
Keywords: E-cigarette, golden Syrian hamster, proinflammatory, tissue factor, vaping
Abstract
E-cigarette vaping is a major aspect of nicotine consumption, especially for children and young adults. Although it is branded as a safer alternative to cigarette smoking, murine and rat models of subacute and chronic e-cigarette vaping exposure have shown many proinflammatory changes in the respiratory tract. An acute vaping exposure paradigm has not been demonstrated in the golden Syrian hamster, and the hamster is a readily available small animal model that has the unique benefit of becoming infected with and transmitting respiratory viruses, including SARS-CoV-2, without genetic alteration of the animal or virus. Using a 2-day, whole body vaping exposure protocol in male golden Syrian hamsters, we evaluated serum cotinine, bronchoalveolar lavage cells, lung, and nasal histopathology, and gene expression in the nasopharynx and lung through reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Depending on the presence of nonnormality or outliers, statistical analysis was performed by ANOVA or Kruskal–Wallis tests. For tests that were statistically significant (P < 0.05), post hoc Tukey–Kramer and Dunn’s tests, respectively, were performed to make pairwise comparisons between groups. In nasal tissue, RT-qPCR analysis revealed nicotine-dependent increases in gene expression associated with type 1 inflammation (CCL-5 and CXCL-10), fibrosis [transforming growth factor-β (TGF-β)], nicotine-independent increase oxidative stress response (SOD-2), and a nicotine-independent decrease in vasculogenesis/angiogenesis (VEGF-A). In the lung, nicotine-dependent increases in the expression of genes involved in the renin-angiotensin pathway [angiotensin-converting enzyme (ACE), ACE2], coagulation (tissue factor, Serpine-1), extracellular matrix remodeling (MMP-2, MMP-9), type 1 inflammation (IL-1β, TNF-α, and CXCL-10), fibrosis (TGF-β and Serpine-1), oxidative stress response (SOD-2), neutrophil extracellular traps release (ELANE), and vasculogenesis and angiogenesis (VEGF-A) were identified. To our knowledge, this is the first demonstration that the Syrian hamster is a viable model of e-cigarette vaping. In addition, this is the first report that e-cigarette vaping with nicotine can increase tissue factor gene expression in the lung. Our results show that even an acute exposure to e-cigarette vaping causes significant upregulation of mRNAs in the respiratory tract from pathways involving the renin-angiotensin system, coagulation, extracellular matrix remodeling, type 1 inflammation, fibrosis, oxidative stress response, neutrophil extracellular trap release (NETosis), vasculogenesis, and angiogenesis.
INTRODUCTION
E-cigarettes (e-cig), first introduced in 2003, have recently become a very popular form of nicotine consumption. In 2021, 34% of high school students reported ever using tobacco products, and e-cig vaping represented 85% of their consumption (1). This means over 4.4 million high school students have tried e-cig vaping (1). Furthermore, just 40% of high school and middle school e-cig users report doing so on more than 20 of the last 30 days (1). This indicates that a significant portion of e-cig vaping is more intermittent and acute in duration. Marketed as a safer alternative to traditional cigarette use, the chemical content of the aerosol has significant overlap with the content of cigarette smoke as seen by the presence of small aldehydes such as acrolein, acetaldehyde, and formaldehyde (2). These chemicals, along with the many others already identified in e-cig aerosol, play a part in the proinflammatory state created in the respiratory tract due to vaping. Evidence of the inflammation created by e-cig vaping has been shown in multiple murine and rat models. Especially in chronic and subacute exposures, e-cig exposure is known to cause lung lipid and macrophage dysregulation independent of nicotine, nicotine-dependent lung inflammation, extracellular matrix (ECM) remodeling, cytokine production, and alterations in response to reactive oxygen species (ROS) (3–5). Alterations in ROS response have been shown in vivo and in vitro in acute models, as well (6, 7). To our knowledge, golden Syrian hamsters (Mesocricetus auratus) have never been used as a model of e-cig-induced inhalational injury. Since a substantial subset of e-cig vaping behavior is intermittent and acute, especially in teenagers, the development of models that reflect this type of exposure is important.
In this study, we hypothesized that the golden Syrian hamster would be a viable model for airway inflammation, ECM remodeling, oxidative stress, neutrophil extracellular trap release (NETosis), and risk of thrombosis related to acute e-cig exposure. Our results establish the validity of small animal modeling of e-cig inhalational injury in a hamster, and the novel finding that acute vaping leads to an increase in tissue factor expression. As an added benefit, the golden Syrian hamster is a readily available small animal model that may have application in the study of respiratory viruses such as respiratory syncytial virus (RSV) and adenovirus (8–10). In addition, it does not require genetic modifications to become infected or transmit SARS-CoV-2 and influenza (11–13). Thus, our model has significant translational applications to the evaluation of vaping’s impact on respiratory infections.
METHODS
Animals
The studies were approved by the Institutional Animal Care and Use Committee of the University of Colorado Anschutz Medical Campus. The investigators adhered to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (1996) and the research was carried out in compliance with the Animal Welfare Act. Six- to 8-wk-old male Lakeview Golden (LVG) Syrian hamsters (weight: 93–140 g; Charles River Laboratories, Wilmington, MA) were used and maintained in an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC)-accredited animal care facility. Hamsters were acclimated for 7 days following arrival, housed four animals per cage, and their health status was monitored daily. Since this is a feasibility study of a novel exposure paradigm, no power calculation was performed, and sample sizes were constrained by the maximal number of animals that could be exposed at one time. Animals were grouped by three exposure regimens, including bias flow (n = 16), PG/VG + 0% nicotine (n = 16), and PG/VG + 2.5% nicotine (n = 16).
Chemicals and e-Cigarette Liquid
With the goal of having consistent e-liquid content and aerosol generation, vape juice was made daily in the laboratory. Propylene glycol (PG), vegetable glycerin (VG), and nicotine-free base (>99% GC) were purchased from Sigma Aldrich and used as the components of the e-liquid. E-liquid consisting of 50% PG, 50% VG, with or without 25 mg/mL (2.5%) nicotine was prepared the morning of each exposure. This formulation is most compatible with the e-cig device and atomizer described in Aerosol Generation and Animal Exposures.
Aerosol Generation and Animal Exposures
E-cigarette aerosol was generated using an inExpose system (SCIREQ, Montreal, QC, Canada) equipped with a Joyetech eVic VTC Mini mod device, which provides consistent aerosol content and particle size through concurrent use of an atomizer consisting of a nickel-based, temperature-controlled coil with 0.15 Ω resistance with stainless steel housing and cotton-based wick (sub-ohm coil, KangerTech, Shenzhen, China) (14). The puff profile used for the exposure included a total volume of 70 mL, an exposure time of 3.3 s, every 30 s (15). Hamsters were exposed to e-cigarette aerosol for 2 h per day for two consecutive days via a whole body exposure system with a 10-L chamber (SciReq). The e-cig aerosol generated was passed through the condensing chamber and pumped into the mixing chamber with a flow rate of 1.0 L/min. The aerosol was diluted with air in the mixing chamber and then delivered into the whole body exposure chamber where hamsters were separated by dividers. Simultaneously, the e-cig aerosol in the exposure chamber was exhausted by another pump with a flow rate of 3.0 L/min. Both the pumps were calibrated and adjusted before each exposure. Pumps were cleaned following each exposure to minimize the effects of nicotine residues. The atomizer was changed out after a maximum of 20 exposure hours to avoid overheating and carbon monoxide generation. Before exposure to a new atomizer, 1 mL of e-cig liquid was dispensed onto the atomizer ensuring saturation of the cotton wick and prevention of a dry burn. Hamsters were exposed in one of three groups: control animals (“bias flow” group), PG/VG + 0% nicotine, and PG/VG + 2.5% nicotine. Control animals received room air only, at a flow rate of 3.0 L/min. After 120 min of continuous, ambient exposure, animals were monitored for at least 15 min before returning to the housing facility.
Euthanasia
Animals were euthanized immediately following the last day of e-cigarette exposure. Euthanasia was performed via terminal ketamine-xylazine intraperitoneal (IP) injection (200 mg/kg ketamine + 30 mg/kg xylazine; VetOne) followed by diaphragmatic puncture and exsanguination.
Bronchoalveolar Lavage Fluid Lung Tissue Harvest and Histopathology
After terminal anesthesia and exsanguination, lung tissue was cleared of blood by flushing the right ventricle with phosphate-buffered saline (PBS) at a 30 mL/min flow rate. The trachea was then cannulated, the left bronchus clamped, and the right lung was lavaged with two 2.5 mL washes of PBS solution. Right lung lobes were tied off, individually dissected, immediately snap-frozen in liquid nitrogen, and stored at −80°C until RNA extraction. Alternatively, the right upper lobe (RUL) was placed into 1 mL cold TRIzol reagent (Invitrogen) per 100 mg of tissue, immediately homogenized, and the homogenate stored at −80°C until RNA extraction. The left lung was then unclamped and intratracheally fixed with 4% paraformaldehyde in PBS (PFA-PBS) for 5 min before removal by gross dissection and storage in 4% PFA-PBS until embedding. Paraffin-embedded tissues were sectioned at a thickness of 5 µm and stained for hematoxylin and eosin (H&E) and Alcian blue-periodic acid-Schiff (AB-PAS). Bronchoalveolar lavage fluid (BALF) samples were pooled, centrifuged at 300 g for 10 min at 4°C, and supernatants frozen (−80°C). Cell pellets from BALF were resuspended using 250 µL PBS and cytospin slides (Thermo Shandon) were prepared using 50,000 cells per slide. Differential cell counts (∼400 cells/slide) were performed on cytospin-prepared slides stained with PROTOCOL Hema 3 (Fisher Scientific). Total cell counts are expressed per microliter of BALF.
Nasal Respiratory Epithelium Tissue Harvest and Histopathology
After terminal anesthesia and exsanguination, nasal respiratory epithelial tissue was isolated by first removing the head at the base of the skull. The skin of the head and lower jaw was completely removed. Muscle and connective tissue were scraped from the frontal and nasal plates, the rhinarium was detached, and the nasal and frontal plates were removed. The nasal respiratory epithelium and olfactory bulbs were collected and placed into 1 mL of cold TRIzol on ice. Samples were homogenized in TRIzol immediately following harvest and homogenates were stored at −80°C until RNA extraction. For histopathology, the skin of the head and lower jaw was removed, along with brain matter through the back of the skull. The remaining skull was fixed in 150 mL of 4% PFA-PBS. After decalcification for 1.5 days, paraffin-embedded tissues were sectioned at a thickness of 5 µm and stained for H&E and AB-PAS.
Cotinine Assay
Cotinine levels were measured in hamster serum collected immediately after the last day of e-cigarette aerosol exposure by ELISA according to the manufacturer’s instructions (Abnova). Approximately 3 mL of fresh blood was collected via inferior vena cava before exsanguination. The blood was allowed to clot, centrifuged at 1,300 g for 10 min at 25°C, and the serum was collected, aliquoted, and stored at −80°C until analysis. Absorbance was measured at 450 nm with background correction at 560 nm using a SpectraMax M5 plate reader (Molecular Devices).
Reverse Transcription Quantitative Real-Time PCR
Total RNA was extracted using TRIzol reagent and an RNeasy Mini Kit (Qiagen). After TRIzol-based isolation, RNA samples were equilibrated with an equal volume of 70% ethanol. A proportion of sample equivalent to ≤ 30 mg of tissue was then purified using the RNeasy Mini, including on-column DNase treatment, according to the manufacturer’s protocol. cDNA was synthesized from 50 ng of input RNA using the iScript Reverse Transcription Supermix (Bio-Rad), which contains a blend of oligo(dT) and random hexamers, according to the manufacturer’s instructions. Because commercial PCR panels were not available, primers were designed for gene targets of interest that could be internally validated, and primer sequences are shown in Table 1. The impact of vaping on the gene targets expressed through in vivo murine, rat, and human studies are reviewed in Supplemental Table S1. Although most of the targets are part of acute inflammatory response pathways, we also included genes that are relevant in upper and lower respiratory tract infections (such as SARS-CoV-2), respiratory tract infection recovery, and long-term sequelae. The mRNA levels of our gene targets were detected using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on a QuantStudio 7 Flex system (Applied Biosystems, Thermo Fisher). The manufacturer’s instructions for qPCR reaction preparation and thermal cycling parameters were followed. Target mRNA expression levels were normalized to Rpl18, which was validated for stable expression across all groups. Relative gene expression was determined by the 2−ΔΔCt method and calculated relative to the mean expression level of the biological replicates of the bias flow control group. Data are presented as fold change compared with the bias flow control group. No reverse transcriptase controls and melt curve analyses were used to verify the absence of genomic amplification and specificity of amplicons.
Table 1.
PCR primers
| Gene Product | Primer Name | Primer Sequence | Tm, °C | Amplicon Length, bp | mRNA Accession No. | References |
|---|---|---|---|---|---|---|
| ACE | ACE - F | GGAGAGCTGGCATGATGTTGT | 64.2 | 101 | NM_001281581.1 | (16) |
| ACE - R | TGTCCGAAAAGCCGTCTTGT | 63.8 | ||||
| ACE2 | ACE2 - F | CTCAGCGGACAAGAACAAACAG | 63.3 | 135 | XM_005074209.3 | This study |
| ACE2 - R | GCCATTATGTCATCCAAACCTGG | 63.2 | ||||
| CCL-5 | Ccl5 - R | TCCTTTACACTGCCTCGTGT | 62.6 | 104 | XM_005076936.4 | This study |
| Ccl5 - F | CACACTTGACGGTTCCTTCG | 62.6 | ||||
| CXCL-10 | Cxcl10 - F | TGCTACACTTTTAGCCTTGTGC | 62.8 | 97 | NM_001281344.1 | (17) |
| Cxcl10 R | ACCCAGGTAACTCAGAACTGGA | 63.9 | ||||
| Neutrophil elastase | Elane - F | TGTGAACGGCCTAAACTTCC | 61.7 | 114 | XM_013122977.3 | This study |
| Elane - R | AAGCCATTCTCGAAGATCCG | 61.3 | ||||
| MMP-2 | MMP2 - F | CCATTTGATGGCAAGGATGGA | 59.0 | 130 | XM_005079148.4 | This study |
| MMP2 - R | CATACTTTACCCGGACCACTTG | 60.0 | ||||
| MMP-9 | MMP9 - F | TCTTCCAGTACCAAGACAAAG | 58.6 | 115 | XM_005084984.4 | This study |
| MMP9 - R | AGGAAGTCGTAGGTCATGTAG | 59.8 | ||||
| PAI-1 | Serpine1 - F | CCCTTCGATAAGAAAGTGCC | 59.7 | 127 | XM_005080401.4 | This study |
| Serpine1 - R | TCTCCAGAGAGAACTTAGGC | 59.3 | ||||
| RPL18 | Rpl18 - F | AGATCCTCACCTTTGACCAG | 60.2 | 148 | XM_005084699.4 | This study |
| Rpl18 - R | CGGACATAGGGTTTGGTATG | 59.2 | ||||
| SOD-2 | Sod2 - F | CTACGTGAACAACCTGAACGCC | 62.2 | 71 | XM_005065926.4 | This study |
| Sod2 - R | TTGGGCTCTCCACCACCATTAG | 63.0 | ||||
| Tissue factor | TF - F | ACCATCCCTTTGGAACAAGC | 62.0 | 146 | XM_040751945.1 | This study |
| TF - R | ACGATGATGAGTGTTTCTCCC | 61.2 | ||||
| TGF-β | TGFβ- F | ACGTGGAACTCTACCAGAAATAC | 61.2 | 144 | XM_040734679.1/XM_040734680.1 | This study |
| TGFβ- R | GTATCCCATCTCCTTGGTTCAG | 61.2 | ||||
| TNF-α | TNF-α - F | CCCACGTTGTAGCAAACCA | 61.9 | 149 | XM_005086799.4 | This study |
| TNF-α - R | GAGAACCTGGGAGTAAACCAG | 61.2 | ||||
| VEGF-A | VEGFA - F | CGACAGAAGGAGAGCAGAAAG | 61.8 | 82 | NM_001281843.1 | This study |
| VEGFA - R | GTCTCGATCGGATGGCAATAG | 61.8 | ||||
| IL-1β | IL-1b - F | TGAACAACAGAAATGCCTCG | 60.2 | 99 | XM_005068610.4 | This study |
| IL-1b - R | CTCATGGAGAACACCACTTG | 59.5 | ||||
| IL-6 | IL-6 - F | TCACCTCTGGTCTTCTGGAC | 62.0 | 146 | XM_005087110.3 | This study |
| IL-6 - R | ATCTGGACCCTTTACCTCTTGT | 62.0 |
ACE, angiotensin-converting enzyme; F, forward; IL, interleukin; R, reverse; MMP, matrix metalloproteinase; PAI, plasminogen activator inhibitor; SOD, superoxide dismutase; TNF, tumor necrosis factor; TF, tissue factor; TGF, transforming growth factor; VEGF, vascular endothelial growth factor.
Data Analysis and Statistics
Based on exposure type (bias flow, PG/VG + 0% nicotine, and PG/VG + 2.5% nicotine), histograms and boxplots were used to visually identify outliers and check the distribution of outcome measures by group. There was no evidence of nonnormality or outliers in the BALF and cotinine data, thus ANOVA was used. Due to a skewed distribution and the presence of outliers in our mRNA experiments of nasal respiratory epithelium and whole lung homogenate tissue, Kruskal–Wallis tests were used to compare fold change across groups. For the ANOVA and Kruskal–Wallis tests that were statistically significant (P < 0.05), post hoc Tukey–Kramer and Dunn’s tests, respectively, were performed to make pairwise comparisons between groups. To account for multiple comparisons, the familywise type I error rate for each set of three pairwise Tukey–Kramer tests was set to 0.05 and the P values from each set of three pairwise post hoc Dunn’s tests were adjusted using the Bonferroni correction. All data visualizations and analyses were performed with GraphPad Prism software (v. 9.2, La Jolla, CA).
RESULTS
Cotinine Is Detectable in Hamster Serum after Acute Nicotine Vaping
After 2 days of exposure, both bias flow (n = 7) and PG/VG + 0% nicotine (n = 8) hamsters had plasma cotinine levels less than 5 ng/mL (Fig. 1A; 0.0 ± 0.0 ng/mL and 1.4 ± 0.7 ng/mL, respectively). Serum cotinine levels were significantly higher in hamsters exposed to PG/VG + 2.5% nicotine (n = 7) (Fig. 1A; 62.3 ± 10.4 ng/mL; P < 0.0001). In addition, the e-cig device parameters and exposure characteristics, run under our standard experimental conditions, are reported in Supplemental Table S2 (18).
Figure 1.

Acute, whole body e-cigarette exposure. A: serum cotinine levels for animals exposed to bias flow (0.0 ± 0.0 ng/mL), PG/VG + 0% nicotine (1.4 ± 0.7 ng/mL), or PG/VG + 2.5% nicotine (62.3 ± 10.4 ng/mL). ****P < 0.0001, ANOVA with Tukey–Kramer post hoc test. B: AB-PAS-stained nasal sections and H&E-stained lung sections from animals exposed to bias flow (left), PG/VG + 0% nicotine (middle), or PG/VG + 2.5% nicotine (right). C: total cell count, absolute cell counts, and proportion of macrophages, neutrophils, and lymphocytes in bronchoalveolar lavage (BAL) fluid for animals exposed to bias flow, PG/VG + 0% nicotine, PG/VG + 0% nicotine, and PG/VG + 2.5% nicotine. ANOVA with Tukey–Kramer post hoc test. All data are reported as means ± SD. AB-PAS, Alcian blue-periodic acid-Schiff; BALF, bronchoalveolar lavage fluid; H&E, hematoxylin and eosin; PG, propylene glycol; VG, vegetable glycerin.
Acute Vaping Does Not Cause Histologically Evident Changes in Mucus Cell or Epithelial Organization in the Hamster Nose or Lung
Histopathology of the nose and lung for each exposure group was evaluated after 2 days of exposure. In the nose, AB-PAS staining showed no discernable difference in mucin component production between the vaping regimens (Fig. 1B—AB-PAS nose—bias flow, PG/VG + 0% nicotine, PG/VG + 2.5% nicotine). In the bronchial epithelium, H&E staining highlights that there were no significant differences in bronchial epithelial organization, sloughing, or inflammatory cell infiltration (Fig. 1B—H&E lung—bias flow, PG/VG + 0% nicotine, PG/VG + 2.5% nicotine). In addition, there were no differences in lung structure, architecture, or cell populations between the bias-flow group and the vaped groups (PG/VG + 0% nicotine or PG/VG + 2.5% nicotine). H&E staining of the nose and AB-PAS staining of the lung show similar findings to their respective counterparts (Supplemental Fig. S1). Given the acute nature of the exposure protocol, these results are consistent with our expected results.
BAL Cell Numbers and Composition Were Not Altered by Acute Vaping
The total white blood cell (WBC) counts in BALF were not different between bias flow (n = 15; 1,154 ± 381 cells/µL), PG/VG + 0% nicotine (n = 14; 1,396 ± 806 cells/µL), and PG/VG + 2.5% nicotine (n = 11; 1,327 ± 439 cells/µL) (Fig. 1C, P = 0.52) after 2 days of vaping. Absolute cell counts for macrophages did not differ between bias flow (n = 12; 1,112 ± 393 cells/µL), PG/VG + 0% nicotine (n = 10; 1,432 ± 873 cells/µL), and PG/VG + 2.5% nicotine (n = 7; 1,203 ± 455 cells/µL) (Fig. 1C, P = 0.4771). Absolute cell counts for neutrophils did not different between bias flow (n = 12; 57 ± 20 cells/µL), PG/VG + 0% nicotine (n = 10; 81 ± 56 cells/µL), and PG/VG + 2.5% nicotine (n = 7; 82 ± 36 cells/µL) (Fig. 1C, P = 0.2679). Absolute cell counts for lymphocytes were not different between bias flow (n = 12; 7 ± 6 cells/µL), PG/VG + 0% nicotine (n = 10; 11 ± 8 cells/µL), and PG/VG + 2.5% nicotine (n = 7; 8 ± 2 cells/µL) (Fig. 1C, P = 0.36). In addition, there was no difference in BALF cell differential as evidenced by the percent of macrophages, neutrophils, and lymphocytes in BALF between bias flow (n = 12; 94.6 ± 1.2%, 4.9 ± 1.1%, 0.5 ± 0.2%, respectively), PG/VG + 0% nicotine (n = 10; 94.3 ± 1.1%, 5.2 ± 1.2, 0.6 ± 0.3%, respectively), and PG/VG + 2.5% nicotine (n = 7; 93.8 ± 0.5%, 5.5 ± 0.5%, 0.7 ± 0.1%, respectively) (Fig. 1C, P = 0.32, P = 0.46, P = 0.37, respectively).
Acute Vaping Alters Nasal Epithelial Expression Levels of Genes Regulating Type 1 Inflammation, Fibrosis, and Reactive Oxygen Species Processing
Analysis of the impact of vaping on gene expression of the hamster airway was first evaluated by investigating changes in mRNA expression in nasal respiratory epithelium. We selected a panel of target genes (Table 1) based on relevance to SARS-CoV-2 infection/COVID-19 disease, as well as previously published reports of vaping-induced changes in the lungs of mouse models (Supplemental Table S1). For most genes investigated, there was no difference in expression level between the bias flow and PG/VG + 0% groups (Table 2, Fig. 2, and Supplemental Fig. S2). However, we found a nicotine-dependent increase in two genes representing a type 1 inflammatory response, CCL-5 (mean fold change + SD = 4.2 ± 3.3; P = 0.0101) and CXCL-10 (3.2 ± 1.5; P = 0.0009) (Table 2, Fig. 2A). In addition, a nicotine-dependent increase in the profibrotic mediator TGF-β was observed (1.6 ± 0.6; P = 0.0003; Table 2, Fig. 2B). The ROS response gene SOD-2 was unique in showing a nicotine-independent increase (PG/VG + 0% nicotine relative to bias flow 1.8 ± 0.5; P = 0.0133; Table 2, Fig. 2C), and a further increase with exposure to nicotine, although the latter was not statistically significant (PG/VG + 2.5% nicotine compared with PG/VG + 0% nicotine 1.8 ± 0.7; P = 0.1066; Table 2, Fig. 2C). This suggests that there are both PG/VG-related and nicotine-related effects on SOD-2 expression in the nasal epithelium. In contrast, we found a nicotine-independent decrease in mRNA for VEGF-A, which regulates vasculogenesis and angiogenesis (PG/VG + 0% nicotine: bias flow = 0.5 ± 0.2; P = 0.0252 and PG/VG + 2.5% nicotine: bias flow = 0.4 ± 0.3; P = 0.0016; Table 2, Fig. 2D). For the type 1 inflammatory response gene TNF-α, expression was higher for the nicotine-exposed group compared with PG/VG alone, suggesting a nicotine-related effect, but this was not statistically significant (PG/VG + 2.5% nicotine: PG/VG + 0% nicotine = 1.7 ± 0.9; P = 0.1511; Table 2, Fig. 2A). In addition, the mean expression of the type 1 inflammatory response gene IL-1β was slightly elevated for the PG/VG + 0% nicotine group compared with bias flow-exposed animals (1.4 ± 0.7; P = 0.9693; Table 2, Fig. 2A), a trend that was also observed in the comparison between the PG/VG alone and PG/VG + 2.5% nicotine groups (1.5 ± 0.8; P = 0.1887; Table 2, Fig. 2A). There was a significant increase in IL-1β expression between PG/VG + 2.5% nicotine and bias flow exposure (2.0 ± 1.1; P = 0.0132; Table 2, Fig. 2A). mRNAs for all other gene targets investigated showed no significant changes with the vaping of PG/VG + 0% nicotine or PG/VG + 2.5% nicotine (Table 2, Supplemental Fig. S2).
Table 2.
Respiratory tract gene expression changes with acute vaping exposure
| Tissue Origin | Gene Target | Fold Change (mean ± SD), PG/VG + 2.5% nic: PG/VG + 0% nic |
P Value, PG/VG + 2.5% nic: PG/VG + 0% nic |
Fold Change (mean ± SD), PG/VG + 2.5% nic: bias flow | P Value, PG/VG + 2.5% nic: bias flow | Fold Change (mean ± SD), PG/VG + 0% nic: bias flow | P Value, PG/VG + 0% nic: bias flow |
|---|---|---|---|---|---|---|---|
| Nasal | IL-1β | 1.5 ± 0.8 | = 0.1887 | 2.0 ± 1.1 | = 0.0132 | 1.4 ± 0.7 | = 0.9693 |
| IL-6 | 1.4 ± 0.7 | = 0.2988 | 1.3 ± 0.6 | > 0.9999 | 0.9 ± 0.5 | > 0.9999 | |
| ACE | 1.0 ± 0.3 | > 0.9999 | 1.2 ± 0.4 | = 0.4891 | 1.2 ± 0.4 | = 0.6667 | |
| ACE2 | 1.0 ± 0.6 | > 0.9999 | 0.9 ± 1.2 | = 0.5251 | 0.9 ± 0.3 | = 0.9980 | |
| CCL-5 | 4.2 ± 3.3 | = 0.0101 | 3.8 ± 3.0 | = 0.0116 | 0.9 ± 0.5 | > 0.9999 | |
| CXCL-10 | 3.2 ± 1.5 | = 0.0009 | 3.2 ± 1.5 | = 0.0001 | 1.0 ± 0.4 | > 0.9999 | |
| Neutrophil elastase | 1.3 ± 1.4 | > 0.9999 | 1.3 ± 1.4 | > 0.9999 | 1.0 ± 1.0 | > 0.9999 | |
| MMP-2 | 1.5 ± 0.9 | = 0.3634 | 1.7 ± 0.9 | = 0.1806 | 1.1 ± 0.5 | > 0.9999 | |
| MMP-9 | 1.9 ± 2.0 | = 0.3922 | 3.2 ± 3.3 | = 0.1092 | 1.7 ± 1.6 | > 0.9999 | |
| PAI-1 | 1.4 ± 0.8 | = 0.7588 | 1.3 ± 0.7 | = 0.7832 | 0.9 ± 0.3 | > 0.9999 | |
| SOD-2 | 1.8 ± 0.7 | = 0.1066 | 3.2 ± 1.3 | < 0.0001 | 1.8 ± 0.5 | = 0.0133 | |
| Tissue factor | 1.9 ± 0.6 | = 0.0003 | 1.4 ± 0.4 | = 0.1206 | 0.7 ± 0.2 | = 0.1807 | |
| TGF-β | 1.6 ± 0.6 | = 0.0003 | 1.6 ± 0.6 | = 0.0085 | 1.0 ± 0.2 | > 0.9999 | |
| TNF-α | 1.7 ± 0.9 | = 0.1511 | 1.7 ± 0.9 | = 0.0178 | 1.0 ± 0.4 | > 0.9999 | |
| VEGF-A | 0.8 ± 0.4 | > 0.9999 | 0.4 ± 0.3 | = 0.0016 | 0.5 ± 0.2 | = 0.0252 | |
| Lung | IL-1β | 12.0 ± 27.0 | = 0.0001 | 12.8 ± 29.0 | = 0.0002 | 1.1 ± 0.6 | > 0.9999 |
| IL-6 | 4.3 ± 0.2 | = 0.12 | 5.4 ± 11.0 | = 0.0286 | 1.2 ± 0.9 | > 0.9999 | |
| ACE | 11.7 ± 26.5 | < 0.0001 | 12.1 ± 27.5 | < 0.0001 | 1.0 ± 0.5 | > 0.9999 | |
| ACE2 | 13.6 ± 32.2 | < 0.0001 | 15.8 ± 37.5 | < 0.0001 | 1.2 ± 0.7 | > 0.9999 | |
| CCL-5 | 1.3 ± 0.9 | = 0.8417 | 1.8 ± 1.2 | = 0.0175 | 1.4 ± 0.8 | = 0.3206 | |
| CXCL-10 | 1.6 ± 0.6 | = 0.0181 | 2.0 ± 0.8 | < 0.0001 | 1.3 ± 0.2 | = 0.1406 | |
| Neutrophil elastase | 17.0 ± 38.2 | < 0.0001 | 15.8 ± 35.6 | = 0.0003 | 0.9 ± 0.6 | > 0.9999 | |
| MMP-2 | 9.6 ± 22.0 | = 0.0061 | 10.1 ± 23.2 | = 0.0105 | 1.1 ± 0.6 | > 0.9999 | |
| MMP-9 | 4.8 ± 8.9 | = 0.0281 | 5.5 ± 10.1 | = 0.0096 | 1.1 ± 0.9 | > 0.9999 | |
| PAI-1 | 10.2 ± 19.6 | = 0.0010 | 10.9 ± 20.9 | = 0.0020 | 1.1 ± 0.9 | > 0.9999 | |
| SOD-2 | 1.7 ± 1.0 | = 0.0113 | 1.8 ± 1.0 | = 0.0025 | 1.0 ± 0.2 | > 0.9999 | |
| Tissue factor | 1.6 ± 0.4 | < 0.0001 | 1.6 ± 0.4 | < 0.0001 | 1.0 ± 0.2 | > 0.9999 | |
| TGF-β | 7.3 ± 14.2 | < 0.0001 | 8.6 ± 16.7 | < 0.0001 | 1.2 ± 0.4 | > 0.9999 | |
| TNF-α | 11.9 ± 25.2 | = 0.0002 | 14.6 ± 30.8 | < 0.0001 | 1.2 ± 0.6 | > 0.9999 | |
| VEGF-A | 5.2 ± 6.3 | = 0.0011 | 5.4 ± 6.5 | = 0.0004 | 1.0 ± 0.5 | > 0.9999 |
ACE, angiotensin-converting enzyme; IL, interleukin; MMP, matrix metalloproteinase; PAI, plasminogen activator inhibitor; PG, propylene glycol; SOD, superoxide dismutase; TNF, tumor necrosis factor; TGF, transforming growth factor; VEGF, vascular endothelial growth factor; VG, vegetable glycerin. Bolded characters indicate statistical significance at P < 0.05.
Figure 2.

Changes in gene expression in nasal epithelia and olfactory bulb tissue induced by acute e-cig exposure. Hamsters were exposed to bias flow (blue), PG/VG + 0% nicotine (green), or PG/VG + 2.5% nicotine (red) for 2 days (n = 11 or 12 animals/group). Target gene expression was analyzed by RT-qPCR. Levels were normalized to RPL18 and calculated relative to the mean expression level of the biological replicates of the bias flow group. A: IL-1β, TNF-α, CCL-5, and CXCL-10. B: TGF-β. C: SOD-2. D: VEGF-A. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Kruskal–Wallis with Dunn’s post hoc test. IL, interleukin; PG, propylene glycol; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SOD, superoxide dismutase; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor; VG, vegetable glycerin.
Vaping Acutely Alters Lung Expression of Genes Regulating Inflammation, Reactive Oxygen Species Processing, Coagulation, Fibrosis, and Repair Response in a Nicotine-Dependent Manner
To further characterize the impact of acute vaping on hamster airways, gene expression changes were evaluated in whole lung homogenates. Thirteen of the 15 target genes investigated demonstrated a nicotine-dependent increase at a transcriptomic level (Table 2, Fig. 3, A–G). This includes ACE (PG/VG + 2.5% nicotine: PG/VG + 0% nicotine 11.7 ± 26.5; P < 0.0001) and ACE2 (13.6 ± 32.2; P < 0.0001), genes involved in the renin-angiotensin-aldosterone system (RAAS) pathway (Table 2, Fig. 3A). Notably, ACE2 also serves as the receptor for SARS-CoV-2. Exposure to nicotine also impacted the coagulation-related genes tissue factor (1.6 ± 0.4; P < 0.0001) and Serpine-1 (encoding PAI-1, 10.2 ± 19.6; P = 0.0010), extracellular matrix remodeling genes MMP-2 (9.6 ± 22.0; P = 0.0061) and MMP-9 (4.8 ± 8.9; P = 0.0281), and fibrosis and vasculogenesis genes TGF-β and VEGF-A (7.3 ± 14.2; P < 0.0001 and 5.2 ± 6.3; P = 0.0011, respectively) (Table 2, Fig. 3, B–D). Similar to the results obtained in the analysis of nasal epithelial tissue, several type 1 inflammatory genes were upregulated by nicotine vaping. These included IL-1β (12.0 ± 27.0, P = 0.0001), TNF-α (11.9 ± 25.2, P = 0.0002), and CXCL-10 (1.6 ± 0.6, P = 0.0181) (Table 2, Fig. 3E). In contrast to the pattern observed in nasal tissue, the ROS response gene SOD-2 was increased in a completely nicotine-dependent manner in lung tissue (1.7 ± 1.0; P = 0.0113; Table 2, Fig. 3F). Finally, a nicotine-dependent link to NETosis was evidenced by an increase in ELANE, the gene encoding neutrophil elastase (17.0 ± 38.2; P < 0.0001; Table 2, Fig. 3G). Although there was no difference in IL-6 expression between the PG/VG alone and bias flow groups or between PG/VG alone and PG/VG + 2.5% nicotine, IL-6 was elevated in the nicotine-exposed group compared with bias flow animals (5.4 ± 11.0; P = 0.0286; Table 2, Fig. 3E). The mean expression of CCL5 was marginally elevated in the PG/VG alone compared with bias flow group (1.4 ± 0.8; P = 0.3206; Table 2, Fig. 3E), but there was an increase in its expression between PG/VG + 2.5% nicotine and bias flow exposure (1.8 ± 1.2, P = 0.0175; Table 2, Fig. 3E). CCL5 was not significantly different in the PG/VG alone versus PG/VG + 2.5% nicotine groups. None of the genes showed a significant change between PG/VG + 0% nicotine vaping and bias flow exposure (Table 2, Fig. 3, A–E). A description of the baseline gene expression for each gene target in nasopharyngeal and lung tissue is shown in Supplemental Table S3. In addition, a visual comparison of the gene expression changes from each tissue under each exposure condition is shown in Supplemental Table S4.
Figure 3.

Acute e-cig exposure affects mRNA expression of target genes in the lung analyzed by RT-qPCR. Hamsters were exposed to bias flow (blue), PG/VG + 0% nicotine (green), and PG/VG + 2.5% nicotine (red) for 2 days (n = 14–16 animals/group). Target mRNA expression was analyzed by RT-qPCR. Expression was normalized to RPL18 and calculated relative to the mean expression level of the biological replicates of the bias flow group. A: RAAS pathway genes ACE and ACE2. B: coagulation genes tissue factor and Serpine-1. C: ECM remodeling genes MMP-2 and MMP-9. D: fibrosis- and angiogenesis-/vasculogenesis-related genes TGF-β and VEGF-A. E: type 1 inflammatory genes IL-1β, TNF-α, IL-6, CCL-5, and CXCL-10. F: ROS processing gene SOD-2. G: NETosis-related gene ELANE. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, Kruskal–Wallis with Dunn’s post hoc test. ACE, angiotensin-converting enzyme; ECM, extracellular matrix; IL, interleukin; PG, propylene glycol; NETosis, neutrophil extracellular trap release; RAAS, renin-angiotensin-aldosterone system; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SOD, superoxide dismutase; TNF, tumor necrosis factor; VEGF, vascular endothelial growth factor; VG, vegetable glycerin.
DISCUSSION
The purpose of this study was to determine whether the golden Syrian hamster could be used to model the effects of e-cig vaping. In testing our hypothesis that hamsters are a viable model of e-cig-induced airway inhalational injury, we exposed them to bias flow, PG/VG + 0% nicotine, and PG/VG + 2.5% nicotine. After exposure, we monitored exposure quality with serum cotinine, evaluated airway histopathology, and performed BALF studies. In addition, we investigated the expression of 15 gene targets that covered pathways involving type 1 inflammation, processing of ROS, ECM remodeling, NETosis, fibrosis, and coagulation.
Our results fulfill the primary study objective that hamsters are a feasible model of the effects of acute e-cig vaping. First, we show that the measure of serum cotinine is an accurate and reproducible way to confirm exposure to nicotine vaping in hamsters (Fig. 1A). These levels are similar in magnitude to those reported for newborn mice exposed to 1.8% nicotine with PG for 10 days and rats exposed to PG/VG + 2.5% nicotine for 3 days (7, 19). We evaluated histological changes with acute vaping in the nose and lung. In the nose, AB-PAS staining suggested no change in mucin components of the epithelial layer (Fig. 1B). Although other studies have reported vaping-induced increases in MUC5AC, we suspect that our vaping protocol may not be long enough to induce changes visible on histological evaluation (20). In the lung, H&E staining demonstrated no change in bronchial epithelial organization or alteration in the sloughing of cells into the airway lumen for vaped hamsters compared with bias flow controls. Finally, we evaluated BALF to examine the impact of acute vaping on total WBC counts and the percentage of macrophages, neutrophils, and lymphocytes in that cell population. We did not see significant differences between our bias flow controls and vaping groups, with or without nicotine, which is consistent with a published report of acute vaping in a rat model (Fig. 1C) (7).
Most notably, the results indicated that there were increases in the nose and lung levels of gene expression of interest at a transcriptomic level. Since hamsters are obligate nasal breathers and have a larger nasopharyngeal surface area compared with humans, nasopharyngeal studies were pursued. Our analysis of the nasal respiratory epithelium demonstrated nicotine-dependent increases in type 1 inflammation and fibrosis (Fig. 2, A and B). There was a nicotine-independent increase in ROS processing (Fig. 2C). In addition, there was a nicotine-independent decrease in the angiogenesis- and vasculogenesis-related gene VEGF-A (Fig. 2D); however, we are unsure of the clinical significance of this finding. Downregulation of innate immunity with chronic e-cig vaping in the human nose has previously been reported, most notably with decreases in IL-6 and VEGF at the protein level (21, 22). We suspect that the differences in our findings could be related to the acute nature of our exposures and possible species variation.
In the lung, the effects of vaping were highlighted by a nicotine-dependent increase in renin-angiotensin pathway by upregulation of ACE and ACE2 expression (Fig. 3A). The findings for ACE2 are similar to a published report that used a murine model of vaping (4). Importantly, we describe herein the novel finding of increased tissue factor expression due to nicotine vaping (Fig. 3B). To our knowledge, transcriptomic changes in tissue factor have not previously been described with in vitro or in vivo e-cig vaping experiments. Its upregulation could serve as a link to the risk of thrombosis with e-cig vaping. Qasim et al. (23) in their study described enhanced platelet function and risk of thrombogenesis with 5 days of vaping in a murine model; however, other factors in the coagulation cascade have not been implicated. Tissue factor activation is the initiator of the extrinsic coagulation cascade, and it has been considered critical to the process of microvascular thrombi formation and immunothrombosis in severe acute respiratory distress syndrome (ARDS), including COVID-19 (24, 25). This makes it a valuable target for further study, both in disease pathogenesis and therapeutic development. Although we have not elucidated the exact mechanism of the increase in tissue factor, our hypothesis is that it is due to the nicotine-dependent increases in type 1 inflammatory cytokine genes, which were also highly expressed in the lung tissue in our model (Fig. 3E). Of note, CXCL-10 was the lone gene upregulated in a nicotine-dependent manner in both the nasal and lung tissues (Figs. 2A and 3E). Although CXCL-10 is mostly known as a lymphocyte chemokine, it has been shown to be a significant component of the neutrophilic response to oxidative stress in vivo (26, 27). The observed transcriptomic increases in CXCL-10 could be consistent with the early type 1 inflammatory response, especially since we also describe activation of the oxidative stress response with increases in SOD-2 (Figs. 2C and 3D). The expression of another coagulation-related gene, Serpine-1, was also markedly increased in the hamster lung following acute nicotine vaping (Fig. 3B). Serpine-1 encodes plasminogen activator inhibitor-1 (PAI-1), an inhibitor of fibrinolysis, which favors coagulation and inhibits clot breakdown (28). In the context of other respiratory diseases that can be modeled with the golden Syrian hamster, the increase in type 1 inflammation and shift toward a procoagulant state in acute nicotine vaping could have deleterious effects if sustained.
Additional pathways demonstrating a nicotine-dependent response included NETosis, which was impacted by vaping through a nicotine-dependent increase in ELANE (neutrophil elastase) in the hamster lung (Fig. 3G). This gene encodes a serine protease whose expression is limited to neutrophils and their precursors. In cell culture, short-term nicotine exposure led to increased ELANE gene expression in a myeloblast/promyelocyte cell line (29). Subsequently, human BALF cells from individuals who chronically smoke or vape demonstrated increased neutrophil elastase expression (30). Since our acute exposure did not result in an influx of neutrophils into the lung, as measured by bronchoalveolar lavage and seen in histopathology, we suspect that this increase could be due to increased expression in the neutrophils already present in the tissue or from neutrophil precursors circulating in, and/or marginated within, the lung.
Our model also showed altered expression of genes involved in the development of lung fibrosis through nicotine-dependent increases in TGF-β and PAI-1 (Fig. 3, B and D). TGF-β is a principal regulator of lung fibrosis development, and its role in the development of lung fibrosis post-COVID infection is actively being studied. PAI-1 is also thought to have a role in lung fibrosis development through the induction of senescence in alveolar type II cells, beyond its role in fibrinolysis (31). Also potentially related to lung fibrosis, we report nicotine-dependent increases in mRNAs encoding MMP-2 and MMP-9, which are involved in ECM remodeling (Fig. 3C). Although other groups have shown a nicotine-independent decrease in MMP-2 and increase in MMP-9, the inconsistency may be due to species differences (4, 5). Overall, our findings implicate the potential for e-cig use to lead to dysregulated ECM repair. Finally, our findings in the lung demonstrate a differential response compared with the nose with a nicotine-dependent increase in ROS processing, angiogenesis, and vasculogenesis (Fig. 3, D and F).
Limitations
The study is limited due to the inherent nature of model development and working with an animal that has a paucity of commercially available antibodies, assays, and experimental kits. First, there are limitations in our experimental methods, specifically with testing vape juice made daily in the laboratory. Despite the benefit of controlling for confounding variables, such as flavorants or chemical contaminants, it may limit our exploration of real-world vaping conditions that include flavors, nicotine salts, and fourth-generation vaping devices. In addition, the analyses are limited by the investigation of genes for which we could design primers and validate, although there were other genes we hoped to include in our experiments. Hopefully, the further development of commercial assays for the Syrian hamster will be very helpful in the future. The conclusions are limited to transcriptomic changes in inflammatory response pathways and have not been identified within specific lung cell types. The conclusions are also limited by the acute exposure duration, and it is possible that chronic exposures could obtain different results. Specifically, it is possible that nicotine tolerance might limit the magnitude of its effects going forward.
In conclusion, the golden Syrian hamster has provided a viable model for the study of e-cig vaping-related airway injury and demonstrated significant transcriptomic upregulation of inflammatory pathways, in an acute exposure setting. Through the development of this model, we will be able to further study potential sex differences in acute vaping exposure, in addition to the impact of e-cig use on respiratory viruses, including SARS-CoV-2 infection. Its development allowed us to identify tissue factor as a novel nicotine-upregulated gene associated with vaping. These findings, along with the upregulation of other components of the type 1 inflammation and fibrotic pathways, are important targets of future vaping research.
DATA AVAILABILITY
Data will be made available upon reasonable request.
SUPPLEMENTAL DATA
Supplemental Tables S1–S4 and Supplemental Figs. S1 and S2: https://doi.org/10.5281/zenodo.6870193 (v. 4).
GRANTS
This work was supported by the Countermeasures Against Chemical Threats (CounterACT) Program, National Institutes of Health (NIH), National Institute of Environmental Health Sciences (NIEHS) (U54ES027698-05 to C.W.W.), and an associated Supplement (3U54ES027698-05S1). Additional support was provided by a grant from Children’s Hospital Colorado Research Foundation (CHC R7530S PEDS) (to C.W.W.).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
D.M.H., H.J.N., P.E.B., and C.W.W. conceived and designed research; D.M.H., H.J.N., T.M.V., L.A.B., and S.C. performed experiments; D.M.H., H.J.N., T.M.V., E.H.C., J.T.B., and C.W.W. analyzed data; D.M.H., H.J.N., P.E.B., A.B.-L., and C.W.W. interpreted results of experiments; D.M.H. prepared figures; D.M.H. drafted manuscript; H.J.N., T.M.V., L.A.B., S.C., P.E.B., E.H.C., J.T.B., A.B.-L., and C.W.W. edited and revised manuscript; D.M.H., H.J.N., T.M.V., L.A.B., S.C., P.E.B., E.H.C., J.T.B., A.B.-L., and C.W.W. approved final version of manuscript.
ACKNOWLEDGMENTS
The authors are grateful for the support of Robin R. Deterding, the Breathing Institute at Children’s Hospital Colorado, Livia A. Veress, and Jacqueline S. Rioux. Preprint is available at https://doi.org/10.1101/2022.05.20.492852.
REFERENCES
- 1. Gentzke AS, Wang TW, Cornelius M, Park-Lee E, Ren C, Sawdey MD, Cullen KA, Loretan C, Jamal A, Homa DM. tobacco product use and associated factors among middle and high school students - national youth tobacco survey, United States, 2021. MMWR Surveill Summ 71: 1–29, 2022. doi: 10.15585/mmwr.ss7105a1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Sleiman M, Logue JM, Montesinos VN, Russell ML, Litter MI, Gundel LA, Destaillats H. Emissions from electronic cigarettes: key parameters affecting the release of harmful chemicals. Environ Sci Technol 50: 9644–9651, 2016. doi: 10.1021/acs.est.6b01741. [DOI] [PubMed] [Google Scholar]
- 3. Madison MC, Landers CT, Gu BH, Chang CY, Tung HY, You R, Hong MJ, Baghaei N, Song LZ, Porter P, Putluri N, Salas R, Gilbert BE, Levental I, Campen MJ, Corry DB, Kheradmand F. Electronic cigarettes disrupt lung lipid homeostasis and innate immunity independent of nicotine. J Clin Invest 129: 4290–4304, 2019. doi: 10.1172/JCI128531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Wang Q, Sundar IK, Li D, Lucas JH, Muthumalage T, McDonough SR, Rahman I. E-cigarette-induced pulmonary inflammation and dysregulated repair are mediated by nAChR α7 receptor: role of nAChR α7 in SARS-CoV-2 Covid-19 ACE2 receptor regulation. Respir Res 21: 154, 2020. doi: 10.1186/s12931-020-01396-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Wang Q, Khan NA, Muthumalage T, Lawyer GR, McDonough SR, Chuang TD, Gong M, Sundar IK, Rehan VK, Rahman I. Dysregulated repair and inflammatory responses by e-cigarette-derived inhaled nicotine and humectant propylene glycol in a sex-dependent manner in mouse lung. FASEB Bioadv 1: 609–623, 2019. doi: 10.1096/fba.2019-00048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Ma T, Wang X, Li L, Sun B, Zhu Y, Xia T. Electronic cigarette aerosols induce oxidative stress-dependent cell death and NF-κB mediated acute lung inflammation in mice. Arch Toxicol 95: 195–205, 2021. doi: 10.1007/s00204-020-02920-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wang J, Zhang T, Johnston CJ, Kim SY, Gaffrey MJ, Chalupa D, Feng G, Qian WJ, McGraw MD, Ansong C. Protein thiol oxidation in the rat lung following e-cigarette exposure. Redox Biol 37: 101758, 2020. doi: 10.1016/j.redox.2020.101758. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Schmidt AC, McAuliffe JM, Murphy BR, Collins PL. Recombinant bovine/human parainfluenza virus type 3 (B/HPIV3) expressing the respiratory syncytial virus (RSV) G and F proteins can be used to achieve simultaneous mucosal immunization against RSV and HPIV3. J Virol 75: 4594–4603, 2001. doi: 10.1128/JVI.75.10.4594-4603.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Wright PF, Woodend WG, Chanock RM. Temperature-sensitive mutants of respiratory syncytial virus: in-vivo studies in hamsters. J Infect Dis 122: 501–512, 1970. doi: 10.1093/infdis/122.6.501. [DOI] [PubMed] [Google Scholar]
- 10. Hjorth RN, Bonde GM, Pierzchala WA, Vernon SK, Wiener FP, Levner MH, Lubeck MD, Hung PP. A new hamster model for adenoviral vaccination. Arch Virol 100: 279–283, 1988. doi: 10.1007/BF01487691. [DOI] [PubMed] [Google Scholar]
- 11. Chan JF, Zhang AJ, Yuan S, Poon VK, Chan CC, Lee AC, Chan WM, Fan Z, Tsoi HW, Wen L, Liang R, Cao J, Chen Y, Tang K, Luo C, Cai JP, Kok KH, Chu H, Chan KH, Sridhar S, Chen Z, Chen H, To KK, Yuen KY. Simulation of the clinical and pathological manifestations of coronavirus disease 2019 (COVID-19) in a golden Syrian hamster model: implications for disease pathogenesis and transmissibility. Clin Infect Dis 71: 2428–2446, 2020. doi: 10.1093/cid/ciaa325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Imai M, Iwatsuki-Horimoto K, Hatta M, Loeber S, Halfmann PJ, Nakajima N, . et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc Natl Acad Sci USA 117: 16587–16595, 2020. doi: 10.1073/pnas.2009799117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Iwatsuki-Horimoto K, Nakajima N, Ichiko Y, Sakai-Tagawa Y, Noda T, Hasegawa H, Kawaoka Y. Syrian Hamster as an Animal Model for the Study of Human Influenza Virus Infection. J Virol 92, 2018. doi: 10.1128/JVI.01693-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Lechasseur A, Altmejd S, Turgeon N, Buonanno G, Morawska L, Brunet D, Duchaine C, Morissette MC. Variations in coil temperature/power and e-liquid constituents change size and lung deposition of particles emitted by an electronic cigarette. Physiol Rep 7: e14093, 2019. doi: 10.14814/phy2.14093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Behar RZ, Hua M, Talbot P. Puffing topography and nicotine intake of electronic cigarette users. PLoS One 10: e0117222, 2015. doi: 10.1371/journal.pone.0117222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Uchide T, Fujimori Y, Fukushima U, Uechi M, Sasaki T, Temma K. cDNA cloning of hamster angiotensin-converting enzyme and mRNA expression. DNA Seq 17: 319–325, 2006. doi: 10.1080/10425170600724816. [DOI] [PubMed] [Google Scholar]
- 17. Schountz T, Campbell C, Wagner K, Rovnak J, Martellaro C, DeBuysscher BL, Feldmann H, Prescott J. Differential innate immune responses elicited by nipah virus and cedar virus correlate with disparate in vivo pathogenesis in hamsters. Viruses 11: 291, 2019. doi: 10.3390/v11030291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Noël A, Verret CM, Hasan F, Lomnicki S, Morse J, Robichaud A, Penn AL. Generation of electronic cigarette aerosol by a third-generation machine-vaping device: application to toxicological studies. J Vis Exp 138: 58095, 2018. doi: 10.3791/58095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. McGrath-Morrow SA, Hayashi M, Aherrera A, Lopez A, Malinina A, Collaco JM, Neptune E, Klein JD, Winickoff JP, Breysse P, Lazarus P, Chen G. The effects of electronic cigarette emissions on systemic cotinine levels, weight and postnatal lung growth in neonatal mice. PLoS One 10: e0118344, 2015. doi: 10.1371/journal.pone.0118344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Gellatly S, Pavelka N, Crue T, Schweitzer KS, Day BJ, Min E, Numata M, Voelker DR, Scruggs A, Petrache I, Chu HW. Nicotine-free e-cigarette vapor exposure stimulates il6 and mucin production in human primary small airway epithelial cells. J Inflamm Res 13: 175–185, 2020. doi: 10.2147/JIR.S244434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Martin EM, Clapp PW, Rebuli ME, Pawlak EA, Glista-Baker E, Benowitz NL, Fry RC, Jaspers I. E-cigarette use results in suppression of immune and inflammatory-response genes in nasal epithelial cells similar to cigarette smoke. Am J Physiol Lung Cell Mol Physiol 311: L135–L144, 2016. doi: 10.1152/ajplung.00170.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Rebuli ME, Glista-Baker E, Hoffman JR, Duffney PF, Robinette C, Speen AM, Pawlak EA, Dhingra R, Noah TL, Jaspers I. Electronic-cigarette use alters nasal mucosal immune response to live-attenuated influenza virus. a clinical trial. Am J Respir Cell Mol Biol 64: 126–137, 2021. doi: 10.1165/rcmb.2020-0164OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Qasim H, Karim ZA, Silva-Espinoza JC, Khasawneh FT, Rivera JO, Ellis CC, Bauer SL, Almeida IC, Alshbool FZ. Short-term e-cigarette exposure increases the risk of thrombogenesis and enhances platelet function in mice. J Am Heart Assoc 7: e009264, 2018. doi: 10.1161/JAHA.118.009264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Fang X-Z, Wang Y-X, Xu J-Q, He Y-J, Peng Z-K, Shang Y. Immunothrombosis in acute respiratory dysfunction of COVID-19. Front Immunol 12, 2021. doi: 10.3389/fimmu.2021.651545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Subrahmanian S, Borczuk A, Salvatore S, Fung KM, Merrill JT, Laurence J, Ahamed J. Tissue factor upregulation is associated with SARS-CoV-2 in the lungs of COVID-19 patients. J Thrombosis Haemost 19: 2268–2274, 2021. doi: 10.1111/jth.15451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Jiang D, Liang J, Guo R, Xie T, Kelly FL, Martinu T, Yang T, Lovgren AK, Chia J, Liu N, Jung Y, Palmer SM, Noble PW. Long-term exposure of chemokine CXCL10 causes bronchiolitis-like inflammation. Am J Respir Cell Mol Biol 46: 592–598, 2012. doi: 10.1165/rcmb.2011-0116OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Michalec L, Choudhury BK, Postlethwait E, Wild JS, Alam R, Lett-Brown M, Sur S. CCL7 and CXCL10 orchestrate oxidative stress-induced neutrophilic lung inflammation. J Immunol 168: 846–852, 2002. doi: 10.4049/jimmunol.168.2.846. [DOI] [PubMed] [Google Scholar]
- 28. Wygrecka M, Birnhuber A, Seeliger B, Michalick L, Pak O, Schultz AS, Schramm F, Zacharias M, Gorkiewicz G, David S, Welte T, Schmidt JJ, Weissmann N, Schermuly RT, Barreto G, Schaefer L, Markart P, Brack MC, Hippenstiel S, Kurth F, Sander L, Witzenrath M, Kuebler W, Kwapiszewska G, Preissner KT. Altered fibrin clot structure and dysregulated fibrinolysis contribute to thrombosis risk in severe COVID-19. Blood Adv 6: 1074–1087, 2021. doi: 10.1182/bloodadvances.2021004816. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Armstrong LW, Rom WN, Martiniuk FT, Hart D, Jagirdar J, Galdston M. Nicotine enhances expression of the neutrophil elastase gene and protein in a human myeloblast/promyelocyte cell line. Am J Respir Crit Care Med 154: 1520–1524, 1996. doi: 10.1164/ajrccm.154.5.8912774. [DOI] [PubMed] [Google Scholar]
- 30. Ghosh A, Coakley RD, Ghio AJ, Muhlebach MS, Esther CR, Jr, Alexis NE, Tarran R. Chronic e-cigarette use increases neutrophil elastase and matrix metalloprotease levels in the lung. Am J Respir Crit Care Med 200: 1392–1401, 2019. doi: 10.1164/rccm.201903-0615OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Jiang C, Liu G, Luckhardt T, Antony V, Zhou Y, Carter AB, Thannickal VJ, Liu RM. Serpine 1 induces alveolar type II cell senescence through activating p53-p21-Rb pathway in fibrotic lung disease. Aging Cell 16: 1114–1124, 2017. doi: 10.1111/acel.12643. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental Tables S1–S4 and Supplemental Figs. S1 and S2: https://doi.org/10.5281/zenodo.6870193 (v. 4).
Data Availability Statement
Data will be made available upon reasonable request.
