Skip to main content
Clinical and Diagnostic Laboratory Immunology logoLink to Clinical and Diagnostic Laboratory Immunology
. 2001 Jan;8(1):129–132. doi: 10.1128/CDLI.8.1.129-132.2001

Genomic Characterization of Porcine Rotaviruses in Italy

Vito Martella 1,*, Annamaria Pratelli 1, Grazia Greco 1, Maria Tempesta 1, Maura Ferrari 2, Marina Nadia Losio 2, Canio Buonavoglia 1
PMCID: PMC96021  PMID: 11139206

Abstract

A total of 23 rotavirus strains isolated from pigs were analyzed. Twenty strains had been isolated from diarrheic piglets from an outbreak that occurred in northern Italy in 1983. Three strains had been isolated in 1984 from swine herds located in distinct areas of northern Italy. All 23 strains were characterized as type G6P[5] by PCR. The isolation from piglets of rotaviruses displaying typical bovine G- and P-type specificities points out the high frequency of rotavirus transmission between cattle and pigs.


Group A rotaviruses are a major cause of acute gastroenteritis in a variety of mammalian and avian species. They belong to the Reoviridae family and possess a genome consisting of 11 segments of double-stranded RNA (dsRNA) enclosed in a triple-layered capsid. The outer layer is composed of two proteins, VP7 and VP4, that elicit neutralizing antibody responses and that form the basis of the current dual classification system in G (VP7) and P (VP4) types 5, 6.

There are at least 14 different G types, distinguishable on the basis of both serological and genomic techniques, with a substantial correlation between G serotypes and genotypes. Since the VP4 protein carries the minor neutralizing antigen, the serological distinction of the P types is much more difficult than the classification based on genomic analysis. To date, at least 10 P serotypes and 20 different P genotypes have been described. Nevertheless, there is not a complete correlation between P serotypes and genotypes, so that a different designation has been adopted (open numbers for P serotypes, numbers in brackets for P genotypes) 5.

The main G types previously identified in pigs are G3 (CRW-8 type), G4 (Gott fried type), G5 (OSU type), and G11 (YM type) 5, although human types G1, G2, and G9 1, 4, 22, 24 and bovine types G6, G8, and G10 have also been described 14, 19, 22. The most common P types of pigs are P2B[6] and P9[7], which are Gottfried- and OSU-like types, respectively. However, other porcine P genotypes, P[14] (MDR13 type) and P[19] (4F type), have been recognized 2, 5, 14, 16, 27. Furthermore, typical human P genotypes P[8] and P[6] (M37-like type) 22, 24 and bovine P genotypes P[1], P[5], and P[11] have also been detected 13, 19. Nevertheless, data are fragmentary because of the limited number of viruses examined, the noncontemporaneous characterization of both viral outer proteins, and, finally, the typing methods used.

In this study, the characterization of several rotavirus strains isolated in northern Italy from piglets with diarrhea is reported.

MATERIALS AND METHODS

Viruses.

The outbreak occurred in 1983 in a herd of 250 sows with 20 litters. Signs of severe enteritis were observed in 12- to 30-day-old suckling pigs from six litters, with mortality rates ranging from 5 to 8%. A total of 20 rotavirus strains were isolated on MA-104 (monkey kidney) cells from fecal samples of diarrheic animals 8. In addition to the 20 strains isolated in the outbreak described above, three strains isolated from swine herds from different geographic areas of northern Italy (strains 84/52F, 84/106F, and 84/158F) 8 were also analyzed. All the viruses were cultured on MA-104 cells with the addition of 5 μg of trypsin per ml to the maintenance medium, and viral growth was monitored by observation of a cytopathic effect and by indirect immunofluorescence with a rabbit antiserum to rotavirus. The following viruses were used as reference strains: porcine rotaviruses Gottfried, G4P2B[6], and OSU, G5P9[7], and human strain YO, which is type G3P1A[8]. Furthermore, bovine rotaviruses RV157/99-8224, RV13/95, and RV157/99-716, previously characterized as G6P6[1], G8P7[5], and G10P8[11], respectively, were used as controls.

RNA extraction.

For RNA extraction, cell culture-adapted viruses were used at the third passage. The genomic dsRNA of each isolate was extracted from the infected MA-104 cells showing a 50% cytopathic effect with the Rneasy kit (Qiagen GmbH, Hilden, Germany). The RNA extracted was resuspended in RNase-free water and was stored at −80°C.

G-type determination.

The G typing consisted of three steps, as described by Gouvea et al. 12, 14, with some modifications. The reverse transcription (RT) and the first PCR amplification were performed with the GeneAmp RNA PCR Core kit (Perkin-Elmer Europe B. V. Monza). Briefly, 2 μl of viral dsRNA was denatured with 1.4 μl of dimethyl sulfoxide (97°C for 5 min) and was immediately cooled on ice. The denatured RNA (2 μl) was added to 18 μl of an RT mixture containing 1× PCR buffer II (KCl, 50 mM; Tris-HCl, 10 mM [pH 8.3]), MgCl2 (2.5 mM), deoxynucleoside triphosphates (700 μM), 1 U of RNase inhibitor, 2.5 U of murine leukemia virus reverse transcriptase, and each of the primers (Beg9 and End9) at a concentration of 50 nM. After synthesis of cDNA (42°C for 45 min, 99°C for 5 min), the mixture was brought up to a volume of 100 μl by addition of PCR reagents and distilled H2O to obtain the following mixture: 1× PCR buffer II (KCl, 50 mM; Tris-HCl, 10 mM [pH 8.3]), MgCl2 (1.5 mM), (150 μM), both of the primers (primers Beg9 and End9) at a concentration of 50 nM each, and 2.5 U of DNA polymerase. The PCR mixture was subjected to 25 cycles at 94°C for 1 min, 42°C for 2 min, and 72°C for 1 min. Two microliters of the product of the first PCR, diluted 1:100 in distilled H2O, was used as the template for the second PCR amplification in a 100-μl mixture containing 1× PCR buffer II (KCl, 50 mM; Tris-HCl, 10 mM [pH 8.3]), MgCl2 (1.5 mM), dNTPs (200 μM), 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer Europe B. V. Monza), and each of the primers at a concentration of 50 nM. For the G-type characterization, two sets of second PCR amplifications were performed separately with different pools of type-specific primers: primer sEnd9 (antisense) with a pool of primers specific for the G1, G2, G3, G4, and G9 (sense) serotypes and primer sBeg9 (sense) with a pool of primers specific for the G5, G6, G8, G10, and G11 (antisense) serotypes. The mixtures were subjected to 10 min of incubation at 94°C for activation of the DNA polymerase and 25 cycles of 94°C for 1 min, 55°C for 2 min, and 72°C for 1 min. The PCR products were analyzed on a 1.5% TBE (Tris-borate-EDTA [pH 8]) agarose gel and were stained with ethidium bromide, and the G serotype was determined on the basis of the size of the amplicons, as described previously by Gouvea et al. 12, 14. In order to confirm the results, the strains were also characterized by a PCR strategy analogous to the one described by Isegawa et al. 17 with primer pair Bov9Com5-Bov9Com3 for RT (48°C for 45 min, 99°C for 5 min) and amplification of the nearly full-length VP7 gene (94°C for 1 min, 45°C for 2 min, and 72°C for 3 min for 25 cycles). A primer pool, including primer Bov9Com5 and two primers specific for the G6 and G10 serotypes, was used in the second PCR amplification (94°C for 1 min, 50°C for 2 min, and 72°C for 3 min for 25 cycles). The sequences of all the primers used are reported in Table 1.

TABLE 1.

Primers used for G- and P-type characterization

Assay and primer Sequence (5′→3′) Sense Positiong
G typing
 Beg9a GGCTTTAAAAGAGAGAATTTCCGTCTGG + 1–28
 sBeg9b GGCTTTAAAAGAGAGAATTTC + 1–21
 End9a GGTCACATCATACAATTCTAATCTAAG − 1062–1036
 sEnd9 (RVG9)a GGTCACATCATACAATTC − 1062–1045
 G1 (aBT1)a CAAGTACTCAAATCAATGATGG + 314–335
 G2(aCT2)a CAATGATATTAACACATTTTCTGTG + 411–435
 G3(aET3)a CGTTTGAAGAAGTTGCAACAG + 689–709
 G4(aDT4)a CGTTTCTGGTGAGGAGTTG + 480–498
 G9 (aFT9)a CTAGATGTAACTACAACTAC + 757–776
 G5(FT5)b CACGTACTCGTTGTTACGTC − 779–760
 G6(DT6)b CTAGTTCCTGTGTAGAATC − 499–481
 G8 (HT8)b CGGTTCCGGATTAGACAC − 273–256
 G10(ET10)b TTCAGCCGTTGCGACTTC − 714–697
 G11 (BT11)b GTCATCAGCAATCTGAGTTGC − 336–316
 Bov9Com3c TCACATCATACAACTCTAATCT − 1038–1060
 Bov9Com5c TGTATGGTATTGAATATACCA + 50–71
 G6c GGTATCAGCTATTTCGTTTGAT − 336–315
 G10c AACGTTCTAGTATTTGTGGTCT − 692–671
P typing
 Con2d ATTTCGGACCATTTATAACC − 887–868
 Con3d TGGCTTCGCTCATTTATAGACA + 11–32
 P1 (pNCDV)e CGAACGCGGGGGTGGTAGTTG + 269–289
 P5 (pUK)e GCCAGGTGTCGCATCAGAG + 336–354
 P11 (pB223)e GGAACGTATTCTAATCCGGTG + 574–594
 P6 (pGott)e GCTTCAACGTCCTTTAACATCAG + 465–487
 P7 (pOSU)e CTTTATCGGTGGAGAATACGTCAC + 389–412
 Bov4Com5f TTCTTATTGGGACGATTCACA + 1067–1088
 Bov4Com3f CAACCGCAGCTGATATATCATC − 1930–1909
 P1f TTAAATTCATCTCTTAGTTCTC − 1526–1505
 P5f GGCCGCATCGGATAAAGAGTCC − 1725–1704
 P11f TGCCTCATAATATTGTTGGTCT − 1398–1377
a

Data from Gouvea et al. 12. 

b

Data from Gouvea et al. 14. 

c

Data from Isegawa et al. 17. 

d

Data from Gentsch et al. 10. 

e

Data from Gouvea et al. 13. 

f

Data from Isegawa et al. 17. 

g

Primer locations are indicated as originally reported in the corresponding reports. 

P-type determination.

Characterization of the VP4 protein consisted of three steps, following the original typing strategy described by Gentsch at al. 10 and Gouvea et al. 13. The P-typing assay was performed by adopting the same protocols followed for the characterization of the G types, with minor modifications. The RT (42°C for 45 min, 99°C for 5 min) and the first PCR amplification (94°C for 1 min, 42°C for 2 min, and 72°C for 1 min for 25 cycles) were performed with the primer pair Con2-Con3. The second PCR amplification (94°C for 1 min, 55°C for 2 min, and 72°C for 1 min for 25 cycles) was carried out with primer Con2 and a pool of primers specific for the P genotypes P[6] (Gottfried-like type), P[7], P[1], P[5], and P[11]. The P-type characterization was also carried out by a PCR strategy analogous to the one described by Isegawa et al. 17 by using the primer pair Bov4Com5-Bov4Com3 for RT (48°C for 45 min, 99°C for 5 min) and the first amplification (94°C for 1 min, 45°C for 2 min, and 72°C for 3 min for 25 cycles) and primer Bov4Com5 with a pool of primers specific for the P[1], P[5], and P[11] genotypes in the second PCR amplification (94°C for 1 min, 50°C for 2 min, and 72°C for 3 min for 25 cycles). The sequences of all the primers used for the VP4 characterization are reported in Table 1.

Sequence analysis.

In order to confirm the results obtained by PCR, three strains (strains 83/15F, 83/16F, and 84/52F) were further characterized by means of direct sequencing. After purification on Ultrafree DA columns (Amicon Millipore, Bedford, Mass.), the Beg9-End9 and Con2-Con3 amplicons underwent sequence analysis with ABI-PRISM 377 (Perkin-Elmer Applied Biosystems Division). The amplicons were partially sequenced, and the sequences obtained were analyzed by the National Center for Biotechnology Information's and the European Molecular Biology Laboratory's analysis tools.

Nucleotide sequence Accession numbers.

The nucleotide sequences are available under accession numbers AF309571 and AF309569 (VP7 and VP4 of strain 83/16F, respectively) and accession numbers AF309572 and AF309570 (VP7 and VP4 of strain 84/52F, respectively).

RESULTS

By PCR, the 20 porcine rotaviruses isolated in the same outbreak were all characterized as type G6P[5]. The three strains isolated outside this outbreak (strains 84/52F, 84/106F, and 84/158F) were also characterized as type G6P[5]. Reference strains Gottfried and OSU were correctly recognized as types G4P[6] (Gottfried-like type) and G5P[7], respectively. Also, the bovine strains and human strain YO were correctly characterized by PCR. Furthermore, partial sequencing of the Beg9-End9 and Con2-Con3 amplicons confirmed the G6P[5] specificity of the field porcine rotaviruses (Tables 2 and 3). The VP7 and VP4 sequences of virus strains 83/15F and 83/16F, isolated in the same outbreak, showed 100% nucleotide identity. The sequence of strain 84/52F was more than 97% similar to those of strains 83/15F and 83/16F at the nucleotide level and was about 98% similar at the amino acid level. As shown in Tables 2 and 3, the VP7 and VP4 genes of all three porcine isolates showed the highest degree of amino acid sequence similarity to those of bovine strain UK, type G6P7[5].

TABLE 2.

Amino acid sequence identities of VP7 proteins of strains 83/16F and 84/52F to those of rotaviruses belonging to various G serotypesa

Strain (origin) G serotype % Amino acid identity of VP7
83/16F 84/52F
KU (human) 1 78 77
S2 (human) 2 70 68
SA11 (simian) 3 79 76
ST3 (human) 4 68 68
Gottfried (porcine) 4 68 68
OSU (porcine) 5 77 75
NCDV (bovine) 6 95 92
B60 (bovine) 6 96 93
IND (bovine) 6 95 92
UK (bovine) 6 99 97
RF (bovine) 6 94 91
BRV033 (bovine) 6 90 88
PA151 (human) 6 89 87
PA169 (human) 6 92 89
Ch2 (avian) 7 46 46
B37 (human) 8 74 73
116E (human) 9 76 74
61A (bovine) 10 74 73
YM (porcine) 11 75 73
L26 (human) 12 71 71
L338 (equine) 13 69 68
CH3 (equine) 14 70 69
a

The fragment analyzed is 147 amino acids long. The GenBank accession numbers of the VP7 genes from the following strains are indicated: KU, D16343; S2, M11164; SA11, V01546; Gottfried, X06386; ST3, P10501; OSU, X04613; NCDV, M63266; B60, M64680; IND, U15000; UK, X00896; RF, X65940; BRV033, U62154; PA151, L20881; PA169, L20880; Ch2, X56784; B37, J04334; 116E, L14072; 61A, X53403; YM, M23194; L26, M58290; L338, D13549; CH3, D25229. Strains with the same G type as strains 83/16F and 84/52F are boldfaced. 

TABLE 3.

Amino acid sequence identities of VP4 proteins of strains 83/16F and 84/52F to those of rotaviruses belonging to various P typesa

Strain (origin) P genotype P serotype % Amino acid identity of VP4
83/16F 84/52F
A5 (bovine) 1 6 67 69
SA11 (simian) 2 67 69
RRV (simian) 3 5B 65 67
K9 (canine) 3 5A 65 66
RV-5 (human) 4 1B 58 57
UK (bovine) 5 7 99 97
61A (bovine) 5 7 94 96
B641 (bovine) 5 7 91 93
VMRI (bovine) 5 7 93 95
P343 (porcine) 5 7 94 96
M37 (human) 6 2A 56 55
Gottfried (porcine) 6 2B 58 57
OSU (porcine) 7 9 60 60
KU (human) 8 1A 58 56
K8 (human) 9 3A 55 56
69M (human) 10 4 66 70
KK3 (bovine) 11 8 39 43
F123 (equine) 12 62 64
Mc35 (human) 13 3B 55 55
MDR13 (equine) 14 59 61
Lp14 (ovine) 15 67 67
Eb (murine) 16 10 52 54
993/83 (bovine) 17 33 34
L338 (equine) 18 63 66
Mc345 (human) 19 60 59
EHP (murine) 20 66 66
a

The fragment analyzed encompasses 130 residues of the VP8 subunit of the VP4 protein. The GenBank accession numbers of the VP4 genes from the following strains are indicated: A5, D13395; SA11, M23188; RRV, M18736; K9, D14725; RV-5, M32559; UK, M22306; 61A, D13396; B641, M63267; VMRI, U53923; P343, U35851; M37, L20887; Gottfried, M33516; OSU, X13190; KU, M21014; K8, D90260; 69M, M60600; KK3, D13393; F123, D16342; MDR13, L07886; Mc35, D14032; Lp14, L11599; Eb, L18992; 993/83, D16352; L338, D13399; Mc345, D38054; EHP, U08424. Strains with the same P type as strains 83/16F and 84/52F are boldfaced. 

DISCUSSION

The development of genomic tools for the characterization of rotavirus VP7 and VP4 specificities has quickly led to a better definition of the relative distributions of rotavirus G and P types in humans and bovines. Conversely, epidemiological data relative to porcine rotaviruses are poor. Porcine rotavirus G4, G5, G11, P[6] (Gottfried-like type), and P[7] genotypes have been shown to be common in the United States and Canada, even if in those studies consistent amounts of viruses were not recognized by the nucleic acid probes used 23, 27. In an extensive survey carried out in southern Brazil by PCR with a wide set of type-specific primers, porcine rotaviruses with G3, G4, G5, G9, G10, P2A[6] (M37-like type), P2B[6] (Gottfried-like type), and P9[7] type specificities have been detected. The G5 (37.3%), P[6] (Gottfried-like type) (23.7%), and P[7] (38.9%) genotypes have been shown to be the most widespread, whereas several rotaviruses have not been characterized by the typing systems used 22.

Porcine rotaviruses that display the typical bovine P[1], P[5], P[11], G[6], and G8 genotypes have previously been detected in pigs 13, 14. Moreover, the detection of G10 porcine rotaviruses and the identification of strains with G10P7[5] and G10P9[7] type specificities have been described in Thailand and Brazil 19, 22.

It was possible to isolate 20 viruses sharing the G6P[5] specificity from piglets with diarrhea in northern Italy. With a few exceptions 15, 20, G6P7[5] seems to be the most widespread combination among bovine rotaviruses all over the world 3, 9, 25. Partial sequence analysis revealed substantial nucleotide and amino acid sequence identities between strain 83/15F and 83/16F, isolated in the same outbreak of diarrhea in piglets. It is clear that in the outbreak described above, all the viruses represented multiple isolates of the same strain, suggesting a quick and efficient transmission of the virus among the six litters. These pieces of evidence highlight the potential pathogenic role of bovine rotaviruses in piglets as a consequence of interspecies transmission. Nevertheless, the possibility that the G6P[5] porcine isolates are molecular reassortants between porcine and bovine strains may not be excluded. Only sequence analysis of other RNA segments or RNA-RNA hybridization 18 might clarify whether these porcine isolates have resulted from direct interspecies transmission or from interspecies reassortment.

At the moment, the lack of epidemiological data does not allow exclusion of the possibility that typical bovine rotavirus G and P types are more common in pigs than was previously believed. Thus, the isolation in the same years of rotaviruses with G6P[5] specificity from swine herds located in different areas (strains 84/52F, 84/106F, and 84/158F) leads to the hypothesis that interspecies transmission of rotaviruses between cattle and swine occurs frequently. Interestingly, in Italy rotaviruses with G6 specificity have also been detected in children affected by acute gastroenteritis 11. Similarly, in Thailand, where G10 bovine rotaviruses are highly prevalent, G10 rotaviruses have been detected in pigs 19 and humans 26.

In conclusion, this study reports for the first time the repetitive isolation of rotaviruses with typical bovine rotavirus specificities from piglets in different regions of northern Italy during the years of 1983 and 1984. Recent epidemiological studies on the relative distributions of bovine rotavirus G and P types in Italy indicate that the G6P7[5] combination is widespread 7, 21.

It is now clear that for the comprehension of rotavirus ecology it is important to define the relative distributions of both human and animal rotavirus G and P types. Despite the relatively small amounts of viruses analyzed and the retrospective nature of this study, the results obtained provide interesting insights into the interspecies circulation of rotaviruses. Further epidemiological studies are required to better define the current relative distributions of porcine rotavirus G and P types in Italy and better understand whether the interspecies circulation that occurs between cows and pigs is occasional or not.

ACKNOWLEDGMENTS

We thank D. Narcisi for excellent technical collaboration and S. Arista (Department of Hygiene and Microbiology, University of Palermo, Palermo, Italy) for supplying human rotavirus strain YO.

REFERENCES

  • 1.Bellinzoni R B, Mattion N M, Burrone O, Gonzales A, La Torre J L, Scodeller E A, Urasawa S, Taniguchi K, Estes M K. Porcine rotaviruses antigenically related to human rotavirus serotypes 1 and 2. J Clin Microbiol. 1990;28:633–636. doi: 10.1128/jcm.28.3.633-636.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Burke B, McCrae M A, Desselberger U. Sequence analysis of two porcine rotaviruses differing in growth in vitro and in pathogenicity: distinct VP4 sequences and conservation of NS53, VP6 and VP7 genes. J Gen Virol. 1994;75:2205–2212. doi: 10.1099/0022-1317-75-9-2205. [DOI] [PubMed] [Google Scholar]
  • 3.Chang K O, Parwani A V, Saif L J. The characterization of VP7 (G type) and VP4 (P type) genes of bovine group A rotaviruses from field samples using RT-PCR and RFLP analysis. Arch Virol. 1996;141:1727–1739. doi: 10.1007/BF01718295. [DOI] [PubMed] [Google Scholar]
  • 4.Ciarlet M, Liprandi F. Serological and genomic characterization of two porcine rotaviruses with serotype G1 specificity. J Clin Microbiol. 1994;32:269–272. doi: 10.1128/jcm.32.1.269-272.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Estes M K. Rotaviruses and their replication. In: Fields B N, Knipe D M, Howley P M, editors. Fields virology. 3rd ed. Vol. 2. Philadelphia, Pa: Lipincott-Raven Publishers; 1996. pp. 1625–1655. [Google Scholar]
  • 6.Estes M K, Cohen J. Rotavirus gene structure and function. Microbiol Rev. 1989;53:410–449. doi: 10.1128/mr.53.4.410-449.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Falcone E, Tarantino M, Di Trani L, Cordioli P, Lavazza A, Tollis M. Determination of bovine rotavirus G and P serotypes in Italy by PCR. J Clin Microbiol. 1999;37:3879–3882. doi: 10.1128/jcm.37.12.3879-3882.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ferrari M, Gualandi G L, Gelmetti D. Isolation of cytopathic strains of rotavirus from pigs. Microbiologica. 1986;9:287–294. [PubMed] [Google Scholar]
  • 9.Fukai K, Sakai T, Kamata H. Distribution of G serotypes and P genotypes of bovine group A rotavirus isolated in Japan. Aust Vet J. 1998;76:418–422. doi: 10.1111/j.1751-0813.1998.tb12393.x. [DOI] [PubMed] [Google Scholar]
  • 10.Gentsch J R, Glass R I, Woods P, Gouvea V, Gorziglia M, Flores J, Das B K, Bhan M K. Identification of group rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30:1365–1373. doi: 10.1128/jcm.30.6.1365-1373.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gerna G, Sarasini A, Parea M, Arista S, Miranda P, Brussow H, Hohino Y, Flores J. Isolation and characterization of two distinct human rotavirus strains with G6 specificity. J Clin Microbiol. 1992;30:9–16. doi: 10.1128/jcm.30.1.9-16.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gouvea V, Glass R I, Woods P, Taniguchi K, Clark H F, Forrester B, Fang Z-Y. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J Clin Microbiol. 1990;28:276–282. doi: 10.1128/jcm.28.2.276-282.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gouvea V, Santos N, Timenetsky M C. VP4 typing of bovine and porcine group A rotaviruses by PCR. J Clin Microbiol. 1994;32:1333–1337. doi: 10.1128/jcm.32.5.1333-1337.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gouvea V, Santos N, Timenetsky M C. Identification of bovine and porcine rotavirus G types by PCR. J Clin Microbiol. 1994;32:1338–1340. doi: 10.1128/jcm.32.5.1338-1340.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gulati B R, Nagakomi O, Koshimura Y, Nagakomi T, Pandey R. Relative frequencies of G and P types among rotaviruses from Indian diarrheic cow buffalo calves. J Clin Microbiol. 1999;37:2074–2076. doi: 10.1128/jcm.37.6.2074-2076.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Huang J, Nagesha H S, Holmes I H. Comparative sequence analysis of VP4s from five Australian porcine rotaviruses: implication of an apparent new P-type. Virology. 1993;196:319–327. doi: 10.1006/viro.1993.1482. [DOI] [PubMed] [Google Scholar]
  • 17.Isegawa Y, Nagakomi O, Nagakomi T, Ishida S, Uesugi S, Ueda S. Determination of bovine rotavirus G and P serotypes by polymerase chain reaction. Mol Cell Probes. 1993;7:277–284. doi: 10.1006/mcpr.1993.1041. [DOI] [PubMed] [Google Scholar]
  • 18.Nakagomi O, Nakagomi T. Molecular epidemiology of human rotaviruses: genogrouping by RNA-RNA hybridization. Arch Virol (Suppl) 1996;12:93–98. doi: 10.1007/978-3-7091-6553-9_11. [DOI] [PubMed] [Google Scholar]
  • 19.Pongsuwanna Y, Taniguchi K, Chiwakul M, Urasawa T, Wakasugi F, Jayavasu C, Urasawa S. Serological and genomic characterization of porcine rotaviruses in Thailand: detection of a G10 porcine rotavirus. J Clin Microbiol. 1996;34:1050–1057. doi: 10.1128/jcm.34.5.1050-1057.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Pongsuwanna Y, Taniguchi K, Choonthanom M, Chiwakul M, Jayavasu C, Snodgrass D R, Urasawa S. Serological and genetic characterization of bovine rotaviruses in Thailand by ELISA and RNA-RNA hybridization: detection of numerous non serotype 6 strains. Southeast Asian J Trop Med Public Health. 1990;21:607–613. [PubMed] [Google Scholar]
  • 21.Pratelli A, Martella V, Tempesta M, Buonavoglia C. Characterization by polymerase chain reaction of ruminant rotaviruses isolated in Italy. Microbiologica. 1999;22:105–109. [PubMed] [Google Scholar]
  • 22.Rácz M L, Kroeff S S, Munford V, Caruzo T A R, Durigon E L, Hayashi Y, Gouvea V, Palombo E A. Molecular characterization of porcine rotaviruses from the southern region of Brazil: characterization of an atypical genotype G[9] strain. J Clin Microbiol. 2000;38:2443–2446. doi: 10.1128/jcm.38.6.2443-2446.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rosen B I, Parwani A V, Lopez S, Flores J, Saif L J. Serotypic differentiation of rotaviruses in field samples from diarrheic pigs by using nucleic acid probes specific for porcine VP4 and human and porcine VP7 genes. J Clin Microbiol. 1994;32:311–317. doi: 10.1128/jcm.32.2.311-317.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Santos N, Lima R C C, Nozawa C M, Linhares R E, Gouvea V. Detection of porcine rotavirus type G9 and of a mixture of types G1 and G5 associated with Wa-like VP4 specificity: evidence for natural human porcine genetic reassortment. J Clin Microbiol. 1999;37:2734–2736. doi: 10.1128/jcm.37.8.2734-2736.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Suzuki Y, Sanekata T, Sato M, Tajima K, Matzuda Y, Nagakomi O. Relative frequencies of G (VP7) and P (VP4) serotypes determined by polymerase chain reaction assays among Japanese bovine rotaviruses isolated in cell culture. J Clin Microbiol. 1993;31:3046–3049. doi: 10.1128/jcm.31.11.3046-3049.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Urasawa T, Taniguchi K, Kobayashi N, Mise K, Hasegawa A, Yamazi Y, Urasawa S. Nucleotide sequence of VP4 and VP7 genes of a unique human rotavirus strain Mc35 with subgroup I and serotype 10 specificity. Virology. 1993;195:766–771. doi: 10.1006/viro.1993.1428. [DOI] [PubMed] [Google Scholar]
  • 27.Zaberezhny A D, Lyoo Y S, Paul P S. Prevalence of P types among porcine rotaviruses using subgenomic VP4 gene probes. Vet Microbiol. 1994;39:97–110. doi: 10.1016/0378-1135(94)90090-6. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Diagnostic Laboratory Immunology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES