Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2022 Sep 28;10(5):e01306-22. doi: 10.1128/spectrum.01306-22

Orthohantaviruses in Reservoir and Atypical Hosts in the Czech Republic: Spillover Infection and Indication of Virus-Specific Tissue Tropism

Václav Hönig a,b,✉,#, Jan Kamiš a,c,#, Aneta Maršíková c, Tereza Matějková d, Pavel Stopka d, Anna Mácová c, Daniel Růžek a,b,e, Jana Kvičerová c,d
Editor: Mathilde Richardf
PMCID: PMC9604079  PMID: 36169417

ABSTRACT

Orthohantaviruses (genus Orthohantavirus) are a diverse group of viruses that are closely associated with their natural hosts (rodents, shrews, and moles). Several orthohantaviruses cause severe disease in humans. Central and western Europe are areas with emerging orthohantavirus occurrences. In our study, several orthohantaviruses, including the pathogenic Kurkino virus (KURV), were detected in their natural hosts trapped at several study sites in the Czech Republic. KURV was detected mainly in its typical host, the striped field mouse (Apodemus agrarius). Nevertheless, spillover infections were also detected in wood mice (Apodemus sylvaticus) and common voles (Microtus arvalis). Similarly, Tula virus (TULV) was found primarily in common voles, and events of spillover to rodents of other host species, including Apodemus spp., were recorded. In addition, unlike most previous studies, different tissues were sampled and compared to assess their suitability for orthohantavirus screening and possible tissue tropism. Our data suggest possible virus-specific tissue tropism in rodent hosts. TULV was most commonly detected in the lung tissue, whereas KURV was more common in the liver, spleen, and brain. Moreover, Seewis and Asikkala viruses were detected in randomly found common shrews (Sorex araneus). In conclusion, we have demonstrated the presence of human-pathogenic KURV and the potentially pathogenic TULV in their typical hosts as well as their spillover to atypical host species belonging to another family. Furthermore, we suggest the possibility of virus-specific tissue tropism of orthohantaviruses in their natural hosts.

IMPORTANCE Orthohantaviruses (genus Orthohantavirus, family Hantaviridae) are a diverse group of globally distributed viruses that are closely associated with their natural hosts. Some orthohantaviruses are capable of infecting humans and causing severe disease. Orthohantaviruses are considered emerging pathogens due to their ever-increasing diversity and increasing numbers of disease cases. We report the detection of four different orthohantaviruses in rodents and shrews in the Czech Republic. Most viruses were found in their typical hosts, Kurkino virus (KURV) in striped field mice (Apodemus agrarius), Tula virus (TULV) in common voles (Microtus arvalis), and Seewis virus in common shrews (Sorex araneus). Nevertheless, spillover infections of atypical host species were also recorded for KURV, TULV, and another shrew-borne orthohantavirus, Asikkala virus. In addition, indications of virus-specific patterns of tissue tropism were observed. Our results highlight the circulation of several orthohantaviruses, including KURV, which is pathogenic to humans, among rodents and shrews in the Czech Republic.

KEYWORDS: Kurkino virus, Tula virus, Seewis virus, Asikkala virus, rodents, Eulipotyphla, phylogeny, host specificity, tissue specificity, zoonoses, zoonosis

INTRODUCTION

Orthohantaviruses (genus Orthohantavirus, family Hantaviridae, order Bunyavirales) are negative-sense, enveloped, single-stranded zoonotic RNA viruses with a trisegmented genome (formed by large [L], medium [M], and small [S] segments) (1, 2). In humans, they may cause infection with two types of clinical manifestations, both with possibly fatal outcomes (3, 4). Hemorrhagic fever with renal syndrome (HFRS) is caused by Old World orthohantaviruses that occur in Europe and Asia, whereas hantavirus pulmonary (or cardiopulmonary) syndrome [H(C)PS] is caused by New World orthohantaviruses in the Americas (5, 6). Orthohantaviruses are considered host specific and are tightly associated with hosts of one or a few closely related species that constitute their natural reservoir (69). The reservoir hosts of orthohantaviruses that are pathogenic to humans are rodents, but other orthohantaviruses have also been detected in Eulipotyphla (namely, shrews and moles) (10, 11). As rodents are widespread and people can easily come into contact with them, human infections have become an increasing problem. The inhalation of virus-containing aerosols via the excreta (urine, feces, or saliva) of infected rodents is the most common route of transmission (10, 12).

In general, orthohantaviruses form three large evolutionary groups (see below) associated with hosts from four rodent subfamilies, including the Old World subfamilies Murinae (family Muridae) and Arvicolinae (family Cricetidae) and the New World subfamilies Sigmodontinae (Cricetidae) and Neotominae (Cricetidae) (8, 13). In addition, some orthohantaviruses are associated with hosts of the order Eulipotyphla (families Soricidae and Talpidae) as their reservoir hosts (13). In Europe, the following orthohantaviruses circulate in populations of wild rodents: Dobrava virus (DOBV), Kurkino virus (KURV), Saaremaa virus (SAAV), Sochi virus (SOCV) (all belonging to the Dobrava-Belgrade orthohantavirus species), Puumala virus (PUUV) (Puumala orthohantavirus), Seoul virus (SEOV) (Seoul orthohantavirus), and Tula virus (TULV) (Tula orthohantavirus) (8, 1417). Moreover, Seewis virus (SWSV) (Seewis orthohantavirus) and Asikkala virus (ASIV) (Asikkala orthohantavirus) have been found mainly in shrews (18, 19). Most of the European orthohantavirus human disease cases are caused by PUUV, DOBV, and KURV (20). The viruses differ in their geographic distributions, species of reservoir hosts, and virulence to humans. DOBV (previously known as DOBV-Af), typically hosted by yellow-necked mice (Apodemus flavicollis; Murinae), is dominant in the Balkans and Russia (21). It has also been found in several countries in central Europe (e.g., the Czech Republic, Germany, Hungary, and Slovakia) (8, 21, 22). KURV (previously known as DOBV-Aa) is associated with striped field mice (Apodemus agrarius), is widely distributed from Germany throughout the central European countries to parts of northern (Denmark) and eastern (Estonia and Russia) Europe, and causes a milder form of human disease than DOBV (8, 23, 24). Striped field mice are also the reservoir hosts of SAAV, so far restricted to the island of Saaremaa in Estonia (7). SOCV (previously known as DOBV-Ap) is associated with Black Sea field mice (Apodemus ponticus) and occurs in the Black Sea region of the European part of Russia (7, 25). The more common but less virulent PUUV is the causative agent of an HFRS-like disease called nephropathia epidemica (NE) (3). Together with its reservoir host, the bank vole (Clethrionomys glareolus; Arvicolinae), it is distributed throughout Europe and in the western part of Russia (23, 26). Furthermore, the cooccurrence of PUUV, DOBV, and KURV in the same area has been reported, particularly in the Balkans (27). SEOV, which is transmitted by rats (Rattus spp.; Murinae), is an exceptional orthohantavirus that is distributed worldwide due to ship trade and human migration, allowing the movement of rats over long distances (26, 28). TULV is found primarily in common voles (Microtus arvalis; Arvicolinae), several other members of the same genus, and European water voles (Arvicola amphibius; Arvicolinae) (2931). Although TULV is considered nonpathogenic, rare cases of TULV-associated pulmonary and renal syndrome have been documented in humans in the Czech Republic and Germany (32, 33).

Regarding shrew-borne orthohantaviruses, SWSV was first detected in a common shrew (Sorex araneus; Soricidae) captured in a Swiss village of the same name (34). Since then, several studies have confirmed SWSV in shrews and also occasionally in rodents in other central European countries, including the Czech Republic, Slovakia, and Germany (19, 35). Another shrew-borne hantavirus, ASIV, has been recorded as a novel hantavirus from Finland (36), carried by the Eurasian pygmy shrew (Sorex minutus). Together with SWSV, ASIV has also been detected in the Czech Republic and neighboring Germany (18).

Although orthohantaviruses are not new to humankind, they are considered to be emerging viruses with epidemic outbreaks because of the recent increase in the number of human cases (especially in western Europe) (37) and because of the continuous records of enormous previously unrecognized diversity (5, 7, 38, 39). In contrast to the observed seroprevalence (22), the incidence of orthohantavirus infection in humans is lower in the Czech Republic than in neighboring Germany or Austria (20, 40). Data on the circulation of orthohantaviruses among reservoir hosts are incomplete, yet human cases and rodent tissue screening suggest the presence and epidemiologic relevance of DOBV, KURV, PUUV, and TULV (35) in this country. Here, we report KURV and TULV, their phylogenetic relationships, and their occurrence in different host tissues of wild rodents mainly from urban areas of the Czech Republic as well as SWSV and ASIV in randomly found shrews.

RESULTS

Altogether, 153 rodent individuals were trapped and sampled at the defined trapping sites (for details, see Table 1). Moreover, 10 randomly found dead shrews (family Soricidae; Sorex spp., Crocidura spp., and Neomys fodiens) were also sampled (Table 2).

TABLE 1.

Summary of the numbers and species of the trapped and examined rodents in the Czech Republic from 2016 to 2021

Locality (region) Trapping yr(s) No. of rodents of species
Microtus arvalis Clethrionomys glareolus Apodemus agrarius Apodemus sylvaticus Apodemus flavicollis
České Budějovice (South Bohemia) 2016–2018 4 7 12 15
Lužnice (South Bohemia) 2018 10 1
Zbytiny-Koryto (South Bohemia) 2021 2 5
Květušín (South Bohemia) 2021 2 1 2
Opava (Northern Moravia) 2016 1 40 1 10
Varnsdorf (Northern Bohemia) 2018, 2019 1 1 6 1
Vestec (Central Bohemia) 2020 16 6 9
 
Total 24 20 46 25 38

TABLE 2.

Detailed information on the randomly found dead shrews

Locality ID Name of locality (district) Locality type GPS coordinates (WGS84) Yr of collection Species of collected animal
A České Budějovice, Vltava (České Budějovice) Urban area (housing estate) 48°59′56.238″N, 14°27′19.339″E 2017 Sorex minutus
B České Budějovice, Biology Centre CAS (České Budějovice) Urban area (research center complex) 48°58′39.859″N, 14°26′52.175″E 2020 Sorex araneus
C Zbytiny-Koryto (Prachatice) Area of confirmed hantavirus disease in humans 48°55′53.899″N, 14°01′23.761″E 2018 Sorex araneus
D Volenice (Strakonice) Rural area (agricultural) 49°32′26.700″N, 13°54′06.000″E 2019 Crocidura suaveolens
E Lužnice, field station U Zahradníků no. 92 (Jindřichův Hradec) Rural area (congress center) 49°04′51.428″N, 14°45′41.266″E 2018 Neomys fodiens (n = 2)
F Hoděmyšl (Příbram) Urban area 49°36′41.220″N, 13°53′17.700″E 2019 Crocidura suaveolens
G Podmokly (Plzeň-sever) Rural area (agricultural) 49°52′04.020″N, 13°10′00.240″E 2019 Sorex araneus
H Varnsdorf (Děčín) Rural area (agricultural) 50°55′09.899″N, 14°35′53.808″E 2018 Sorex araneus
I Semtěš (Karlovy Vary) Rural area (agricultural) 50°04′32.460″N, 13°09′41.700″E 2019 Crocidura leucodon

Prevalence and diversity of the detected orthohantaviruses.

In total, 24.2% (37/153) of the rodent hosts and 27.3% (3/10) of the shrews tested positive for orthohantavirus RNA (PCR products confirmed by sequencing) in at least one tissue sample (multiple tissue samples were taken from a trapped individual). Based on nucleotide sequence analysis, TULV, KURV, SWSV, and ASIV were identified in the positive samples. TULV was most frequently found in common voles (70.8% of all trapped common voles), and KURV was most frequently found in striped field mice (15.2% of all trapped striped field mice), even though both viruses were also detected in rodents of other species (Table 3). SWSV and ASIV were found exclusively in common shrews (Table 4). Differences in prevalence rates between female and male hosts were not statistically significant on the level of localities or on the level of the individual host species (for detailed results, see Table S3 in the supplemental material).

TABLE 3.

Prevalence of TULV and KURV RNAs in rodents and shrews from the Czech Republica

Species of tested animal Prevalence (%) (no. of positive animals/no. of animals tested)
TULV KURV Total
Microtus arvalis 70.8 (17/24) 8.3 (2/24) 79.2 (19/24)
Clethrionomys glareolus 10.0 (2/20) 0 (0/20) 10.0 (2/20)
Apodemus agrarius 10.9 (5/46) 15.2 (7/46) 26.1 (12/46)
Apodemus sylvaticus 8.0 (2/25) 8.0 (2/25) 16.0 (4/25)
Apodemus flavicollis 5.3 (2/38) 0 (0/38) 5.3 (2/38)
a

Viral RNA was detected by nested reverse transcription-PCR (RT-PCR) with universal primer pairs targeting orthohantavirus RNA in all available tissue samples. Orthohantaviruses were identified based on the sequencing of a portion of the large (and medium) segment of orthohantavirus genomic RNA. TULV, Tula virus; KURV, Kurkino virus.

TABLE 4.

Prevalence of SWSV and ASIV RNAs in rodents and shrews from the Czech Republica

Species of tested animal Prevalence (%) (no. of positive animals/no. of animals tested)
SWSV ASIV Total
Sorex araneus 50.0 (2/4) 25.0 (1/4) 75.0 (3/4)
Sorex minutus 0 (0/1) 0 (0/1) 0 (0/1)
Crocidura suaveolens 0 (0/2) 0 (0/2) 0 (0/2)
Crocidura leucodon 0 (0/1) 0 (0/1) 0 (0/1)
Neomys fodiens 0 (0/2) 0 (0/2) 0 (0/2)
a

Viral RNA was detected by nested RT-PCR with universal primer pairs targeting orthohantavirus RNA in all available tissue samples. Orthohantaviruses were identified based on sequencing of a portion of the large segment of orthohantavirus genomic RNA. SWSV, Seewis virus; ASIV, Asikkala virus.

Phylogenetic analyses.

The final alignment of L segment sequences yielded a 290-bp-long matrix containing 97 sequences of orthohantaviruses; the final alignment of M segment sequences was 292 bp long and contained 39 sequences of orthohantaviruses. Phylogenetic analyses of both matrices produced well-resolved trees with a basic structure corresponding to the phylogenies presented previously by Klempa et al. (7) and Zelená et al. (35). However, the addition of DOBV, KURV, TULV, SWSV, ASIV, and other orthohantaviruses to the common phylogeny has made the overall evolutionary picture of the genus Orthohantavirus even more complex.

All 9 KURV sequences of the L segment obtained from our samples, which originated from striped field mice (6 sequences), common voles (2 sequences), and a yellow-necked mouse (1 sequence), were placed onto the KURV branch. They were split into two distinct clusters regardless of the host species, locality, or tissue type (see Fig. 2). For the M segment, we managed to obtain only a single sequence from samples previously positive for KURV (according to the L segment sequence). That sequence was obtained from a striped field mouse and could not be assigned to a specific virus clade as the whole Dobrava-Belgrade orthohantavirus cluster remained unresolved in the M segment tree (see Fig. 3).

FIG 2.

FIG 2

Phylogenetic relationships of the obtained sequences of orthohantaviruses inferred by maximum likelihood (ML) analysis of the RNA-dependent RNA polymerase gene (L segment). The Bayesian inference (BI) tree was mapped onto the ML tree. Numbers at the nodes show bootstrap values derived from the ML analysis/posterior probabilities under the BI analysis. Bootstrap supports and posterior probabilities of <50% and <0.50, respectively, are not provided. Hantaan virus was used as an outgroup. Colors indicate the orthohantaviruses (blue, viruses of the Dobrava-Belgrade orthohantavirus species; red, Tula virus; brown, Seewis virus; yellow, Asikkala virus). Accession numbers for the sequences obtained from GenBank are indicated. Each original sample code consists of the abbreviation of the specific code of the sample, the host species, the country code, and the map reference (Fig. 1 and Table 6). HTNV, Hantaan virus; AMRV, Amur virus; SEOV, Seoul virus; DOBV, Dobrava virus; SAAV, Saaremaa virus; KURV, Kurkino virus; SOCV, Sochi virus; TATV, Tatenale virus; PUUV, Puumala virus; TULV, Tula virus; SWSV, Seewis virus; MGAV, Amga virus; ASIV, Asikkala virus; CZ, Czech Republic; DE, Germany; EE, Estonia; FI, Finland; FR, France; JP, Japan; PL, Poland; CN, China; RS, Serbia; RU, Russia; SI, Slovenia; SK, Slovakia; TR, Turkey; UK, United Kingdom.

We obtained 28 TULV sequences of the L segment, which originated from common voles (18 sequences), striped field mice (5 sequences), bank voles (2 sequences), wood mice (2 sequences), and a yellow-necked mouse (1 sequence). They branched within two phylogenetically distinct clusters based on the sampled localities. One of the branches was associated almost exclusively with samples from Vestec (see Fig. 2). Fewer TULV sequences were obtained for the M segment (18 sequences), but they still indicated the same pattern of two distinct clusters (see Fig. 3).

Two sequences of the L segment from common shrews clustered with SWSV sequences, while one sequence represented ASIV. Unfortunately, we did not manage to sequence the M segment of any samples from shrews despite multiple efforts.

Tissue tropism.

Concerning the tissue specificity and efficiency of orthohantavirus RNA detection, virus-specific patterns were observed. TULV was most efficiently detected in the lung tissue (82% of the individuals positive in any tissue), whereas KURV was more efficiently detected in the liver (71%), the spleen (71%), and, most surprisingly, the brain (75%) (Table 5). No TULV-positive kidney samples were found in the tested mice or bank voles, including 6 samples from individuals positive in other tissues, whereas the same virus was efficiently detected in the kidney tissues of 65% of the positive common voles (Table S4). Nevertheless, the differences in the prevalences of TULV and DOBV in the individual tissue samples were not statistically significant. Shrew-borne orthohantaviruses were found in the lungs, liver, brain, and heart tissue (Table S4).

TABLE 5.

Tissue tropism and efficiency of detection of orthohantavirus RNA in different tissue samples from orthohantavirus RNA-positive individualsa

Virus No. of positive
individuals
% positive samples (no. of positive samples/no. of positive individuals with sample available)
Lungs Kidneys Liver Spleen Brain Heart
TULV 28 82.1 (23/28) 52.4 (11/21) 65.2 (15/23) 16.7 (1/6) 0 (0/2) NA
KURV 9 55.6 (5/9) 0 (0/3) 71.4 (5/7) 71.4 (5/7) 75.0 (3/4) 0 (0/2)
SWSV 2 50.0 (1/2) 0 (0/1) 50.0 (1/2) 0 (0/1) 50.0 (1/2) 100 (1/1)
ASIV 1 100 (1/1) NA NA NA 100 (1/1) 100 (1/1)
 
Total 40 75.0 (30/40) 44.0 (11/25) 65.6 (21/32) 42.9 (6/14) 55.6 (5/9) 50.0 (2/4)
a

The percentage was calculated as the ratio of the number of positive samples of the particular tissue type to the total number of positive individuals with this tissue sample available (not all tissues were sampled from all individuals). TULV, Tula virus; KURV, Kurkino virus; SWSV, Seewis virus; ASIV, Asikkala virus; NA, not available.

DISCUSSION

Orthohantaviruses are emerging zoonotic pathogens that have a significant impact on human health in many countries (41). Although a similar or even higher seroprevalence has been found in the human population in the Czech Republic, the incidence rate of human cases of orthohantavirus infection is significantly lower than those in other countries in central Europe, especially the neighboring countries Austria, Germany, and Slovakia (42). This could be due to an underestimation of the number of clinical cases, a higher occurrence of clinically inapparent cases, or (most likely) a combination of both. KURV and TULV are among the most frequently detected orthohantaviruses in rodents in the Czech Republic, in both in our study (Table 3) and previous studies (29, 35). Both pathogens are associated with a mild course of the disease (43, 44). In contrast, PUUV has been reported to be a major cause of human infection elsewhere in Europe (45) and also in Austria (46) and Germany (43), including areas bordering the Czech Republic. DOBV and KURV human HFRS cases are significantly less frequent in central Europe (43, 47). In the Czech Republic, PUUV, DOBV, and KURV are the most frequent causes of clinically apparent, diagnosed orthohantavirus disease cases in humans (16, 35, 48, 49), although they remain relatively rare and spatially and geographically isolated.

KURV was detected mainly in striped field mice, two wood mice, and two common voles (Table 3). The presence of the related DOBV was previously reported in 2 yellow-necked mice in Northern Moravia (35) and in rodents of multiple species in South Bohemia (50). Interestingly, in our study, KURV was detected in multiple individuals at the two trapping sites in Northern Moravia and one trapping site in South Bohemia (Fig. 1). The nucleotide sequences obtained from both regions clustered with sequences from rodents and human patients from Northern Moravia (35). The authors of that previous study (35) mentioned that DOBV was detected more frequently in mountainous areas, whereas KURV was associated with lowlands; our samples originated from lowlands.

FIG 1.

FIG 1

Geographic distribution of the localities used for rodent trapping and places where the dead shrews were found. Localities of rodent trapping are marked by numbers according to Table 6. Localities of the collected shrews are marked by letters according to Table 2. Colors indicate the orthohantaviruses detected (red, Tula virus; blue, Kurkino virus; brown, Seewis virus; orange, Asikkala virus; gray, locality where no orthohantavirus RNA-positive samples were detected). (The map template is from https://commons.wikimedia.org/wiki/File:Czechia_-_colored_blank_map.png.)

In our study, PUUV was not detected in any of the 20 bank voles or animals of any other species. There is a single study reporting the direct detection of PUUV in rodents in the Czech Republic (49), indicating that the distribution of this virus might be highly focal. As also previously reported (29, 51, 52), TULV is prevalent among populations of common voles in the Czech Republic. Although it is rarely detected in humans, infections of immunocompromised (33) as well as immunocompetent (32, 47, 53) patients were reported. In general, the distribution of orthohantaviruses in their reservoir hosts, as well as the distribution of human cases, is influenced by numerous factors on the side of the reservoirs, the virus, and the human population (42, 54), resulting in high spatiotemporal variability (43).

Phylogenetic analyses of the L segment indicate that the detected TULV and shrew-borne orthohantaviruses are strictly monophyletic. The members of the Dobrava-Belgrade orthohantavirus species split into 4 monophyletic lineages according to the individual viruses, DOBV, KURV, SAAV, and SOCV, which is in congruence with data from previous publications by Klempa et al. (7) and Zelená et al. (35). Our sequences were classified as KURV. Similarly, it seems obvious that TULV is not composed of a single genotype, but it also splits into several distinct genotypes within central Europe, regardless of the reservoir host (43, 55, 56). Since little is known of its pathogenicity to humans, we cannot assess whether this differentiation may have any significance in terms of the impact on human health (i.e., that one lineage may be more pathogenic than the other). Data from phylogenetic analyses of the M segment were congruent with the results of Klempa et al. (7), suggesting that the phylogenetic position of SAAV is unresolved, being scattered among the viruses of the Dobrava-Belgrade orthohantavirus species. The phylogram of the M segment was less resolved than that of the L segment. The M segment, encoding the Gn and Gc surface glycoprotein precursors, is known to undergo faster evolution than the L (RNA-dependent RNA polymerase) and S (nucleocapsid) segments (57, 58), which is reflected in the long branch of TULV in the M segment compared to the L segment phylogenetic tree.

Orthohantaviruses are considered to be highly host specific (8, 59). In our study, the majority of TULVs were detected in common voles (family Cricetidae), which are typical hosts of the virus in central Europe (29, 30). Similarly, as expected, KURV was most frequently found in striped field mice (Muridae) (7), and SWSV and ASIV were detected exclusively in common shrews (18, 34). Nevertheless, TULV RNA was detected in four striped field mice, two wood mice, two yellow-necked mice, and two bank voles, and likewise, two wood mice and one common vole were positive for KURV RNA. Most of the atypical hosts shared a locality (i.e., lived syntopically) with the positive individuals of the typical host species, and sequence analysis confirmed the high identity of sequences obtained from typical and atypical hosts, indicating interspecies (interfamily) spillover. The possibility of cross-contamination can never be eliminated, but we have taken measures to minimize this risk. In addition, the virus was detected in multiple tissues from the same individual infected with an atypical orthohantavirus, and the individuals originated from different trapping sites and trapping events, which makes accidental cross-contamination highly unlikely. The possibility of infection of bank voles with TULV as well as infection of mice (yellow-necked mice and laboratory mice) with atypical viruses of the Dobrava-Belgrade orthohantavirus species was partially confirmed in a previous laboratory experiment (60). There is evidence that spillover infection occurs under natural conditions between host species belonging to the same family (50, 56, 61, 62) rather than between members of different families (35, 50). However, the exclusive use of the typical host even under conditions of sympatric/syntopic occurrence of the hosts and viruses has also been reported (4, 63). On the other hand, surveillance of hantaviruses often focuses on a particular host species and/or a particular virus; therefore, the frequency of intergenus spillover may be underestimated. Our data do not allow us to assess whether infection of an atypical host results in the same course of infection and whether and how effectively atypical hosts may participate in virus circulation in nature. Nevertheless, our records of KURV and TULV hantavirus spillover to hosts of different families indicate possible lower host specificity and the potential for hantavirus coinfections. Interestingly, one striped field mouse (52AA) (only a short KURV sequence was available, which was not included in the phylogenetic analysis) and one common vole (23723MA) were found to be infected simultaneously by KURV and TULV (Fig. 2). Although each of the viruses was detected in a different organ, such coinfection can lead to reassortment or recombination events (39) because the two viruses may encounter each other in the same tissue at a different stage of infection.

Orthohantaviruses, as viruses with a segmented genome, may exchange segments and form reassortants. Unlike orthobunyaviruses, they usually form reassortants within members of the same virus or virus species rather than between two different virus species. The M segment is most likely to be replaced, while the combination of L and S segments usually remains stable (39). Evidence of reassortments is usually revealed as a conflicting topology of virus nucleotide sequences of each genomic segment from the same host individual. Therefore, we compared the phylogenetic position of the L segment sequences to their position in the M segment phylogenetic tree (Fig. 2 and 3). No evidence of interspecies reassortment was found. Nevertheless, while one TULV sequence obtained from a common vole trapped in the Praha-západ district (4MI) grouped with all other sequences from the same locality in the L segment-based phylogenetic tree (Fig. 1), its position in the M segment-based phylogeny indicates possible reassortment between two TULV lineages (Fig. 2). However, because only short sequences of both genome fragments were available, we are not able to distinguish between reassortment and homologous recombination (39).

FIG 3.

FIG 3

Phylogenetic relationships of the obtained sequences of orthohantaviruses inferred by maximum likelihood (ML) analysis of the glycoprotein precursor gene (M segment). The Bayesian inference (BI) tree was mapped onto the ML tree. Numbers at the nodes show bootstrap values derived from the ML analysis/posterior probabilities under the BI analysis. Bootstrap supports and posterior probabilities of <50% and <0.50, respectively, are not provided. Hantaan virus was used as an outgroup. Colors indicate the orthohantaviruses (blue, viruses of the Dobrava-Belgrade orthohantavirus species; red, Tula virus; brown, Seewis virus). Accession numbers for the sequences obtained from GenBank are indicated. Each original sample code consists of the abbreviation of the specific code of the sample, the species of the host, the country code, and the map reference (Fig. 1 and Table 6). HTNV, Hantaan virus; SOCV, Sochi virus; DOBV, Dobrava virus; SAAV, Saaremaa virus; TULV, Tula virus; SWSV, Seewis virus; CZ, Czech Republic; DE, Germany; HR, Croatia; HU, Hungary; KR, South Korea; PL, Poland; SI, Slovenia; SK, Slovakia; RU, Russia; TR, Turkey.

Most studies on trapped rodents have screened only a single tissue type, usually the lungs (21, 35, 49) or the kidneys (63), for orthohantavirus detection. Because there may be differences in the efficiencies of orthohantavirus detection in different tissues, we compared the rates of detection of TULV and KURV in positive individuals in all different available tissue samples. Although the differences were not statistically significant (possibly because of the insufficient number of positive samples and incomplete tissue sample sets from several individuals [see Table S1 in the supplemental material]), our results generally confirmed the observations from previous studies, namely, the low efficiency of detection of KURV (DOBV) compared with TULV in the lungs, the high efficiency of orthohantavirus detection in the liver, and the possibility of detecting orthohantaviral RNA in brain tissues of rodents and shrews (Table S4) (15, 56, 64, 65). Based on our results, we hypothesize that the tissue tropism is virus specific not only in humans but also in natural orthohantavirus rodent hosts and that infection is often multisystemic. These observations need to be confirmed on a larger scale and with a complete sample set that would allow adequate statistical evaluation. Nevertheless, our pilot findings are of great importance because these mechanisms may significantly affect the overall efficiency of orthohantaviral RNA detection.

In addition to rodent-associated orthohantaviruses, RNAs of the shrew-borne orthohantaviruses SWSV and ASIV were also detected in our study. Considering the fact that the shrews were found completely randomly at different, geographically distant locations and yet 3 out of 10 were positive for orthohantavirus RNA (only common shrews), we assume that there is a high prevalence of these orthohantaviruses in shrews in the Czech Republic. SWSV has already been detected several times in central Europe (34, 66), particularly in the Czech Republic (31, 35). Our L segment sequences obtained from common shrews formed a well-supported separate intracluster within the SWSV clade. It is evident that all three sequences from the Czech Republic are distinct from those from Slovakia, Russia, and Finland (19, 67). The SWSV L segment sequence in the GenBank database under accession number JQ425313 (19), from a common shrew, originates from the same district, České Budějovice, where we detected the SWSV-positive sample 5SA. Concerning the time gap between the detection of the two positive common shrews (11 years) and the 99% L segment nucleotide identity (328/330), we can state that after all of these years, SWSV in České Budějovice is still present and circulates in shrews in this area almost unchanged. We also detected ASIV in another common shrew (sample 4SA). ASIV was detected in the Czech Republic and neighboring Germany in both common shrews and Eurasian pygmy shrews. The sympatric occurrence of these species provides an opportunity for spillover infections; however, phylogenetic analyses and the broad geographic distribution of ASIV across Europe in Eurasian pygmy shrews imply that shrews of this species are the primary reservoir hosts (18).

In conclusion, we detected multiple orthohantaviruses in free-living rodents and shrews in the Czech Republic. Moreover, our data suggest possible virus-specific tissue tropism in rodent hosts, a high prevalence of SWSV in common shrews, and a high prevalence of TULV in common voles (with frequent spillover to hosts of other species, including Muridae) in the Czech Republic. Since most of the rodents were trapped in the vicinity of human settlements, and human-pathogenic KURV and potentially pathogenic TULV were found, our results suggest a potential risk to public health.

MATERIALS AND METHODS

Ethical statements.

This study included the trapping of free-living rodents. The trapping and manipulation of the trapped animals were carried out in strict accordance with Czech national laws and guidelines on the use of experimental animals and protection of animals against cruelty (Animal Welfare Act number 246/1992 Coll.). The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of South Bohemia and by the Ministry of the Environment of the Czech Republic (permit numbers 51304/ENV/14-2981/630/14, MZP/2017/630/854, and MZP/2021/630/2459).

Sampling.

From 2016 to 2021, rodents (yellow-necked field mice, striped field mice, wood mice, common voles, and bank voles) were live trapped in 14 areas of the Czech Republic (Table 6 and Fig. 1). Furthermore, randomly found cadavers of shrews (10 individuals) were collected and also subjected to the screening process (Table 2 and Fig. 1).

TABLE 6.

Detailed information on the localities of rodent trapping

Locality ID Locality; district (region) Locality type GPS coordinates (WGS84) Yr(s) of collection
1 Borek; České Budějovice (South Bohemia) Urban area 49°00′45.677″N, 14°29′46.141″E 2016
2 Vltava; České Budějovice (South Bohemia) Urban area (housing estate) 48°59′56.238″N, 14°27′19.339″E 2017
3 Mánesova Street no. 273/9; České Budějovice (South Bohemia) Urban area (house cellar) 48°58′09.730″N, 14°28′45.020″E 2018
4 Švábův Hrádek; České Budějovice (South Bohemia) Rural area (weed) 48°58′16.600″N, 14°26′20.212″E 2020
5 Lužnice, field station U Zahradníků no. 92; Jindřichův Hradec (South Bohemia) Rural area (congress center) 49°04′51.428″N, 14°45′41.266″E 2018
6 Zbytiny-Koryto; Prachatice (South Bohemia) Area of confirmed hantavirus disease in humans 48°55′53.899″N, 14°01′23.761″E 2018
7 Květušín; Český Krumlov (South Bohemia) Area of confirmed hantavirus disease in humans 48°46′56.620″N, 14°07′59.710″E 2021
8 Oldřišov; Opava (Northern Moravia) Rural area (agricultural) 49°58′36.249″N, 17°57′30.491″E 2016
9 Oldřišov, sugar beet field between Oldřišov and Opava; Opava (Northern Moravia) Rural area (agricultural) 49°59′04.414″N, 17°56′47.773″E 2016
10 Weed hill near Hillova Street; Opava (Northern Moravia) Urban area 49°57′11.994″N, 17°54′55.937″E 2016
11 Varnsdorf; Děčín (Northern Bohemia) Rural area (agricultural) 50°55′09.899″N, 14°35′53.808″E 2018, 2019
12 Vestec, Biocev; Praha-západ (Central Bohemia) Urban area (research center complex) 49°58′54.020″N, 14°29′16.572″E 2020
13 Vestec, near the Shell gas station; Praha-západ (Central Bohemia) Urban area 49°59′34.318″N, 14°29′32.185″E 2020
14 Dolní Břežany; Praha-západ (Central Bohemia) Urban area 49°57′44.389″N, 14°27′57.209″E 2020

Sherman live traps (LFA size; H. B. Sherman Traps, Inc., Tallahassee, FL, USA) filled with bait were set in the late evening, spaced approximately 10 m apart, and left in the field overnight. The lungs and occasionally also other visceral organs, liver, kidneys, spleen, brain, and heart, were sampled directly after the animal was killed by cervical dislocation and preserved in an RNA stabilization solution (RNAlater; Invitrogen, Vilnius, Lithuania). Sterile dissection tools were used for each individual and cleansed between samplings of the individual organs. After transport to the laboratory, the samples were stored at −80°C. Detailed data on individual rodents are presented in Table S1 in the supplemental material.

Reservoir hosts of species with overlapping morphologies that are difficult to be distinguished in the field (yellow-necked field mice, wood mice, and shrews) were identified by methods of molecular biology (diagnostic PCR and sequencing) (68, 69).

RNA extraction and reverse transcription.

Individual rodent tissue samples were cleansed from RNAlater and homogenized in sterile phosphate-buffered saline (PBS) as 10% (wt/vol) (liver) or 20% (wt/vol) (all remaining tissue samples) suspensions using an automated homogenizer (Tissue Lyzer II; Qiagen, Hilden, Germany) and sterile 5-mm stainless steel beads at 30 Hz for 2 min (Qiagen, Hilden, Germany). After centrifugation, the supernatant was collected, and RNA isolation was performed using a commercially available silica column-based kit (QIAamp viral RNA minikit; Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Using a high-capacity RNA-to-cDNA kit (Thermo Fisher Scientific, Vilnius, Lithuania) and 5 μL of total RNA as the template, cDNA was synthesized according to the manufacturer’s instructions.

PCR amplification and sequencing. (i) Screening PCR.

All of the available samples were screened for orthohantavirus RNA. Nested PCR with primer pairs Han-L-F1 and Han-L-R1 (first reaction) and Han-L-F2 and Han-L-R2 (second reaction) (Table 7) was used to amplify the partial sequences of the orthohantaviral L segment encoding the RNA-dependent RNA polymerase (70). The first PCR was carried out using a total volume of 25 μL, including 1.0 μL of each primer (10 μM), 12.5 μL of PCR master mix (Combi PPP master mix; Top-Bio, s. r. o., Vestec, Czech Republic), 6.5 μL of PCR-grade water, and 4 μL of synthesized cDNA. The annealing temperature was set based on the best result of the gradient PCR. Parameters for nested PCRs were as follows: an initial denaturation step at 95°C for 6 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 53°C for 30 s, and extension at 72°C for 30 s. The final extension step was performed at 72°C for 3 min. Subsequently, 1 μL of the product of the first PCR was used for the nested reaction according to the same protocol (the missing volume in the PCR mix was filled with PCR-grade water). Individual steps of the detection protocol (nucleic acid extraction, preparation of PCR master mixes, amplification, electrophoresis, and PCR product purification) were performed in separate rooms, using separate equipment. Moreover, PCR master mixes were prepared in a dedicated PCR box, samples and isolated nucleic acids were handled in biohazard boxes, and all working surfaces were decontaminated using bleach and UV light before and after the work.

TABLE 7.

Primers used for the screening of rodent tissue samples and sequencing of orthohantavirus-positive samples

Primer name Primer sequence Directiona Annealing temp (°C) Approximate size of PCR product (bp) Target Reference
HAN-L-F1 ATGTAYGTBAGTGCWGATGC F 53 420 L segment 70
HAN-L-R1 AACCADTCWGTYCCRTCATC R
HAN-L-F2 TGCWGATGCHACIAARTGGTC F 53 390
HAN-L-R2 GCRTCRTCWGARTGRTGDGCAA R
1470c CCIGGITTICATGGITGGGC F 40 600 DOBV M segment 16
2029R CCATGIGCITTITCIKTCCA R
1674F TGTGAIKTITGIAAITAIGAGTGTGA F 40 320
1990R TCIGMTGCISTIGCIGCCCA R
28F AATTGAAAAGGTGAAGCAGG F 50 460 TULV M segment This study
492R GCAGATGATGGTAGGGAAAA R
a

F, forward; R, reverse.

(ii) M segment-specific PCR.

Samples positive for RNA of the viruses belonging to the Dobrava-Belgrade orthohantavirus species (according to the sequencing of the screening PCR product) were submitted for amplification of the partial sequence of the orthohantaviral M segment encoding the Gn and Gc glycoprotein precursors. The PCR mixtures were prepared as described above for the screening nested PCR, employing the primer pairs 1470c and 2029R (first PCR) and 1674F and 1990R (second PCR) (16) (Table 7). The parameters for PCR were as follows: an initial denaturation step at 95°C for 6 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 40°C for 30 s, and extension at 72°C for 30 s. The final extension step was performed at 72°C for 3 min. Primer pair 28F and 492R (Table 7) was used for TULV-positive samples, according to the protocol and parameters described above, except that the annealing temperature was 50°C.

Processing of the PCR products and sequencing.

PCR amplicons were visualized on a 2% agarose gel using Sybr green (Life Technologies Europe, Bleiswijk, the Netherlands) under UV light (Uvitec, Cambridge, United Kingdom). PCR products of the expected sizes were purified using 0.2 μL of FastAP (thermosensitive alkaline phosphatase) and 0.2 μL of Exo I (exonuclease I from Escherichia coli) enzymes (Thermo Fisher Scientific, Waltham, MA, USA). Enzymatic digestion was carried out in a thermocycler at 37°C for 15 min, followed by enzyme inactivation at 80°C for 15 min. The purified PCR products were directly sequenced via the Sanger sequencing method by Macrogen, Inc. (Amsterdam, the Netherlands), on an automatic 3730XL DNA analyzer (https://www.macrogen-europe.com/services/sanger-sequencing/standard). The obtained sequences were verified by the BLAST algorithm (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and adjusted using Sequence Scanner v2.0 (https://products.appliedbiosystems.com). The EditSeq and SeqMan v5.05 programs (DNASTAR Inc., Madison, WI, USA) were used to assemble the sequences.

Phylogenetic analyses.

The obtained partial sequences of the L and M genomic segments of orthohantaviruses from rodents and shrews, together with the sequences of related orthohantaviruses available in the GenBank database, were used for phylogenetic analyses. The data set was aligned with the BioEdit v7.2.5 program (71), using the ClustalW multiple-alignment algorithm (72). The resultant alignment was manually trimmed to a uniform length. For the reconstruction of phylogenetic relationships, two approaches were used: Bayesian inference (BI), performed using MrBayes v3.2.2 (73), and maximum likelihood (ML), performed using PhyML v2.4.3 (74). The most suitable evolutionary models were selected by jModeltest (75, 76). BI analysis was calculated under the GTR+Γ+I evolutionary model; the Markov chain Monte Carlo (MCMC) method was specified for 10 million generations, with a frequency of collection of every 500 generations, and the burn-in was set to 25%. ML was also conducted using the GTR+Γ+I model, and bootstrap values were calculated with 1,000 replicates. The resultant phylogenetic trees were visualized and exported in TreeView v1.6.6 (77) and graphically edited in Adobe Illustrator CC v2017.0.2 (Adobe Systems, Inc.).

Statistical analyses.

Differences in orthohantavirus prevalences between female and male hosts as well as differences in the prevalences of particular orthohantavirus species in individual tissue samples were tested using Fisher’s exact test (GraphPad Prism v9.3.1; GraphPad Software, CA, USA). Differences with P values of <0.05 were considered statistically significant.

Data availability.

Nucleotide sequences were deposited in the NCBI GenBank database (www.ncbi.nlm.nih.gov) under the accession numbers ON243777 to ON243817 and ON653425 to ON653442 (see Tables S2 and S3 in the supplemental material).

ACKNOWLEDGMENTS

We are grateful to Aneta Trefancová, Hynek Mazanec, Jiří Ťápal (Faculty of Science, University of South Bohemia, České Budějovice, Czech Republic), and Václav Mikeš (Museum of South Bohemia in České Budějovice, Czech Republic), who participated in the field studies, and Petra Straková (Veterinary Research Institute, Brno, and Biology Centre CAS, České Budějovice), who provided us with positive controls and valuable methodological advice.

This work was supported by the Ministry of Education, Youth, and Sports (MŠMT) of the Czech Republic with the award of OPVVV Project FIT (CZ.02.1.01/0.0/0.0/15_003/0000495), which is financially supported by the European Fund for Regional Development. This work was also supported by financial resources of the Department of Parasitology (Faculty of Science, University of South Bohemia, České Budějovice) and the Laboratory of Arbovirology (Biology Centre CAS, České Budějovice). This work was also supported by the project National Institute of virology and bacteriology (Programme EXCELES, ID Project No. LX22NPO5103) - Funded by the European Union - Next Generation EU. Pavel Stopka, Jana Kvičerová, and Tereza Matějková were supported by the MICOBION teaming project funded by European Union Horizon 2020 program (number 810224). Tereza Matějková was supported by the Grant Agency of Charles University (GAUK) (number 1191419).

We report that there are no competing interests to declare.

Václav Hönig, conceptualization, formal analysis, methodology, project administration, supervision, validation, original draft preparation, and writing – review and editing. Jan Kamiš, data curation, formal analysis, investigation, methodology, resources, visualization, writing – original draft preparation, and writing – review and editing. Aneta Maršíková, investigation, methodology, resources, and original draft preparation. Tereza Matějková, investigation and resources. Pavel Stopka, investigation, resources, and funding acquisition. Anna Mácová, investigation, resources, and writing – review and editing. Daniel Růžek, funding acquisition, supervision, and writing – review and editing. Jana Kvičerová, conceptualization, data curation, formal analysis, funding acquisition, methodology, resources, supervision, validation, original draft preparation, and writing – review and editing.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Tables S1 to S4. Download spectrum.01306-22-s0001.pdf, PDF file, 0.5 MB (519.3KB, pdf)

Contributor Information

Václav Hönig, Email: honig@paru.cas.cz.

Mathilde Richard, Erasmus MC.

REFERENCES

  • 1.Laenen L, Vergote V, Calisher CH, Klempa B, Klingström J, Kuhn JH, Maes P. 2019. Hantaviridae: current classification and future perspectives. Viruses 11:788. doi: 10.3390/v11090788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kuhn JH, Adkins S, Agwanda BR, Al Kubrusli R, Alkhovsky SV, Amarasinghe GK, Avšič-Županc T, Ayllón MA, Bahl J, Balkema-Buschmann A, Ballinger MJ, Basler CF, Bavari S, Beer M, Bejerman N, Bennett AJ, Bente DA, Bergeron É, Bird BH, Blair CD, Blasdell KR, Blystad D-R, Bojko J, Borth WB, Bradfute S, Breyta R, Briese T, Brown PA, Brown JK, Buchholz UJ, Buchmeier MJ, Bukreyev A, Burt F, Büttner C, Calisher CH, Cao M, Casas I, Chandran K, Charrel RN, Cheng Q, Chiaki Y, Chiapello M, Choi I-R, Ciuffo M, Clegg JCS, Crozier I, Dal Bó E, de la Torre JC, de Lamballerie X, de Swart RL, et al. 2021. 2021 taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales. Arch Virol 166:3513–3566. doi: 10.1007/s00705-021-05143-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Krüger DH, Schönrich G, Klempa B. 2011. Human pathogenic hantaviruses and prevention of infection. Hum Vaccin 7:685–693. doi: 10.4161/hv.7.6.15197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sibold C, Ulrich R, Labuda M, Lundkvist Å, Martens H, Schütt M, Gerke P, Leitmeyer K, Meisel H, Krüger DH. 2001. Dobrava hantavirus causes hemorrhagic fever with renal syndrome in central Europe and is carried by two different Apodemus mice species. J Med Virol 63:158–167. [PubMed] [Google Scholar]
  • 5.Avšič-Županc T, Saksida A, Korva M. 2019. Hantavirus infections. Clin Microbiol Infect 21S:e6–e16. doi: 10.1111/1469-0691.12291. [DOI] [PubMed] [Google Scholar]
  • 6.Jonsson CB, Figueiredo LTM, Vapalahti O. 2010. A global perspective on hantavirus ecology, epidemiology, and disease. Clin Microbiol Rev 23:412–441. doi: 10.1128/CMR.00062-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Klempa B, Avsic-Zupanc T, Clement J, Dzagurova TK, Henttonen H, Heyman P, Jakab F, Kruger DH, Maes P, Papa A, Tkachenko EA, Ulrich RG, Vapalahti O, Vaheri A. 2013. Complex evolution and epidemiology of Dobrava-Belgrade hantavirus: definition of genotypes and their characteristics. Arch Virol 158:521–529. doi: 10.1007/s00705-012-1514-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Klempa B, Radosa L, Kruger DH. 2013. The broad spectrum of hantaviruses and their hosts in central Europe. Acta Virol 57:130–137. doi: 10.4149/av_2013_02_130. [DOI] [PubMed] [Google Scholar]
  • 9.Plyusnin A, Morzunov SP. 2001. Virus evolution and genetic diversity of hantaviruses and their rodent hosts. Curr Top Microbiol Immunol 256:47–75. doi: 10.1007/978-3-642-56753-7_4. [DOI] [PubMed] [Google Scholar]
  • 10.Yanagihara R, Gu SH, Arai S, Kang HJ, Song J-W. 2014. Hantaviruses: rediscovery and new beginnings. Virus Res 187:6–14. doi: 10.1016/j.virusres.2013.12.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhang Y-Z. 2014. Discovery of hantaviruses in bats and insectivores and the evolution of the genus Hantavirus. Virus Res 187:15–21. doi: 10.1016/j.virusres.2013.12.035. [DOI] [PubMed] [Google Scholar]
  • 12.Watson DC, Sargianou M, Papa A, Chra P, Starakis I, Panos G. 2014. Epidemiology of hantavirus infections in humans: a comprehensive, global overview. Crit Rev Microbiol 40:261–272. doi: 10.3109/1040841X.2013.783555. [DOI] [PubMed] [Google Scholar]
  • 13.Guo W-P, Lin X-D, Wang W, Tian J-H, Cong M-L, Zhang H-L, Wang M-R, Zhou R-H, Wang J-B, Li M-H, Xu J, Holmes EC, Zhang Y-Z. 2013. Phylogeny and origins of hantaviruses harbored by bats, insectivores, and rodents. PLoS Pathog 9:e1003159. doi: 10.1371/journal.ppat.1003159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Heyman P, Plyusnina A, Berny P, Cochez C, Artois M, Zizi M, Pirnay JP, Plyusnin A. 2004. Seoul hantavirus in Europe: first demonstration of the virus genome in wild Rattus norvegicus captured in France. Eur J Clin Microbiol Infect Dis 23:711–717. doi: 10.1007/s10096-004-1196-3. [DOI] [PubMed] [Google Scholar]
  • 15.Madai M, Horváth G, Herczeg R, Somogyi B, Zana B, Földes F, Kemenesi G, Kurucz K, Papp H, Zeghbib S, Jakab F. 2021. Effectiveness regarding hantavirus detection in rodent tissue samples and urine. Viruses 13:570. doi: 10.3390/v13040570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Papa A, Zelená H, Barnetová D, Petroušová L. 2010. Genetic detection of Dobrava/Belgrade virus in a Czech patient with haemorrhagic fever with renal syndrome. Clin Microbiol Infect 16:1187–1190. doi: 10.1111/j.1469-0691.2009.03075.x. [DOI] [PubMed] [Google Scholar]
  • 17.Verner-Carlsson J, Lõhmus M, Sundström K, Strand TM, Verkerk M, Reusken C, Yoshimatsu K, Arikawa J, van de Goot F, Lundkvist Å. 2015. First evidence of Seoul hantavirus in the wild rat population in the Netherlands. Infect Ecol Epidemiol 5:27215. doi: 10.3402/iee.v5.27215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Radosa L, Schlegel M, Gebauer P, Ansorge H, Heroldová M, Jánová E, Stanko M, Mošanský L, Fričová J, Pejčoch M, Suchomel J, Purchart L, Groschup MH, Krüger DH, Ulrich RG, Klempa B. 2013. Detection of shrew-borne hantavirus in Eurasian pygmy shrew (Sorex minutus) in central Europe. Infect Genet Evol 19:403–410. doi: 10.1016/j.meegid.2013.04.008. [DOI] [PubMed] [Google Scholar]
  • 19.Schlegel M, Radosa L, Rosenfeld UM, Schmidt S, Triebenbacher C, Löhr P-W, Fuchs D, Heroldová M, Jánová E, Stanko M, Mošanský L, Fričová J, Pejčoch M, Suchomel J, Purchart L, Groschup MH, Krüger DH, Klempa B, Ulrich RG. 2012. Broad geographical distribution and high genetic diversity of shrew-borne Seewis hantavirus in central Europe. Virus Genes 45:48–55. doi: 10.1007/s11262-012-0736-7. [DOI] [PubMed] [Google Scholar]
  • 20.Heyman P, Vaheri A, ENIVD Members . 2008. Situation of hantavirus infections and haemorrhagic fever with renal syndrome in European countries as of December 2006. Euro Surveill 13:18925. doi: 10.2807/ese.13.28.18925-en. [DOI] [PubMed] [Google Scholar]
  • 21.Klempa B, Stanko M, Labuda M, Ulrich R, Meisel H, Krüger DH. 2005. Central European Dobrava hantavirus isolate from a striped field mouse (Apodemus agrarius). J Clin Microbiol 43:2756–2763. doi: 10.1128/JCM.43.6.2756-2763.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Vapalahti O, Mustonen J, Lundkvist A, Henttonen H, Plyusnin A, Vaheri A. 2003. Hantavirus infections in Europe. Lancet Infect Dis 3:653–661. doi: 10.1016/s1473-3099(03)00774-6. [DOI] [PubMed] [Google Scholar]
  • 23.Lee S-H, No JS, Kim W-K, Gajda E, Perec-Matysiak A, Kim J-A, Hildebrand J, Yanagihara R, Song J-W. 2020. Molecular epidemiology and genetic diversity of orthohantaviruses in small mammals in western Poland. Am J Trop Med Hyg 103:193–199. doi: 10.4269/ajtmh.19-0802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nemirov K, Vapalahti O, Lundkvist A, Vasilenko V, Golovljova I, Plyusnina A, Niemimaa J, Laakkonen J, Henttonen H, Vaheri A, Plyusnin A. 1999. Isolation and characterization of Dobrava hantavirus carried by the striped field mouse (Apodemus agrarius) in Estonia. J Gen Virol 80:371–379. doi: 10.1099/0022-1317-80-2-371. [DOI] [PubMed] [Google Scholar]
  • 25.Tkachenko EA, Okulova NM, Iunicheva IV, Morzunov SP, Khaĭbulina SF, Riabova TE, Vasilenko LE, Bashkirtsev VN, Dzagurova TK, Gorbachkova EA, Sedova NS, Balakirev AE, Dekonenko AE, Drozdov SG. 2005. The epizootological and virological characteristics of a natural hantavirus infection focus in the subtropic zone of the Krasnodarsk Territory. Vopr Virusol 50:14–19. (In Russian.) [PubMed] [Google Scholar]
  • 26.Kariwa H, Tkachenko EA, Morozov VG, Seto T, Tanikawa Y, Kolominov SI, Belov SN, Nakamura I, Hashimoto N, Balakiev AE, Dzagurnova TK, Daud NHBA, Miyashita D, Medvedkina OA, Nakauchi M, Ishizuka M, Yoshii K, Yoshimatsu K, Arikawa J, Takashima I. 2009. Epidemiological study of hantavirus infection in the Samara Region of European Russia. J Vet Med Sci 71:1569–1578. doi: 10.1292/jvms.001569. [DOI] [PubMed] [Google Scholar]
  • 27.Avšič Županc T, Korva M, Markotić A. 2014. HFRS and hantaviruses in the Balkans/south-east Europe. Virus Res 187:27–33. doi: 10.1016/j.virusres.2013.12.042. [DOI] [PubMed] [Google Scholar]
  • 28.Plyusnina A, Heyman P, Baert K, Stuyck J, Cochez C, Plyusnin A. 2012. Genetic characterization of Seoul hantavirus originated from Norway rats (Rattus norvegicus) captured in Belgium. J Med Virol 84:1298–1303. doi: 10.1002/jmv.23321. [DOI] [PubMed] [Google Scholar]
  • 29.Heroldová M, Pejcoch M, Bryja J, Jánová E, Suchomel J, Tkadlec E. 2010. Tula virus in populations of small terrestrial mammals in a rural landscape. Vector Borne Zoonotic Dis 10:599–603. doi: 10.1089/vbz.2009.0211. [DOI] [PubMed] [Google Scholar]
  • 30.Plyusnin A, Vapalahti O, Lankinen H, Lehväslaiho H, Apekina N, Myasnikov Y, Kallio-Kokko H, Henttonen H, Lundkvist A, Brummer-Korvenkontio M. 1994. Tula virus: a newly detected hantavirus carried by European common voles. J Virol 68:7833–7839. doi: 10.1128/JVI.68.12.7833-7839.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Schlegel M, Kindler E, Essbauer SS, Wolf R, Thiel J, Groschup MH, Heckel G, Oehme RM, Ulrich RG. 2012. Tula virus infections in the Eurasian water vole in central Europe. Vector Borne Zoonotic Dis 12:503–513. doi: 10.1089/vbz.2011.0784. [DOI] [PubMed] [Google Scholar]
  • 32.Klempa B, Meisel H, Räth S, Bartel J, Ulrich R, Krüger DH. 2003. Occurrence of renal and pulmonary syndrome in a region of northeast Germany where Tula hantavirus circulates. J Clin Microbiol 41:4894–4897. doi: 10.1128/JCM.41.10.4894-4897.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zelená H, Mrázek J, Kuhn T. 2013. Tula hantavirus infection in immunocompromised host, Czech Republic. Emerg Infect Dis 19:1873–1876. doi: 10.3201/eid1911.130421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Song J-W, Gu SH, Bennett SN, Arai S, Puorger M, Hilbe M, Yanagihara R. 2007. Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus). Virol J 4:114. doi: 10.1186/1743-422X-4-114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zelená H, Straková P, Heroldová M, Mrázek J, Kastl T, Zakovska A, Ruzek D, Smetana J, Rudolf I. 2019. Molecular epidemiology of hantaviruses in the Czech Republic. Emerg Infect Dis 25:2133–2135. doi: 10.3201/eid2511.190449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sironen T, Voutilainen L, Isoviita V-M, Niemimaa J, Vaheri A, Vapalahti O, Henttonen H. 2010. Isolation and characterization of novel insectivore-borne hantaviruses from Finland, VIII. International Conference on HFRS, HPS & Hantaviruses, Beijing, China. [Google Scholar]
  • 37.Holmes EC, Zhang Y-Z. 2015. The evolution and emergence of hantaviruses. Curr Opin Virol 10:27–33. doi: 10.1016/j.coviro.2014.12.007. [DOI] [PubMed] [Google Scholar]
  • 38.Jiang F, Wang L, Wang S, Zhu L, Dong L, Zhang Z, Hao B, Yang F, Liu W, Deng Y, Zhang Y, Ma Y, Pan B, Han Y, Ren H, Cao G. 2017. Meteorological factors affect the epidemiology of hemorrhagic fever with renal syndrome via altering the breeding and hantavirus-carrying states of rodents and mites: a 9 years’ longitudinal study. Emerg Microbes Infect 6:e104. doi: 10.1038/emi.2017.92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Klempa B. 2018. Reassortment events in the evolution of hantaviruses. Virus Genes 54:638–646. doi: 10.1007/s11262-018-1590-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.National Institute of Public Health. 2021. Incidence of selected infectious diseases in the Czech Republic: incidence rates per 100,000 population in the years 2012-2021. National Institute of Public Health, Prague, Czech Republic. [Google Scholar]
  • 41.Krüger DH, Figueiredo LTM, Song J-W, Klempa B. 2015. Hantaviruses—globally emerging pathogens. J Clin Virol 64:128–136. doi: 10.1016/j.jcv.2014.08.033. [DOI] [PubMed] [Google Scholar]
  • 42.Heyman P, Ceianu CS, Christova I, Tordo N, Beersma M, Alves MJ, Lundkvist Å, Hukic M, Papa A, Tenorio A, Zelená H, Eßbauer S, Visontai I, Golovljova I, Connell J, Nicoletti L, Esbroeck MV, Dudman SG, Aberle SW, Avšić-Županc T, Korukluoglu G, Nowakowska A, Klempa B, Ulrich RG, Bino S, Engler O, Opp M, Vaheri A. 2011. A five-year perspective on the situation of haemorrhagic fever with renal syndrome and status of the hantavirus reservoirs in Europe, 2005-2010. Euro Surveill 16:19961. doi: 10.2807/ese.16.36.19961-en. [DOI] [PubMed] [Google Scholar]
  • 43.Faber M, Krüger DH, Auste B, Stark K, Hofmann J, Weiss S. 2019. Molecular and epidemiological characteristics of human Puumala and Dobrava-Belgrade hantavirus infections, Germany, 2001 to 2017. Euro Surveill 24:1800675. doi: 10.2807/1560-7917.ES.2019.24.32.1800675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Vaheri A, Henttonen H, Voutilainen L, Mustonen J, Sironen T, Vapalahti O. 2013. Hantavirus infections in Europe and their impact on public health. Rev Med Virol 23:35–49. doi: 10.1002/rmv.1722. [DOI] [PubMed] [Google Scholar]
  • 45.European Centre for Disease Prevention and Control. 2021. Hantavirus infection: annual epidemiological report for 2019. European Centre for Disease Prevention and Control, Stockholm, Sweden. [Google Scholar]
  • 46.Camp JV, Schmon E, Krause R, Sixl W, Schmid D, Aberle SW. 2021. Genetic diversity of Puumala orthohantavirus in rodents and human patients in Austria, 2012-2019. Viruses 13:640. doi: 10.3390/v13040640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Hofmann J, Meier M, Enders M, Führer A, Ettinger J, Klempa B, Schmidt S, Ulrich RG, Kruger DH. 2014. Hantavirus disease in Germany due to infection with Dobrava-Belgrade virus genotype Kurkino. Clin Microbiol Infect 20:O648–O655. doi: 10.1111/1469-0691.12543. [DOI] [PubMed] [Google Scholar]
  • 48.Dusek J, Pejcoch M, Kolsky A, Seeman T, Nemec V, Stejskal J, Vondrak K, Janda J. 2006. Mild course of Puumala nephropathy in children in an area with sporadic occurrence hantavirus infection. Pediatr Nephrol 21:1889–1892. doi: 10.1007/s00467-006-0250-z. [DOI] [PubMed] [Google Scholar]
  • 49.Pejčoch M, Unar J, Kříž B, Pauchová E, Rose R. 2010. Characterization of a natural focus of Puumala hantavirus infection in the Czech Republic. Cent Eur J Public Health 18:116–118. doi: 10.21101/cejph.a3611. [DOI] [PubMed] [Google Scholar]
  • 50.Weidmann M, Schmidt P, Vackova M, Krivanec K, Munclinger P, Hufert FT. 2005. Identification of genetic evidence for Dobrava virus spillover in rodents by nested reverse transcription (RT)-PCR and TaqMan RT-PCR. J Clin Microbiol 43:808–812. doi: 10.1128/JCM.43.2.808-812.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Pejčoch M, Kříž B. 2003. Hantaviruses in the Czech Republic. Emerg Infect Dis 9:756–757. doi: 10.3201/eid0906.020772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Vapalahti O, Lundkvist A, Kukkonen SK, Cheng Y, Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A. 1996. Isolation and characterization of Tula virus, a distinct serotype in the genus Hantavirus, family Bunyaviridae. J Gen Virol 77(Part 12):3063–3067. doi: 10.1099/0022-1317-77-12-3063. [DOI] [PubMed] [Google Scholar]
  • 53.Reynes JM, Carli D, Boukezia N, Debruyne M, Herti S. 2015. Tula hantavirus infection in a hospitalised patient, France, June 2015. Euro Surveill 20:30095. doi: 10.2807/1560-7917.ES.2015.20.50.30095. [DOI] [PubMed] [Google Scholar]
  • 54.Voutilainen L, Savola S, Kallio ER, Laakkonen J, Vaheri A, Vapalahti O, Henttonen H. 2012. Environmental change and disease dynamics: effects of intensive forest management on Puumala hantavirus infection in boreal bank vole populations. PLoS One 7:e39452. doi: 10.1371/journal.pone.0039452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Korva M, Knap N, Resman Rus K, Fajs L, Grubelnik G, Bremec M, Knapič T, Trilar T, Avšič Županc T. 2013. Phylogeographic diversity of pathogenic and non-pathogenic hantaviruses in Slovenia. Viruses 5:3071–3087. doi: 10.3390/v5123071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Schmidt-Chanasit J, Essbauer S, Petraityte R, Yoshimatsu K, Tackmann K, Conraths FJ, Sasnauskas K, Arikawa J, Thomas A, Pfeffer M, Scharninghausen JJ, Splettstoesser W, Wenk M, Heckel G, Ulrich RG. 2010. Extensive host sharing of central European Tula virus. J Virol 84:459–474. doi: 10.1128/JVI.01226-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Nemirov K, Henttonen H, Vaheri A, Plyusnin A. 2002. Phylogenetic evidence for host switching in the evolution of hantaviruses carried by Apodemus mice. Virus Res 90:207–215. doi: 10.1016/s0168-1702(02)00179-x. [DOI] [PubMed] [Google Scholar]
  • 58.Plyusnin A, Vaheri A, Lundkvist Å. 2006. Saaremaa hantavirus should not be confused with its dangerous relative, Dobrava virus. J Clin Microbiol 44:1608–1611. doi: 10.1128/JCM.44.4.1608-1611.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Hjelle B, Yates T. 2001. Modeling hantavirus maintenance and transmission in rodent communities. Curr Top Microbiol Immunol 256:77–90. doi: 10.1007/978-3-642-56753-7_5. [DOI] [PubMed] [Google Scholar]
  • 60.Klingström J, Heyman P, Escutenaire S, Sjölander KB, De Jaegere F, Henttonen H, Lundkvist A. 2002. Rodent host specificity of European hantaviruses: evidence of Puumala virus interspecific spillover. J Med Virol 68:581–588. doi: 10.1002/jmv.10232. [DOI] [PubMed] [Google Scholar]
  • 61.Schmidt S, Saxenhofer M, Drewes S, Schlegel M, Wanka KM, Frank R, Klimpel S, von Blanckenhagen F, Maaz D, Herden C, Freise J, Wolf R, Stubbe M, Borkenhagen P, Ansorge H, Eccard JA, Lang J, Jourdain E, Jacob J, Marianneau P, Heckel G, Ulrich RG. 2016. High genetic structuring of Tula hantavirus. Arch Virol 161:1135–1149. doi: 10.1007/s00705-016-2762-6. [DOI] [PubMed] [Google Scholar]
  • 62.Schlegel M, Klempa B, Auste B, Bemmann M, Schmidt-Chanasit J, Büchner T, Groschup MH, Meier M, Balkema-Buschmann A, Zoller H, Krüger DH, Ulrich RG. 2009. Dobrava-Belgrade virus spillover infections, Germany. Emerg Infect Dis 15:2017–2020. doi: 10.3201/eid1512.090923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Avšič Županc T, Nemirov K, Petrovec M, Trilar T, Poljak M, Vaheri A, Plyusnin A. 2000. Genetic analysis of wild-type Dobrava hantavirus in Slovenia: co-existence of two distinct genetic lineages within the same natural focus. J Gen Virol 81:1747–1755. doi: 10.1099/0022-1317-81-7-1747. [DOI] [PubMed] [Google Scholar]
  • 64.Dervović E, Hukić M. 2016. Detection of Puumala virus in the tissue of infected naturally rodent hosts in the area of central Dinarides. J Virol Methods 230:24–27. doi: 10.1016/j.jviromet.2016.01.007. [DOI] [PubMed] [Google Scholar]
  • 65.Maas M, van Heteren M, de Vries A, Kuiken T, Hoornweg T, Veldhuis Kroeze E, Rockx B. 2019. Seoul virus tropism and pathology in naturally infected feeder rats. Viruses 11:531. doi: 10.3390/v11060531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Resman K, Korva M, Fajs L, Zidarič T, Trilar T, Županc TA. 2013. Molecular evidence and high genetic diversity of shrew-borne Seewis virus in Slovenia. Virus Res 177:113–117. doi: 10.1016/j.virusres.2013.07.011. [DOI] [PubMed] [Google Scholar]
  • 67.Ling J, Smura T, Tamarit D, Huitu O, Voutilainen L, Henttonen H, Vaheri A, Vapalahti O, Sironen T. 2018. Evolution and postglacial colonization of Seewis hantavirus with Sorex araneus in Finland. Infect Genet Evol 57:88–97. doi: 10.1016/j.meegid.2017.11.010. [DOI] [PubMed] [Google Scholar]
  • 68.Bellinvia E. 2004. A phylogenetic study of the genus Apodemus by sequencing the mitochondrial DNA control region. J Zool Syst Ecol Res 42:289–297. doi: 10.1111/j.1439-0469.2004.00270.x. [DOI] [Google Scholar]
  • 69.Schlegel M, Ali HS, Stieger N, Groschup MH, Wolf R, Ulrich RG. 2012. Molecular identification of small mammal species using novel cytochrome b gene-derived degenerated primers. Biochem Genet 50:440–447. doi: 10.1007/s10528-011-9487-8. [DOI] [PubMed] [Google Scholar]
  • 70.Klempa B, Fichet-Calvet E, Lecompte E, Auste B, Aniskin V, Meisel H, Denys C, Koivogui L, ter Meulen J, Krüger DH. 2006. Hantavirus in African wood mouse, Guinea. Emerg Infect Dis 12:838–840. doi: 10.3201/eid1205.051487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Hall T. 1999. Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
  • 72.Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 74.Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52:696–704. doi: 10.1080/10635150390235520. [DOI] [PubMed] [Google Scholar]
  • 75.Posada D. 2008. jModelTest: phylogenetic model averaging. Mol Biol Evol 25:1253–1256. doi: 10.1093/molbev/msn083. [DOI] [PubMed] [Google Scholar]
  • 76.Posada D. 2009. Selection of models of DNA evolution with jModelTest. Methods Mol Biol 537:93–112. doi: 10.1007/978-1-59745-251-9_5. [DOI] [PubMed] [Google Scholar]
  • 77.Page RD. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357–358. doi: 10.1093/bioinformatics/12.4.357. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Tables S1 to S4. Download spectrum.01306-22-s0001.pdf, PDF file, 0.5 MB (519.3KB, pdf)

Data Availability Statement

Nucleotide sequences were deposited in the NCBI GenBank database (www.ncbi.nlm.nih.gov) under the accession numbers ON243777 to ON243817 and ON653425 to ON653442 (see Tables S2 and S3 in the supplemental material).


Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES