HA-EcSTING. GS cells seeded into bottom cell culture dishes (35 mm), were co-transfected with pGFP-VP131-IG and pHA-EcSTING for IFA, and observed under CLSM. (E) Diagrammatic representation of mutants of EcSTING used in this study. There are 2 mutants of EcSTING: EcSTING-ΔC, containing the TM domain (aa 1–140), and EcSTING-ΔN, lacking the TM domain (aa 141–408). (F) HA-EcSTING associated with GFP-VP131 via its N-terminal TM domain. GS cells seeded into 10-cm2 dishes were co-transfected with pHA-EcSTING, pHA-EcSTING-ΔC, pHA-EcSTING-ΔN or pcDNA3.1-3×HA and pGFP-VP131 for 48 h. Cell lysates were immunoprecipitated with anti-HA affinity gel overnight. Then the immunoprecipitates and WCLs were analyzed by IB with anti-GFP, anti-HA, and anti-β-tubulin, respectively. (G) GFP-VP131 colocalized with domains of HA-EcSTING. GS cells were co-transfected with pHA-EcSTING, pHA-EcSTING-ΔC, or pHA-EcSTING-ΔN and pGFP-VP131 for IFA, and imaged under a CLSM. Green fluorescence signals represented GFP-VP131 or GFP-VP131-IG and red fluorescence signals represented DsRed-ER, HA-EcSTING, HA-EcSTING-ΔC, or HA-EcSTING-ΔN. Scale bar = 5 μm. n = 3. GS, grouper spleen; STING, stimulator of IFN genes; ER, endoplasmic reticulum; IG, immunoglobulin; TM, transmembrane; DAPI, 4,6-diamidino-2-phenylindole; IFA, indirect immunofluorescence assay; CLSM, confocal laser scanning microscope; WCLs, whole-cell lysates; IB, immunoblotting; IP, immunoprecipitation.

Next, 2 EcSTING truncations, including EcSTING-ΔC (lacking the C terminus, aa 1–140) and EcSTING-ΔN (lacking the N-terminal TM region, aa 141–408) were generated (Fig. 6E) to identify the critical domains of EcSTING interacting with VP131. As shown in Fig. 6F, the wild-type HA-EcSTING as well as the truncation of HA-EcSTING-ΔC, but not HA-EcSTING-ΔN retained the ability to bind to GFP-VP131. In addition, HA-EcSTING-ΔN was distributed throughout the cells, whereas the wild-type HA-EcSTING and HA-EcSTING-ΔC were specifically localized in the cytoplasm (Fig. 6G). Collectively, it is suggested that the TM region of EcSTING is indispensable for its interaction with VP131.

VP131 promotes EcSTING degradation through the K63-linked ubiquitination.

To gain further insight into the regulatory effects of VP131 on EcSTING or EcTBK1, we firstly examined the effects of GFP-VP131 on important adaptors at the protein level. As shown in Fig. 7, the expression of HA-EcSTING or HA-EcTBK1 was markedly reduced by GFP-VP131 (Fig. 7A and D). Moreover, the degradation of HA-EcSTING or HA-EcTBK1 was enhanced with higher GFP-VP131 transfection doses (Fig. 7B and E). Next, the degradation mechanism of HA-EcSTING or HA-EcTBK1 in this process were investigated. Three classical protein degradation systems exist in organisms, namely, the ubiquitin-proteasome pathway, the autophagy pathway, and the lysosomal pathway (35). To dissect which pathway is predominant in GFP-VP131-induced HA-EcSTING degradation, the cells were co-transfected with pGFP-VP131 and pHA-EcSTING and pretreated with MG132, 3-MA, or NH4Cl to disrupt the different degradation pathways. As shown in Fig. 7C, downregulation of HA-EcSTING was routinely observed in GFP-VP131-overexpressing cells compared with the control cells. In addition, GFP-VP131-mediated degradation of HA-EcSTING was blocked by all inhibitors (MG132, 3-MA, and NH4Cl). Subsequently, GS cells co-transfected with pGFP-VP131 and pHA-EcTBK1 were also incubated with these inhibitors, and we found that MG132 but not 3-MA or NH4Cl significantly blocked GFP-VP131-mediated HA-EcTBK1 damage (Fig. 7F), suggesting that VP131 inhibits EcSTING–EcTBK1 signaling through both the autophagy-lysosome pathway and ubiquitin-proteasome pathway. Given that proteasome-dependent degradation is a common outcome of ubiquitination modification. To further examine whether the degradation of EcSTING was related to ubiquitination, GS cells were co-transfected with pFlag-EcSTING, pGFP-VP131 and pHA-Ub in the presence or absence of MG132. Co-IP revealed that GFP-VP131 promoted the ubiquitination of Flag-EcSTING (Fig. 7G). K48- or K63-linked Ub, which are ubiquitin mutant with single lys 48 or lys 63 residue, are 2 canonical polyubiquitin chain linkages. To explore the pattern of ubiquitination of Flag-EcSTING, pFlag-EcSTING, pGFP-VP131 and pHA-K48-Ub or pHA-K63-Ub were co-transfected in the presence of MG132. As shown in Fig. 7H, the ubiquitination of Flag-EcSTING triggered by the VP131 was promoted via K63-linked ubiquitination. Thus, these results suggest that VP131 induces K63-linked Ub-proteasomal degradation of EcSTING.

FIG 7.

FIG 7

GFP-VP131 promoted HA-EcSTING or HA-EcTBK1 degradation. (A and D) GS cells were seeded in 12-well plates, incubated overnight, and co-transfected with pHA-EcSTING (A), or pHA-EcTBK1 (D) and pGFP-VP131 or pEGFP-N3 for 48 h. The WCLs were subjected to IB with anti-HA, anti-GFP, and anti-β-tubulin. (B and E) GS cells seeded in 12-well plates were co-transfected with pHA-EcSTING (B) or pHA-EcTBK1 (E) plus various concentrations of pGFP-VP131. After 48 h, the WCLs were subjected to IB with anti-HA, anti-GFP, and anti-β-tubulin. (C and F) GS cells were seeded in 12-well plates overnight and co-transfected with pHA-EcSTING (C), or pHA-EcTBK1 (F) and pGFP-VP131 or pEGFP-N3. At 18 h posttransfection, the cells were treated with DMSO, MG132 (10 μM), 3-MA (2 mM), or NH4Cl (20 mM) for 6 h prior to IB analysis. (G) GFP-VP131 promoted the ubiquitination of Flag-EcSTING. GS cells were co-transfected with pFlag-EcSTING, pGFP-VP131 or pEGFP-N3, and pHA-Ub for 18 h and then cells were treated with DMSO or MG132 (10 μM) for 6 h. Cell lysates were IP with anti-Flag–agarose conjugate for overnight and the immunoprecipitates and WCLs were analyzed by IB with Abs indicated. (H) GFP-VP131 mediated K63-linked ubiquitination of Flag-EcSTING in vitro. GS cells were co-transfected with pFlag-EcSTING, pGFP-VP131 or pEGFP-N3, and pHA-Ub-K48 or pHA-Ub-K63 for 18 h. The cells were then treated with MG132 (10 μM) for 6 h prior to Co-IP analysis. n = 3. GS, grouper spleen; STING, stimulator of IFN genes; TBK1, TANK-binding kinase 1; DMSO, dimethyl sulfoxide; WCLs, whole-cell lysates; IB, immunoblotting; IP, immunoprecipitation; Co-IP, co-immunoprecipitation.

EcSTING-VP131 interaction accelerates the formation of GFP-VP131 aggregates in vitro.

Given that VP131 interacts with EcSTING and promotes EcSTING degradation, we next investigated whether EcSTING reversely affects the function of VP131. As shown in Fig. 8A, the green fluorescence signals of GFP-VP131 were mainly distributed in the cytoplasm in cells co-transfected with pGFP-VP131 and pDsRed2-C1, and green fluorescent aggregates were observed in only 21% of transfected cells at 24 h posttransfection. However, the green aggregates were observed in 82% of cells co-transfected with pGFP-VP131 and pDsRed2-EcSTING (Fig. 8A and B). At 48 h, the green fluorescent aggregates were observed in 45% of pGFP-VP131- and pDsRed2-C1-co-transfected cells, increasing to 91% in pGFP-VP131- and pDsRed2-EcSTING-co-transfected cells (Fig. 8B). Moreover, the majority of the green fluorescence signals from GFP-VP131 overlapped with the red fluorescence signals from DsRed-EcSTING. Collectively, our results suggest that the EcSTING–VP131 interaction accelerates the formation of GFP-VP131 aggregates to affect its function.

FIG 8.

FIG 8

DsRed-EcSTING accelerated the formation of GFP-VP131 aggregates. (A and B) GS cells seeded into glass bottom cell culture dishes (35 mm) were co-transfected with pGFP-VP131 and pDsRed2-EcSTING or pDsRed2-C1, and then cells were fixed at 24 or 48 h and subjected to confocal microscopy analysis. Green signals represent GFP-VP131, red signals represent DsRed-EcSTING or DsRed, and yellow signals in the merged image show that GFP-VP131 colocalized with DsRed-EcSTING (original magnification, ×100; oil immersion objective). Scale bar = 5 μm (A). Moreover, the percentage of green GFP-VP131 aggregates in transfected GS cells was quantified (B). The percentage of aggregates was quantified as the number of transfected GS cells with GFP-VP131 aggregates relative to that of transfected GS cells with all GFP-VP131 signals. The number of transfected GS cells with GFP-VP131 signals was set as 100%, and 1,000 cells were counted. n = 3, mean ± SD. *, P < 0.05. GS, grouper spleen; STING, stimulator of interferon genes; SD, standard deviation.

VP131 inhibits EcSTING’s and EcTBK1’s antiviral action.

Our previous studies showed that EcSTING and EcTBK1 might be important regulators of the grouper innate immune response and exert antiviral effects against fish viruses (36, 37). In addition, the above data suggest that VP131 not only suppresses EcSTING-mediated IFN activation, but also promotes EcSTING degradation. Next, we investigated the effects of GFP-VP131 overexpression on antiviral action of HA-EcSTING. As shown in Fig. 9, upon infection with RGNNV, HA-EcSTING overexpression weakened CPE progression and decreased viral gene transcription and protein expression compared to the control vector, indicating that EcSTING exerts antiviral effects against RGNNV. In contrast, the inhibitory effect on CPE progression by HA-EcSTING overexpression was partly reversed by GFP-VP131 (Fig. 9A). Moreover, the mRNA and protein levels of CP were also reversed in pGFP-VP131- and pHA-EcSTING-co-transfected cells (Fig. 9B and C). Similarly, ectopic expression of Flag-EcTBK1 also inhibited the replication of RGNNV, and GFP-VP131 rescued the antiviral effects of Flag-EcTBK1 (Fig. 9D to F). Taken together, our results indicate that VP131 abrogates EcSTING/EcTBK1-mediated antiviral action in vitro.

FIG 9.

FIG 9

GFP-VP131 blocked the HA-EcSTING- or Flag-EcTBK1-induced cellular antiviral immune response. (A to F) GS cells were seeded in 24-well plates, incubated overnight, and transfected with pGFP-VP131 or pEGFP-N3 and pHA-EcSTING (A to C) or pFlag-EcTBK1 (D to F) for 24 h. Next, cells were infected with RGNNV (MOI = 2). The CPEs of infected cells were observed at 24 hpi. The white arrows indicated that vacuole formation was induced by RGNNV infection (A and D). The cells were harvested to examine the mRNA (B and E) and protein (C and F) levels of viral CP by RT-qPCR and IB. n = 3, mean ± SD. *, P < 0.05. GS, grouper spleen; STING, stimulator of IFN genes; TBK1, TANK-binding kinase 1; CPEs, cytopathic effects; RGNNV, red-spotted grouper nervous necrosis virus; MOI, multiplicity of infection; hpi, h postinfection; CP, capsid protein; RT-qPCR, reverse transcription-quantitative real-time PCR; IB, immunoblotting; SD, standard deviation.

DISCUSSION

Like mammalian IFNs, fish IFNs play an important role in the host innate immune system, which is the first line of defense against pathogen infection. To complete their replication cycles in the host, aquatic viruses have evolved a variety of strategies to escape the host immune system (38). SGIV, an important infectious pathogen in grouper aquaculture, has been demonstrated to counteract the cellular IFN-mediated antiviral responses in vitro (32). However, little is known about the mechanisms exploited by SGIV to evade the cellular IFN response.

To identify the SGIV proteins involved in the evasion of the host IFN response, we performed a dual-luciferase reporter gene assay to screen the putative products of ORFs which can suppress poly(I:C)-induced IFN promoter activity, as described previously (39, 40). Among these candidates, VP131 is a novel viral protein present in fish iridoviruses that exerts significant inhibitory effects on the activation of the IFN promoter. To further clarify the roles of SGIV VP131 during SGIV infection, we firstly examined the effects of GFP-VP131 overexpression or knockdown on viral replication. Ectopic expression of GFP-VP131 promoted viral replication, while VP131 knockdown displayed the reverse effect, suggesting that VP131 was a crucial proviral factor during virus infection. Although several SGIV proteins have been demonstrated to facilitate viral replication, via regulation of apoptosis or cell proliferation (29, 41), we speculated that SGIV VP131 might function as a proviral factor via different mechanisms to manipulate host immune responses during virus infection.

In order to confirm our hypothesis, the mechanism of SGIV VP131 in virus replication was investigated. For most viruses, successful escape from immune defenses is a critical process leading to efficient viral replication (38). The common immune evasion strategy employed by viruses is to interfere with the IFN-mediated immune response. An increasing number of studies have proved that proteins from both DNA and RNA viruses suppress IFN production by targeting key components in the RLR or cGAS/STING signaling pathway, including MDA5, MAVS, STING, TBK1, IRF3, or NF-κB. For example, spring viremia of carp virus (SVCV) N protein inhibits IFN-φ1 production by promoting MAVS degradation (42), and SVCV P protein negatively regulates the IFN response by inhibiting TBK1 (43). HCMV protein US9 targets the MAVS and STING signaling pathways to evade type I IFN immune responses (17), while HCMV UL44 antagonizes antiviral immune responses by suppressing IRF3- and NF-κB-mediated transcription (44). Similarly, in this study, we found that GFP-VP131 overexpression inhibited IFN activation, including IFN-1 promoter activity and IFN-related gene expression evoked by poly(I:C), HA-EccGAS/HA-EcSTING, HA-EcSTING, Flag-EcTBK1, or HA-EcMDA5, but not HA-EcMAVS. Interestingly, VP131 colocalized and interacted with EcSTING and EcTBK1, but not EcMDA5. Moreover, the IG domain of VP131 was involved in its interaction with EcSTING, and the N-terminal transmembrane domain of EcSTING was essential for its interaction with VP131. Although VP131 suppressed EcMDA5 induced interferon immune response, EcMDA5 was not co-precipitated by VP131 in our study. Whether weak interaction existed between VP131 and EcMDA5 needed further investigation. Thus, we speculated that VP131 might target EcSTING and EcTBK1 to negatively regulate IFN responses.

STING, a key adaptor of the cGAS/STING signaling pathway, can be activated by cGAS upon binding of dsDNA and interacts with RIG-I, MAVS, and TBK1, leading to IRF3 activation and subsequent induction of type I IFN production to exert antiviral effects (45). Many viruses adopt different strategies to block STING- or TBK1-mediated IFN responses, including cleaving STING or TBK1, disrupting STING/TBK1 complex formation, inhibiting the kinase activity of TBK1, and disrupting the dimerization and translocation of STING (43, 46, 47). Our results showed that GFP-VP131 overexpression markedly reduced ectopic expression of EcSTING or EcTBK1 in a dose-dependent manner. Viral proteins have been reported to degrade target molecules through different degradation pathways, including the lysosomal pathway, the ubiquitin-proteasome system, and the autophagy pathway (35). For instance, grass carp reovirus (GCRV) VP35 and VP3 degrade MAVS through the autophagy pathway (48, 49). Zika virus (ZIKV) NS3- and NS2B3-mediated the degradation of MAVS and STING depend on the ubiquitin-proteasome pathway (50), while the DENV NS2B protease cofactor degrades cGAS in an autophagy-lysosome-dependent pathway (51). Here, our results showed that SGIV VP131 degraded EcSTING or EcTBK1 through both the autophagy-lysosome pathway and ubiquitin-proteasome pathway. It has been common accepted that K48-linked polyubiquitin chain modification leads to the proteasome degradation of target proteins, while K63-linked polyubiquitin chain modification leads to the activation (52, 53). Unexpectedly, VP131 induced the weak K48-ubiquitination of EcSTING, while degraded EcSTING that underwent K63-linked ubiquitination, consistent with the study that swine acute diarrhea syndrome CoV (SADS-CoV) N protein induced K48- and K63-mediated ubiquitination of RIG-I leading to its degradation (54). Taken together, SGIV VP131 drives the degradation of EcSTING-EcTBK1 pathway proteins, thereby inhibiting the IFN response. However, the specific mechanisms by which VP131 promotes degradation of EcSTING-EcTBK1 pathway proteins need further investigation.

Our previous study demonstrated that grouper STING and TBK1 positively regulate the IFN response and exert antiviral effects against fish viruses (36, 37). In addition, the above results show that VP131 interacted with EcSTING or EcTBK1 and promoted their degradation to block the IFN response. Thus, we speculated that VP131 could affect EcSTING- or EcTBK1-induced cellular antiviral action to promote fish virus infection. As expected, in EcSTING- or EcTBK1-overexpressing cells, RGNNV replication was significantly inhibited compared with control cells, whereas pGFP-VP131 co-transfection weakened these effects, suggesting that VP131 negatively regulates EcSTING and EcTBK1-mediated antiviral action. For fish RNA viruses, overexpression of GCRV VP41 also targets STING and facilitates viral RNA synthesis upon GCRV or SVCV infection (55). As an immune evasion gene, the knockout of SGIV VP131 may provide an effective attenuated vaccine against iridovirus disease in grouper aquaculture (56).

Studies have revealed that viral proteins can be phosphorylated or their cellular localization can be changed by host cellular proteins, regulating viral genome replication and transcription, or viral particle assembly and release (57). SVCV P protein is phosphorylated by TBK1, leading to a reduction of IRF3 phosphorylation and viral evasion from the host immune system (43). GCRV VP41 can be phosphorylated by TBK1 in cooperation with STING (55). HCV NS5A protein is phosphorylated by the host casein kinase II (CKII) to regulate virion assembly (57). In addition, varicella zoster virus (VZV) immediate early 63 (IE63) protein is transferred from the nucleus to the cytoplasm after phosphorylation by the host protein cyclin-dependent kinase 1 (CDK1) (58). Interestingly, we also found that EcSTING altered the subcellular localization of GFP-VP131 by accelerating the formation of VP131 aggregates, suggesting that the interaction between EcSTING and VP131 might conversely modulate the trafficking of VP131. However, the potential mechanism by which VP131 is manipulated by EcSTING requires further investigation.

In summary, we demonstrated, in this study, that SGIV VP131 degraded EcSTING to abrogate the IFN response through both the autophagy-lysosome pathway and ubiquitin-proteasome pathway in vitro (Fig. 10). To our knowledge, this report provided the first mechanistic insight in the immune evasion of SGIV mediated by viral proteins. Our findings not only contribute to our understanding of the mechanism of SGIV pathogenesis, but also shed light on the immune evasion tactics by fish iridoviruses.

FIG 10.

FIG 10

SGIV VP131 on EcSTING-mediated interferon signaling. Upon SGIV infection, EccGAS recognizes viral dsDNA, activates EcSTING, and recruits EcTBK1, thereby phosphorylating IRF3 to induce type I IFN production. Meanwhile, the SGIV-encoded VP131 negatively regulates the EcSTING-EcTBK1-mediated IFN response, interacts with EcSTING, and promotes EcSTING and EcTBK1 degradation through both the autophagy-lysosome pathway and ubiquitin-proteasome pathway to inhibit IFN expression and promote virus infection. SGIV, Singapore grouper iridovirus; dsDNA, double-stranded DNA; cGAS, cyclic GMP/AMP synthase; STING, stimulator of IFN genes; TBK1, TANK-binding kinase 1; MDA5, melanoma differentiation-associated gene 5; MAVS, mitochondrial antiviral signaling protein; IFN, interferon; IRF3, IFN regulatory factor 3; IRF7, IFN regulatory factor 7; IG, immunoglobulin; TM, transmembrane.

MATERIALS AND METHODS

Cells, virus, and reagents.

Grouper spleen (GS) and grouper brain (GB) cells were derived from the red-spotted grouper (E. akaara) spleen and brain, respectively, and were both grown in Leibovitz’s L15 medium supplemented with 10% fetal bovine serum (FBS; Gibco) at 28°C (59). SGIV and red-spotted grouper nervous necrosis virus (RGNNV) stocks were isolated in our laboratory and propagated in GS or GB cells, respectively (23, 60). Virus stocks were stored at −80°C until used.

Lyso-Tracker (Red DND-99) was obtained from Invitrogen. poly(I:C) and NH4Cl were purchased from Sigma-Aldrich and reconstituted in sterile water. MG132 and 3-MA were purchased from Selleck and dissolved in dimethyl sulfoxide (DMSO) or sterile water, respectively.

Plasmid construction.

The full-length SGIV ORF131R (GenBank accession no. YP_164226.1) was amplified by PCR from SGIV genomic DNA using the primers listed in Table 1. To clarify the function and subcellular localization of SGIV VP131, the ORF or IG domain of VP131 were subcloned into pEGFP-N3 (Clontech) to obtain the plasmids pGFP-VP131 or pGFP-VP131-IG. The ORFs or domains of E. coioides STING (EcSTING), EccGAS (GenBank accession no. KT313003.1), EcTBK1 (GenBank accession no. MF774017.1), EcMDA5 (GenBank accession no. HQ880665.1), and EcMAVS (GenBank accession no. MF774018.1) were inserted into the pcDNA3.1-3×HA (Clontech) to obtain the plasmids pHA-EcSTING, pHA-EcSTING-ΔC, pHA-EcSTING-ΔN, pHA-EccGAS, pHA-EcTBK1, pHA-EcMDA5, or pHA-EcMAVS, respectively. Besides, the plasmids pFlag-EcSTING or pDsRed2-EcSTING were generated by inserting the ORF of EcSTING into the pECMV-3×FLAG-C (Clontech) or pDsRed2-C1 (Clontech), respectively. The ORF of EcTBK1 was cloned into the pcDNA3.1-Flag (Clontech) to obtain the plasmid pFlag-EcTBK1 as described previously (36). All recombinant plasmids were confirmed by DNA sequencing. Primers are listed in Table 1. The pIFN-1-Luc plasmid was constructed using pGL3-Basic luciferase reporter vector (Promega). The plasmids including pHA-Ub, pHA-Ub-K48 (all lysine residues except Lys-48 are mutated) or pHA-Ub-K63 (all lysine residues except Lys-63 are mutated) were obtained from Miaoling bio.

TABLE 1.

Primers used in this study

Primer names Sequence (5′–3′)
GFP-VP131-KpnI-F CGGGGTACCATGATTTGGTTCATATTGTTGG
GFP-VP131-BamHI-R CGCGGATCCCACTACAAATGGAAAAGTTTCA
GFP-VP131-IG-XhoI-F CCGCTCGAGCTATGATTTGGTTCATATTGTTGG
GFP-VP131-IG-BamHI-R CGCGGATCCCGCGTCCGTAGTTACGTAGT
siRNA1-VP131 UGGACGGUACUACGGUCAAAGUGAA
siRNA2-VP131 GGCGGACAAAUUGUCUCAACCAGUU
siRNA3-VP131 CCGCCCUCAUUGUCUUCGUAUGUCU
HA-EcSTING-BamHI-F CGCGGATCCATGGAGTGCCTCCAAGAT
HA-EcSTING-XhoI-R CCGCTCGAGTTATATTCTTCCTTGATAATGGT
FLAG-EcSTING-KpnI-F CGGGGTACCGAATGGAGTGCCTCCAAGAT
FLAG-EcSTING-XhoI-R CCGCTCGAGTATTCTTCCTTGATAATGGTCG
HA-EcSTING-ΔC-HindIII-F tacgcatcagcggaaATGCAGTGCCTCCAAGATCAG
HA-EcSTING-ΔC-EcorI-R gatatctgcagaattTTACAGGACTCCCAGGCTTTTGAG
HA-EcSTING-ΔN-HindIII-F tacgcatcagcggaaATGGGTCCTTCGGAGGTGG
HA-EcSTING-ΔN-EcorI-R gatatctgcagaattTTATATTCTTCCTTGATAATGGTCGGTGCTC
DsRed-EcSTING-EcorI-F CCGGAATTCTATGGAGTGCCTCCAAGATC
DsRed-EcSTING-BamHI-R CGCGGATCCTATTCTTCCTTGATAATGGTCG
HA-EcTBK1-KpnI-F CGGGGTACCATGCAGAGCACCACCAACTA
HA-EcTBK1-XbaI-R TGCTCTAGATTAACCCCTCAGCCCTCC
HA-EcMDA5-KpnI-F CGGGGTACCATGTTAGCTGCAATGGCTTC
HA-EcMDA5-EcorI-R CCGGAATTCTCATTCAGCGTCATCCTCAT
HA-EcMAVS-KpnI-F CGGGGTACCATGTCATTCGTCAACGACC
HA-EcMAVS-XhoI-R CCGCTCGAGTTAATGCTTAAACCTCCATGC
Actin-RT-F TACGAGCTGCCTGACGGACA
Actin-RT-R GGCTGTGATCTCCTTCTGCA
SGIV-MCP-RT-F GCACGCTTCTCTCACCTTCA
SGIV-MCP-RT-R AACGGCAACGGGAGCACTA
SGIV-VP19-RT-F TCCAAGGGAGAAACTGTAAG
SGIV-VP19-RT-R GGGGTAAGCGTGAAGAC
SGIV-ICP18-RT-F ATCGGATCTACGTGGTTGG
SGIV-ICP18-RT-R CCGTCGTCGGTGTCTATTC
SGIV-LITAF-RT-F GATGCTGCCGTGTGAACTG
SGIV-LITAF-RT-R GCACATCCTTGGTGGTGTTG
EcIRF3-RT-F GACAACAAGAACGACCCTGCTAA
EcIRF3-RT-R GGGAGTCCGCTTGAAGATAGACA
EcIRF7-RT-F CAACACCGGATACAACCAAG
EcIRF7-RT-R GTTCTCAACTGCTACATAGGG
EcMxI-RT-F CGAAAGTACCGTGGACGAGAA
EcMxI-RT-R TGTTTGATCTGCTCCTTGACCAT
RGNNV-CP-RT-F CAACTGACAACGATCACACCTTC
RGNNV-CP-RT-R CAATCGAACACTCCAGCGACA

Subcellular localization.

To observe the subcellular localization of SGIV VP131, GS cells were seeded into glass bottom cell culture dishes (35 mm) and co-transfected with 0.5 μg pGFP-VP131 or pEGFP-N3 with 0.5 μg pDsRed2-ER, pDsRed2-Mito, or pDsRed2-Golgi (Clontech) for 48 h using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. In addition, GS cells were transfected for 48 h with 1.0 μg pGFP-VP131 or pEGFP-N3 and then stained with Lyso-Tracker (Red DND-99) (1:1,000; Invitrogen) for 30 min. After staining with 4,6-diamidino-2-phenylindole (DAPI) for 5 min, cells were observed under a confocal laser scanning microscope (CLSM; Carl Zeiss).

Virus infection assay.

For the overexpression assay, GS cells were transfected with pGFP-VP131 or pEGFP-N3 for 24 h and then infected with SGIV at a multiplicity of infection (MOI) of 2. Cell morphology was observed, and cells were photographed using a phase-contrast microscope at 24 h postinfection (hpi). Meanwhile, the infected cells were harvested at 12 and 24 hpi for reverse transcription-quantitative real-time PCR (RT-qPCR) analysis and immunoblotting (IB). In addition, the viral titers of SGIV-infected cell monolayers at 24 hpi were determined by the 50% tissue culture infective dose (TCID50) assay.

For the knockdown assay, 3 specific small interfering RNA (siRNA) oligonucleotides targeting different sequences of SGIV VP131 were designed using BLOCK-iT RNAi Designer (http://rnaidesigner.thermofisher.com/rnaiexpress/), and the specific sequences were listed in Table 1. siRNA of VP131 and Stealth RNAi Negative Control Medium GC Duplexes (siRNA-NC) were obtained from Invitrogen. The knockdown efficiency of siRNAs was determined by RT-qPCR and reverse transcription-PCR (RT-PCR). At 24 h posttransfection, GS cells transfected with siRNA (160 nM/well) or siRNA-NC were infected with SGIV (MOI = 2) and harvested at 12 and 24 hpi for RT-qPCR analysis, IB and TCID50 assays, respectively.

RNA isolation and RT-qPCR analysis.

Total RNA was extracted using the SV Total RNA isolation kit (Promega) and cDNA was synthesized using the ReverTra Ace qPCR RT Kit (TOYOBO). The transcript levels of host and viral genes were determined by RT-qPCR using the primers shown in Table 1 with an Applied Biosystems QuantStudio 5 Real Time Detection System (Thermofisher). RT-qPCR conditions were as follows: 95°C for 1 min, followed by 40 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 45 s. The relative fold change values were calculated with the 2−ΔΔCt method with β-actin as an internal control. Quantitative data were presented as mean ± standard deviation (SD). Each assay was carried out in triplicate, and visual data were shown from one representative experiment.

Dual-luciferase reporter assay.

GS cells were seeded into 48-well plates at 60–80% confluence and incubated overnight. 0.075 μg pIFN-1-Luc, 0.2 μg poly(I:C) or inducer expression plasmids, including pHA-EccGAS with pHA-EcSTING, pHA-EcMDA5, pHA-EcMAVS, pHA-EcSTING, or pFlag-EcTBK1, and 0.2 μg pGFP-VP131 or pEGFP-N3 were co-transfected into cells. At 48 h posttransfection, cells were harvested and lysed, and then luciferase assays were carried out using a Dual-Luciferase Reporter System (Promega) following the manufacturer’s manual. A total of 0.02 μg pRL-SV40 (Promega) was included to normalize luciferase activity. Each assay was carried out in triplicate. Data from one representative experiment were shown.

Indirect immunofluorescence assay.

To investigate whether VP131 is associated with key molecules of the cGAS/STING or RLR signaling pathway, including STING, TBK1, MDA5, and MAVS, GS cells were co-transfected with 0.5 μg pHA-EcSTING, pHA-EcSTING-ΔC, pHA-EcSTING-ΔN, pHA-EcTBK1, pHA-EcMDA5, or pHA-EcMAVS, and 0.5 μg pGFP-VP131 or pGFP-VP131-IG for the indirect immunofluorescence assay (IFA), as previously described (61). Briefly, at 48 h posttransfection, GS cells were fixed, permeabilized, and blocked with 0.2% bovine serum albumin (BSA) (Sigma). Then, cells were incubated with primary antibody (Ab) against HA (1:200; Sigma) diluted in 0.2% BSA at room temperature for 2 h. After washing three times with phosphate-buffered saline (PBS), Alexa Fluor 555-conjugated anti-mouse IgG Fab2 (1:200; Cell signaling) was added at room temperature for another 2 h. Finally, the cells were stained with DAPI and observed under CLSM.

Co-immunoprecipitation assay.

For the co-immunoprecipitation (Co-IP) assay, GS cells were seeded into 10-cm2 dishes overnight and co-transfected with 12 μg pHA-EcSTING, pHA-EcSTING-ΔC, pHA-EcSTING-ΔN, pHA-EcTBK1, pHA-EcMDA5, or pHA-EcMAVS, and 12 μg pGFP-VP131, pEGFP-VP131-IG or pEGFP-N3. At 48 h posttransfection, the medium was removed carefully, and the cell monolayers were washed twice with ice-cold PBS. Then, cells were lysed by Pierce IP lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 5% glycerol). The whole-cell lysates (WCLs) were subjected to centrifugation at 12,000 g for 3 min at 4°C, and the supernatants were collected for immunoprecipitation using the Dynabeads Protein G Immunoprecipitation Kit (Thermofisher) with anti-GFP, EZview Red Anti-HA Affinity Gel (Sigma) or Red Anti-Flag M2 Affinity Gel (Sigma). These immunoprecipitated proteins and WCLs were further analyzed by IB with the indicated Abs (52, 62).

Immunoblotting analysis.

The extracted proteins were separated by 10% SDS-PAGE and transferred to 0.22-μm polyvinylidene difluoride (PVDF) membranes (Millipore). The membranes were blocked with 5% (wt/vol) skim milk in PBS containing 0.5% Tween 20 (PBST), and incubated with the primary Abs, including anti-GFP (1:1,000; Abcam), anti-HA (1:1,000; Sigma), anti-Flag (1:1,000; Sigma), anti-SGIV major capsid protein (MCP) (1:2,000; prepared in our lab), anti-RGNNV capsid protein (CP) (1:2,000; prepared in our lab), or anti-β-tubulin (1:2,000; Abcam) for 2 h. After washing three times with PBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated sheep anti-rabbit IgG or sheep anti-mouse IgG (1:3,000; Abcam) for another 2 h at room temperature. Then, the membranes were washed three times with PBST, and were stained using Pierce ECL Western Blotting Substrate (Thermofisher). The intensity of each protein band was quantified using ImageJ software and normalized to the expression of β-tubulin. Results were representative of three independent experiments.

In vitro protein degradation assay.

GS cells were seeded in 12-well plates and transiently transfected with 1 μg adaptors plasmid, including pHA-EcSTING, or pHA-EcTBK1, and 1 μg pGFP-VP131 or pEGFP-N3. At 48 h posttransfection, cells were lysed with Pierce RIPA lysis buffer, and the WCLs were analyzed by IB analysis with anti-GFP (1:1,000), anti-HA (1:1,000), or anti-β-tubulin (1:2,000). Furthermore, GS cells were co-transfected with pHA-EcSTING or pHA-EcTBK1 and pGFP-VP131 or pEGFP-N3 for 24 h and treated with the DMSO, MG132 (10 μM) (a ubiquitin-proteasome inhibitor), 3-MA (2 mM) (an autophagy inhibitor), or NH4Cl (20 mM) (a lysosome inhibitor) for 6 h prior to be harvested for IB analysis.

In vitro ubiquitination assay.

GS cells were seeded into 10-cm2 dishes overnight and transiently co-transfected with 10 μg pFlag-EcSTING, 10 μg pGFP-VP131 and 2.5 μg pHA-Ub, pHA-Ub-K48, or pHA-Ub-K63. At 18 h posttransfection, GS cells were treated with 10 μM MG132 or DMSO for 6 h. After washing twice with cold PBS, GS cells were harvested with the help of a cell scraper. Then, the collected cell precipitations resuspended in 1% SDS were boiled for 10 min, and diluted 10 times in Pierce IP lysis buffer. The lysed proteins were immunoprecipitated with 30 μL anti-Flag agarose conjugate (Sigma-Aldrich) overnight at 4°C with constant agitation. After washing three times with lysis buffer (Beyotime), the immunoprecipitated protein were resuspended in 1 × SDS sample buffer for IB analysis with indicated Abs.

Statistical analysis.

Statistics were carried out using SPSS version 20 by one-way analysis of variance (ANOVA). Differences were considered statistically significant when P was <0.05 (*).

ACKNOWLEDGMENTS

We thank Huali Li (Instrumental Analysis & Research Center, South China Agricultural University) for assistance with confocal microscopy analysis.

We have no financial conflicts of interest.

This work was supported by grants from the National Natural Science Foundation of China (31972837), the National Key R&D Program of China (2018YFD0900500), GuangDong Basic and Applied Basic Research Foundation (2021A1515110327), the China Postdoctoral Science Foundation (2021M691076), and the China Agriculture Research System of MOF and MARA (CARS-47-G16).

Contributor Information

Qiwei Qin, Email: qinqw@scau.edu.cn.

Youhua Huang, Email: huangyh@scau.edu.cn.

Felicia Goodrum, University of Arizona.

REFERENCES

  • 1.Stark GR. 2007. How cells respond to interferons revisited: from early history to current complexity. Cytokine Growth Factor Rev 18:419–423. 10.1016/j.cytogfr.2007.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Xia P, Wang S, Gao P, Gao G, Fan Z. 2016. DNA sensor cGAS-mediated immune recognition. Protein Cell 7:777–791. 10.1007/s13238-016-0320-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kato K, Omura H, Ishitani R, Nureki O. 2017. Cyclic GMP-AMP as an endogenous second messenger in innate immune signaling by cytosolic DNA. Annu Rev Biochem 86:541–566. 10.1146/annurev-biochem-061516-044813. [DOI] [PubMed] [Google Scholar]
  • 4.Ishikawa H, Ma Z, Barber GN. 2009. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461:788–792. 10.1038/nature08476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ran Y, Shu HB, Wang YY. 2014. MITA/STING: a central and multifaceted mediator in innate immune response. Cytokine Growth Factor Rev 25:631–639. 10.1016/j.cytogfr.2014.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, Taira K, Akira S, Fujita T. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5:730–737. 10.1038/ni1087. [DOI] [PubMed] [Google Scholar]
  • 7.Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K, Foy E, Loo YM, Gale M, Jr, Akira S, Yonehara S, Kato A, Fujita T. 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175:2851–2858. 10.4049/jimmunol.175.5.2851. [DOI] [PubMed] [Google Scholar]
  • 8.Hiscott J, Lin R, Nakhaei P, Paz S. 2006. MasterCARD: a priceless link to innate immunity. Trends Mol Med 12:53–56. 10.1016/j.molmed.2005.12.003. [DOI] [PubMed] [Google Scholar]
  • 9.Beachboard DC, Horner SM. 2016. Innate immune evasion strategies of DNA and RNA viruses. Curr Opin Microbiol 32:113–119. 10.1016/j.mib.2016.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Goubau D, Deddouche S, Reis e Sousa C. 2013. Cytosolic sensing of viruses. Immunity 38:855–869. 10.1016/j.immuni.2013.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zheng C. 2018. Evasion of cytosolic DNA-stimulated innate immune responses by herpes simplex virus 1. J Virol 92:e00099-17. 10.1128/JVI.00099-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kikkert M. 2020. Innate immune evasion by human respiratory RNA viruses. J Innate Immun 12:4–20. 10.1159/000503030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dalrymple NA, Cimica V, Mackow ER. 2015. Dengue virus NS proteins inhibit RIG-I/MAVS signaling by blocking TBK1/IRF3 phosphorylation: dengue virus serotype 1 NS4A is a unique interferon-regulating virulence determinant. mBio 6:e00553-15. 10.1128/mBio.00553-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ding Q, Cao X, Lu J, Huang B, Liu YJ, Kato N, Shu HB, Zhong J. 2013. Hepatitis C virus NS4B blocks the interaction of STING and TBK1 to evade host innate immunity. J Hepatol 59:52–58. 10.1016/j.jhep.2013.03.019. [DOI] [PubMed] [Google Scholar]
  • 15.Li XD, Sun L, Seth RB, Pineda G, Chen ZJ. 2005. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc Natl Acad Sci USA 102:17717–17722. 10.1073/pnas.0508531102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wei C, Ni C, Song T, Liu Y, Yang X, Zheng Z, Jia Y, Yuan Y, Guan K, Xu Y, Cheng X, Zhang Y, Yang X, Wang Y, Wen C, Wu Q, Shi W, Zhong H. 2010. The hepatitis B virus X protein disrupts innate immunity by downregulating mitochondrial antiviral signaling protein. J Immunol 185:1158–1168. 10.4049/jimmunol.0903874. [DOI] [PubMed] [Google Scholar]
  • 17.Choi HJ, Park A, Kang S, Lee E, Lee TA, Ra EA, Lee J, Lee S, Park B. 2018. Human cytomegalovirus-encoded US9 targets MAVS and STING signaling to evade type I interferon immune responses. Nat Commun 9:125. 10.1038/s41467-017-02624-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Huang J, You H, Su C, Li Y, Chen S, Zheng C. 2018. Herpes simplex virus 1 tegument protein VP22 abrogates cGAS/STING-mediated antiviral innate immunity. J Virol 92:e00841-18. 10.1128/JVI.00841-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Su C, Zheng C. 2017. Herpes simplex virus 1 abrogates the cGAS/STING-mediated cytosolic DNA-sensing pathway via its virion host shutoff protein, UL41. J Virol 91:e02414-16. 10.1128/JVI.02414-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chinchar VG, Hick P, Ince IA, Jancovich JK, Marschang R, Qin Q, Subramaniam K, Waltzek TB, Whittington R, Williams T, Zhang QY, Ictv RC. 2017. ICTV virus taxonomy profile: iridoviridae. J Gen Virol 98:890–891. 10.1099/jgv.0.000818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Qiu L, Chen MM, Wang RY, Wan XY, Li C, Zhang QL, Dong X, Yang B, Xiang JH, Huang J. 2018. Complete genome sequence of shrimp hemocyte iridescent virus (SHIV) isolated from white leg shrimp, Litopenaeus vannamei. Arch Virol 163:781–785. 10.1007/s00705-017-3642-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Daszak P, Berger L, Cunningham AA, Hyatt AD, Green DE, Speare R. 1999. Emerging infectious diseases and amphibian population declines. Emerg Infect Dis 5:735–748. 10.3201/eid0506.990601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Qin QW, Chang SF, Ngoh-Lim GH, Gibson-Kueh S, Shi C, Lam TJ. 2003. Characterization of a novel ranavirus isolated from grouper Epinephelus tauvina. Dis Aquat Organ 53:1–9. 10.3354/dao053001. [DOI] [PubMed] [Google Scholar]
  • 24.Qin QW, Lam TJ, Sin YM, Shen H, Chang SF, Ngoh GH, Chen CL. 2001. Electron microscopic observations of a marine fish iridovirus isolated from brown-spotted grouper, Epinephelus tauvina. J Virol Methods 98:17–24. 10.1016/s0166-0934(01)00350-0. [DOI] [PubMed] [Google Scholar]
  • 25.Walker PJ, Winton JR. 2010. Emerging viral diseases of fish and shrimp. Vet Res 41:51. 10.1051/vetres/2010022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Song WJ, Qin QW, Qiu J, Huang CH, Wang F, Hew CL. 2004. Functional genomics analysis of Singapore grouper iridovirus: complete sequence determination and proteomic analysis. J Virol 78:12576–12590. 10.1128/JVI.78.22.12576-12590.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Teng Y, Hou Z, Gong J, Liu H, Xie X, Zhang L, Chen X, Qin QW. 2008. Whole-genome transcriptional profiles of a novel marine fish iridovirus, Singapore grouper iridovirus (SGIV) in virus-infected grouper spleen cell cultures and in orange-spotted grouper, Epinephulus coioides. Virology 377:39–48. 10.1016/j.virol.2008.04.011. [DOI] [PubMed] [Google Scholar]
  • 28.Xia L, Cao J, Huang X, Qin Q. 2009. Characterization of Singapore grouper iridovirus (SGIV) ORF086R, a putative homolog of ICP18 involved in cell growth control and virus replication. Arch Virol 154:1409–1416. 10.1007/s00705-009-0457-y. [DOI] [PubMed] [Google Scholar]
  • 29.Yu Y, Huang Y, Ni S, Zhou L, Liu J, Zhang J, Zhang X, Hu Y, Huang X, Qin Q. 2017. Singapore grouper iridovirus (SGIV) TNFR homolog VP51 functions as a virulence factor via modulating host inflammation response. Virology 511:280–289. 10.1016/j.virol.2017.06.025. [DOI] [PubMed] [Google Scholar]
  • 30.Huang X, Huang Y, Gong J, Yan Y, Qin Q. 2008. Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) homolog from Singapore grouper iridovirus. Biochem Biophys Res Commun 373:140–145. 10.1016/j.bbrc.2008.06.003. [DOI] [PubMed] [Google Scholar]
  • 31.Yuan Y, Wang Y, Liu Q, Zhu F, Hong Y. 2016. Singapore grouper iridovirus protein VP088 is essential for viral infectivity. Sci Rep 6:31170. 10.1038/srep31170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Huang X, Huang Y, Cai J, Wei S, Ouyang Z, Qin Q. 2013. Molecular cloning, expression and functional analysis of ISG15 in orange-spotted grouper, Epinephelus coioides. Fish Shellfish Immunol 34:1094–1102. 10.1016/j.fsi.2013.01.010. [DOI] [PubMed] [Google Scholar]
  • 33.Yao D, Liu Y, Chen X, Lim TK, Wang L, Aweya JJ, Zhang Y, Lin Q. 2019. In-depth proteomic profiling of the Singapore grouper iridovirus virion. Arch Virol 164:1889–1895. 10.1007/s00705-019-04264-3. [DOI] [PubMed] [Google Scholar]
  • 34.Sun L, Wu J, Du F, Chen X, Chen ZJ. 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339:786–791. 10.1126/science.1232458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wang Y, Le WD. 2019. Autophagy and ubiquitin-proteasome system. Adv Exp Med Biol 1206:527–550. 10.1007/978-981-15-0602-4_25. [DOI] [PubMed] [Google Scholar]
  • 36.Hu Y, Huang Y, Liu J, Zhang J, Qin Q, Huang X. 2018. TBK1 from orange-spotted grouper exerts antiviral activity against fish viruses and regulates interferon response. Fish Shellfish Immunol 73:92–99. 10.1016/j.fsi.2017.12.010. [DOI] [PubMed] [Google Scholar]
  • 37.Huang Y, Ouyang Z, Wang W, Yu Y, Li P, Zhou S, Wei S, Wei J, Huang X, Qin Q. 2015. Antiviral role of grouper STING against iridovirus infection. Fish Shellfish Immunol 47:157–167. 10.1016/j.fsi.2015.09.014. [DOI] [PubMed] [Google Scholar]
  • 38.Ke F, Zhang QY. 2019. Aquatic animal viruses mediated immune evasion in their host. Fish Shellfish Immunol 86:1096–1105. 10.1016/j.fsi.2018.12.027. [DOI] [PubMed] [Google Scholar]
  • 39.Sathish N, Yuan Y. 2011. Evasion and subversion of interferon-mediated antiviral immunity by Kaposi's sarcoma-associated herpesvirus: an overview. J Virol 85:10934–10944. 10.1128/JVI.00687-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Shen G, Wang K, Wang S, Cai M, Li ML, Zheng C. 2014. Herpes simplex virus 1 counteracts viperin via its virion host shutoff protein UL41. J Virol 88:12163–12166. 10.1128/JVI.01380-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yan Y, Cui H, Guo C, Wei J, Huang Y, Li L, Qin Q. 2014. Singapore grouper iridovirus-encoded semaphorin homologue (SGIV-sema) contributes to viral replication, cytoskeleton reorganization and inhibition of cellular immune responses. J Gen Virol 95:1144–1155. 10.1099/vir.0.060608-0. [DOI] [PubMed] [Google Scholar]
  • 42.Lu L-F, Li S, Lu X-B, LaPatra SE, Zhang N, Zhang X-J, Chen D-D, Nie P, Zhang Y-A. 2016. Spring viremia of carp virus N protein suppresses fish IFNφ1 production by targeting the mitochondrial antiviral signaling protein. J Immunol 196:3744–3753. 10.4049/jimmunol.1502038. [DOI] [PubMed] [Google Scholar]
  • 43.Li S, Lu LF, Wang ZX, Lu XB, Chen DD, Nie P, Zhang YA. 2016. The P protein of Spring viremia of carp virus negatively regulates the fish interferon response by inhibiting the kinase activity of TANK-binding kinase 1. J Virol 90:10728–10737. 10.1128/JVI.01381-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Fu Y-Z, Su S, Zou H-M, Guo Y, Wang S-Y, Li S, Luo M-H, Wang Y-Y. 2019. Human cytomegalovirus DNA polymerase subunit UL44 antagonizes antiviral immune responses by suppressing IRF3- and NF-κB-mediated transcription. J Virol 93:e00181-19. 10.1128/JVI.00181-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ishikawa H, Barber GN. 2008. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455:674–678. 10.1038/nature07317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Aguirre S, Maestre AM, Pagni S, Patel JR, Savage T, Gutman D, Maringer K, Bernal-Rubio D, Shabman RS, Simon V, Rodriguez-Madoz JR, Mulder LC, Barber GN, Fernandez-Sesma A. 2012. DENV inhibits type I IFN production in infected cells by cleaving human STING. PLoS Pathog 8:e1002934. 10.1371/journal.ppat.1002934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Zou H-M, Huang Z-F, Yang Y, Luo W-W, Wang S-Y, Luo M-H, Fu Y-Z, Wang Y-Y. 2020. Human cytomegalovirus protein UL94 targets MITA to evade the antiviral immune Response. J Virol 94:e00022-20. 10.1128/JVI.00022-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Lu LF, Zhang C, Li ZC, Zhou XY, Jiang JY, Chen D, Zhang YA, Li S. 2021. Grass carp reovirus VP35 degrades MAVS through the autophagy pathway to inhibit fish interferon production. Front Immunol 12:613145. 10.3389/fimmu.2021.613145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Lu LF, Li ZC, Zhang C, Zhou XY, Zhou Y, Jiang JY, Chen DD, Li S, Zhang YA. 2020. Grass carp reovirus (GCRV) giving its all to suppress IFN production by countering MAVS signaling transduction. Front Immunol 11:545302. 10.3389/fimmu.2020.545302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Li W, Li N, Dai S, Hou G, Guo K, Chen X, Yi C, Liu W, Deng F, Wu Y, Cao X. 2019. Zika virus circumvents host innate immunity by targeting the adaptor proteins MAVS and MITA. FASEB J 33:9929–9944. 10.1096/fj.201900260R. [DOI] [PubMed] [Google Scholar]
  • 51.Aguirre S, Luthra P, Sanchez-Aparicio MT, Maestre AM, Patel J, Lamothe F, Fredericks AC, Tripathi S, Zhu T, Pintado-Silva J, Webb LG, Bernal-Rubio D, Solovyov A, Greenbaum B, Simon V, Basler CF, Mulder LC, García-Sastre A, Fernandez-Sesma A. 2017. Dengue virus NS2B protein targets cGAS for degradation and prevents mitochondrial DNA sensing during infection. Nat Microbiol 2:17037. 10.1038/nmicrobiol.2017.37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Lu LF, Zhang C, Li ZC, Zhou XY, Jiang JY, Chen DD, Zhang YA, Xiong F, Zhou F, Li S. 2021. A novel role of Zebrafish TMEM33 in negative regulation of interferon production by two distinct mechanisms. PLoS Pathog 17:e1009317. 10.1371/journal.ppat.1009317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Zhong B, Zhang L, Lei C, Li Y, Mao AP, Yang Y, Wang YY, Zhang XL, Shu HB. 2009. The ubiquitin ligase RNF5 regulates antiviral responses by mediating degradation of the adaptor protein MITA. Immunity 30:397–407. 10.1016/j.immuni.2009.01.008. [DOI] [PubMed] [Google Scholar]
  • 54.Liu Y, Liang QZ, Lu W, Yang YL, Chen R, Huang YW, Wang B. 2021. A comparative analysis of coronavirus nucleocapsid (N) proteins reveals the SADS-CoV N protein antagonizes IFN-β production by inducing ubiquitination of RIG-I. Front Immunol 12:688758. 10.3389/fimmu.2021.688758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Lu LF, Li S, Wang ZX, Du SQ, Chen DD, Nie P, Zhang YA. 2017. Grass carp reovirus VP41 targets fish MITA to abrogate the interferon response. J Virol 91:e00390-17. 10.1128/JVI.00390-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Brar G, Farhat NA, Sukhina A, Lam AK, Kim YH, Hsu T, Tong L, Lin WW, Ware CF, Blackman MA, Sun R, Wu TT. 2020. Deletion of immune evasion genes provides an effective vaccine design for tumor-associated herpesviruses. NPJ Vaccines 5:102. 10.1038/s41541-020-00251-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Tellinghuisen TL, Foss KL, Treadaway J. 2008. Regulation of hepatitis C virion production via phosphorylation of the NS5A protein. PLoS Pathog 4:e1000032. 10.1371/journal.ppat.1000032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Habran L, Bontems S, Di Valentin E, Sadzot-Delvaux C, Piette J. 2005. Varicella-zoster virus IE63 protein phosphorylation by roscovitine-sensitive cyclin-dependent kinases modulates its cellular localization and activity. J Biol Chem 280:29135–29143. 10.1074/jbc.M503312200. [DOI] [PubMed] [Google Scholar]
  • 59.Huang X, Huang Y, Sun J, Han X, Qin Q. 2009. Characterization of two grouper Epinephelus akaara cell lines: application to studies of Singapore grouper iridovirus (SGIV) propagation and virus-host interaction. Aquaculture 292:172–179. 10.1016/j.aquaculture.2009.04.019. [DOI] [Google Scholar]
  • 60.Hegde A, Chen CL, Qin QW, Lam TJ, Sin YM. 2002. Characterization, pathogenicity and neutralization studies of a nervous necrosis virus isolated from grouper, Epinephelus tauvina, in Singapore - ScienceDirect. Aquaculture 213:55–72. 10.1016/S0044-8486(02)00092-3. [DOI] [Google Scholar]
  • 61.Zhang Y, Wang L, Zheng J, Huang L, Wang S, Huang X, Qin Q, Huang Y. 2021. Grouper interferon-induced transmembrane protein 1 inhibits iridovirus and nodavirus replication by regulating virus entry and host lipid metabolism. Front Immunol 12:636806. 10.3389/fimmu.2021.636806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Li C, Wang L, Liu J, Yu Y, Huang Y, Huang X, Wei J, Qin Q. 2020. Singapore grouper iridovirus (SGIV) inhibited autophagy for efficient viral replication. Front Microbiol 11:1446. 10.3389/fmicb.2020.01446. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES