Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2022 Aug 29;10(5):e01338-22. doi: 10.1128/spectrum.01338-22

Effect of Intragenomic Sequence Heterogeneity among Multiple 16S rRNA Genes on Species Identification of Elizabethkingia

Jiun-Nong Lin a,b,c,d,, Chung-Hsu Lai c,d, Shang-Yi Lin e, Ching-Chi Lee f, Nan-Yao Lee g,h, Po-Yu Liu i, Chih-Hui Yang j, Yi-Han Huang a
Editor: Susan Realegenok
PMCID: PMC9604143  PMID: 36036645

ABSTRACT

Accurate identification of Elizabethkingia species mostly requires the use of molecular techniques, and 16S rRNA gene sequencing is generally considered the method of choice. In this study, we evaluated the effect of intraspecific diversity among the multiple copies of the 16S rRNA gene on the accuracy of species identification in the genus Elizabethkingia. Sequences of 16S rRNA genes obtained from the 32 complete whole-genome sequences of Elizabethkingia deposited in GenBank and from 218 clinical isolates collected from 5 hospitals in Taiwan were analyzed. Four or five copies of 16S rRNA were identified in the Elizabethkingia species with complete genome sequences. The dissimilarity among the copies of the16S rRNA gene was <1% in all Elizabethkingia strains. E. meningoseptica demonstrated a significantly higher rate of nucleotide variations in the 16S rRNA than did E. anophelis (P = 0.011). Nucleotide alterations occurred more frequently in regions V2 and V6 than in other hypervariable regions (P < 0.001). E. meningoseptica, E. anophelis, and E. argenteiflava strains were clustered distinctly in the phylogenetic tree inferred from 16S rRNA genes, and the intragenomic variation of gene sequences had no profound effect on the classification of taxa. However, E. miricola, E. bruuniana, E. ursingii, and E. occulta were grouped closely in the phylogenetic analysis, and the variation among the multiple copies of the 16S rRNA in one E. ursingii strain affected species classification. Other marker genes may be required to supplement the species classification of closely related taxa in the genus Elizabethkingia.

IMPORTANCE Incorrect identification of bacterial species would influence the epidemiology and clinical analysis of patients infected with Elizabethkingia. The results of the present study suggest that 16S rRNA gene sequencing should not be considered the gold standard for the accurate identification of Elizabethkingia species.

KEYWORDS: Elizabethkingia, 16S rRNA, phylogenetic analysis

INTRODUCTION

The 16S rRNA gene, a small-subunit rRNA gene, is frequently considered the gold standard for bacterial phylogenetic analysis and taxonomic classification, because it is universally present in bacteria and contains highly conservative fragments that are beneficial for designing PCR primers, hypervariable regions that enable species-level discrimination, and an adequate sequence length that can be used for sequencing (1, 2). However, bacterial genomes may contain 1 to 17 copies of the 16S rRNA gene, and sequence variations among multiple copies have been identified in many microbes (310). This intragenomic sequence heterogeneity may bias the identification of microbial species (911).

Bacteria in the genus Elizabethkingia are aerobic Gram-negative bacilli that can cause life-threatening infection in humans, particularly in immunocompromised patients (12, 13). Seven species comprise the genus Elizabethkingia, namely, E. meningoseptica, E. miricola, E. anophelis, E. bruuniana, E. ursingii, E. occulta, and E. argenteiflava (14, 15). However, species identification methods commonly employed in clinical microbiology laboratories, such as traditional biochemical techniques and matrix-assisted laser desorption ionization–time-of-flight mass spectrometry (MALDI–TOF MS), cannot correctly recognize all these species. Accurate identification can only be achieved through molecular techniques (14, 16).

Most recent studies investigating Elizabethkingia have performed 16S rRNA gene sequencing for species identification (13). However, differences among multiple 16S rRNA genes and the effects of intraspecific sequence variations on species identification in Elizabethkingia remain unclear. In this study, we investigated nucleotide variations among the multiple copies of the 16S rRNA gene in Elizabethkingia obtained from the National Center for Biotechnology Information (NCBI) genome sequence repository and clinical isolates collected from multiple hospitals in Taiwan. In addition, we examined the effect of intragenomic sequence heterogeneity among different 16S rRNA genes on the taxonomic classification of Elizabethkingia species.

RESULTS

Copy number and variations in 16S rRNA in whole-genome sequences.

Among the 32 whole-genome Elizabethkingia sequences, 6 strains (18.8%; 4 E. meningoseptica and 2 E. anophelis strains) had 4 copies of 16S rRNA genes; the other 26 Elizabethkingia strains (81.3%) had 5 copies of 16S rRNA genes. Intraspecific differences in sequences in 16S rRNA gene pairs for each genome are displayed in Table 1. The corresponding minimal similarity ranged from 99.41% (E. ursingii strain G4123) to 100% (99.94% ± 0.14% [mean ± standard deviation]). The number of nucleotide variations within a given genome ranged from 1 to 4 in most of the strains. However, E. ursingii strain G4123 had 15 nucleotide variations distributed in the 5 copies of the 16S rRNA gene.

TABLE 1.

Copy number and nucleotide alterations of 16S rRNA in Elizabethkingia species with complete whole-genome sequencesa

Species Strain GenBank accession no. rRNA copy no. rRNA difference copy no. Nucleotide identity (%) Nucleotide alteration(s)b
E. meningoseptica KC1913 CP035809.1 4 2 99.87 G195T, A196G
E. meningoseptica F2 CP050128.1 4 2 99.87 A195C, C196T
E. meningoseptica G4120 CP016378.1 4 0 100
E. meningoseptica G4076 CP016376.1 4 1 99.87 G195T, A196G
E. anophelis R26 CP023401.1 5 0 100
E. anophelis JM-87 CP016372.1 5 0 100
E. anophelis NUHP1 CP007547.1 5 0 100
E. anophelis JUNP 353 AP022313.1 5 0 100
E. anophelis F3201 CP016374.1 5 0 100
E. anophelis 296-96 CP046080.1 5 0 100
E. anophelis SUE CP034247.1 5 0 100
E. anophelis E6809 CP014339.1 5 0 100
E. anophelis Ag1 CP023402.1 5 0 100
E. anophelis AR4-6 CP023404.1 5 0 100
E. anophelis AR6-8 CP023403.1 5 0 100
E. anophelis FDAARGOS_198 CP023010.2 5 0 100
E. anophelis 3375 CP016373.1 5 0 100
E. anophelis FDAARGOS_132 CP014020.1 5 0 100
E. anophelis FDAARGOS_134 CP014021.1 5 0 100
E. anophelis 422 CP016370.1 5 1 99.74 G995T, A1008C, A1009G, A1010G
E. anophelis F3543 CP014340.1 5 0 100
E. anophelis FMS-007 CP006576.1 5 0 100
E. anophelis CSID_3015183678 CP014805.2 5 0 100
E. anophelis CSID_3015183684 CP015066.2 4 0 100
E. anophelis CSID_3015183681 CP015068.2 5 0 100
E. anophelis CSID_3000521207 CP015067.2 4 0 100
E. miricola FL160902 CP040516.1 5 1 99.93 C84T
E. miricola EM798-26 CP023746.1 5 0 100
E. miricola BM10 CP011059.1 5 0 100
E. bruuniana G0146 CP014337.1 5 1 99.93 C78T
E. bruuniana ATCC 33958 CP035811.1 5 1 99.93 A58G
E. ursingii G4123 CP016377.1 5 3 S1: 99.41
S2: 99.54
S3: 99.74
S1: A181T, A182G, A183T, C184T, C185T, A192G, A194T, A196T, A375G
S2: A181G, A578G, C581G, G636T, C639T, A1120G
S3: A181G, A375G, A578G, C581G

aAccessed 10 October 2021.

b

Nucleotide alterations are reported in the following style: G195T indicates a G-to-T change at position 195.

16S rRNA in clinical isolates.

Over the study period, 218 nonduplicate isolates of Elizabethkingia species were collected from different patients. According to 16S rRNA gene sequencing, 15, 179, 15, 3, and 6 isolates were identified as E. meningoseptica, E. anophelis, E. miricola, E. bruuniana, and E. ursingii, respectively. An isolate was considered a variation if it possessed any nucleotide variation. Of the 218 clinical isolates, nucleotide variations were detected in 24 (11%) isolates, including in 5 E. meningoseptica isolates (33.3%), 15 E. anophelis isolates (8.4%), 2 E. miricola isolates (13.3%), and 2 E. ursingii isolates (33.3%). The number of nucleotide variations within a given genome ranged from 1 to 12 (Table 2). Among the 16S rRNA sequences, the least similarity between different gene copies was 99.21% (E. anophelis strain KMUH30), and the mean (± standard deviation) was 99.84% (±0.15%). Compared with E. anophelis, E. meningoseptica demonstrated a significantly higher rate of nucleotide variations (P = 0.011).

TABLE 2.

Nucleotide alterations of the 16S rRNA gene in the clinical Elizabethkingia isolates

Species Strain ANI (%) Nucleotide alteration(s)
E. meningoseptica EM653-29 99.8 C181T, G195T, A196G
E. meningoseptica EM699-87 99.93 A1016C
E. meningoseptica EM495-81 99.8 C181T, G195T, A196G
E. meningoseptica EDC47-90 99.93 C170T
E. meningoseptica VGHTC1 99.87 G195T, A196G
E. anophelis EM87-63 99.93 A1256G
E. anophelis EM233-27 99.93 A158G
E. anophelis EM361-97 99.34 A988T, C996T, T997G, C998T, A1005G, G1006T, A1007G, C1009T, C1010T, A1022T
E. anophelis EM504-35 99.93 A833G
E. anophelis EM749-74 99.93 A830T
E. anophelis EM960-64 99.93 A194G
E. anophelis EM1049-50 99.93 C322T
E. anophelis EDC49-25 99.28 A830T, A988T, C996T, T997G, C998T, A1005G, G1006T, A1007G, C1009T, C1010T, A1022T
E. anophelis EDC52-15 99.93 G194T
E. anophelis EDC43-35 99.93 A647G
E. anophelis KMUH25 99.93 A194G
E. anophelis KMUH30 99.21 A347G, A802T, A960T, C968T, G969T, C970T, A977G, G978T, A979G, C981T, C982T, A994T
E. anophelis KMUH34 99.93 A805G
E. anophelis KMUH38 99.93 A833G
E. anophelis KMUH58 99.93 C414T
E. miricola EM798-26 99.93 A1096C
E. miricola KMUH27 99.93 A84G
E. ursingii EM266-22 99.93 C660T
E. ursingii EM514-3 99.93 C660T

Distribution of nucleotide alterations.

All the alterations observed among the multiple copies of the 16S rRNA gene were single-nucleotide substitutions. Neither insertions nor deletions were identified (Table 1 and Table 2). Nucleotide variations were detected in 54 positions. Nucleotide changes were found most frequently at position 196 (n = 7; A↔G/T, C↔T), followed by position 195 (n = 6; G↔T, A↔C) and position 181 (n = 4; A↔G/T, C↔T). Nucleotide alterations occurred more frequently in V2 (n = 28, 30.8%) and V6 (n = 26, 28.6%) of the 16S rRNA gene than they did in other hypervariable regions (P < 0.001) (Fig. 1).

FIG 1.

FIG 1

Locations and hypervariable regions of nucleotide alterations in multiple copies of the 16S rRNA genes of isolates from GenBank and clinical isolates. V1, n = 3; V2, n = 28; V3, n = 0; V4, n = 7; V5, n = 4; V6, n = 26, V7, n = 1; V8, n = 1; V9, n = 0.

Phylogenetic analysis of 16S rRNA gene and species determination for strain G4123.

A phylogenetic tree based on the 16S rRNA gene sequences for Elizabethkingia strains was generated to evaluate their relatedness (Fig. 2). The phylogenetic tree could be split into 4 major groups: E. anophelis, E. meningoseptica, E. miricola cluster, and E. argenteiflava. A subgroup of E. anophelis subsp. endophytica was discerned in the tree. E. miricola, E. bruuniana, E. ursingii, and E. occulta were clustered together within a close group and formed the E. miricola cluster. The different copies of the 16S rRNA gene did not alter the species identification in the phylogenetic tree, with the exception of Elizabethkingia strain G4123. Based on the whole-genome sequence analysis, Elizabethkingia strain G4123 was identified as E. ursingii, because it demonstrated 79% in silico DNA-DNA hybridization (iDDH) and 97.2% average nucleotide identity (ANI) with regard to E. ursingii type strain G4122 (Fig. 3). E. ursingii strain G4123 had 5 copies of the 16S rRNA gene, which were divided into 4 distinct subgroups. One copy (GenBank accession number CP016377.1, nucleotides [nt] 312029 to 313549) was close to the 16S rRNA of E. ursingii type strain G4122. However, the remaining 4 copies (GenBank accession number CP016377.1, nt 1412577 to 1414097, 1567489 to 1569009, 1574033 to 1575553, and 2287626 to 2289146) were close to that of E. miricola type strain DSM 14571 (Fig. 2).

FIG 2.

FIG 2

Phylogenetic analysis inferred from different copies of the 16S rRNA gene in whole-genome sequences obtained from GenBank and clinical isolates of Elizabethkingia. The percentages of replicate trees in which the associated taxa clustered together in a bootstrap test of 1,000 replicates are displayed next to the branches. The lines marked in red indicate the 4 major groups.

FIG 3.

FIG 3

Species determination of Elizabethkingia strain G4123 based on whole-genome sequencing. (A) Results of in silico DNA-DNA hybridization (iDDH). (B) Average nucleotide identity (ANI).

DISCUSSION

Species in the genus Elizabethkingia cannot be accurately identified using techniques based on biochemical reactions and mass spectrometry (14, 16). Therefore, sequence analysis of the bacterial 16S rRNA gene is becoming increasingly essential in clinical practice and scientific investigations, especially with respect to emerging novel microbes (17). The results of the present study demonstrated the impact of 16S rRNA gene sequence heterogeneity on species identification in the genus Elizabethkingia.

Our results revealed that Elizabethkingia strains contained 4 to 5 copies of the 16S rRNA gene, and 81.3% of strains in all species types had 5 copies. Previous studies have reported that over 80% of bacteria have more than 1 copy of the 16S rRNA gene (310). Some bacteria have been reported to carry more than 10 copies of the 16S rRNA gene. For example, Photobacterium profundum was reported to have 15 copies, and Paeniclostridium sordellii was reported to have 17 copies (3, 4). The number of 16S rRNA copies is believed to be related to the evolutionary response of bacteria to the physical and biological environments (8).

The 16S rRNA gene comprises highly conserved and hypervariable regions, in which numerous mutations can occur (5, 10, 18). Gene variations can be unequally distributed in diverse regions for different species (5, 10), and the hypervariable V1 to V4 regions of bacterial 16S rRNA genes have been reported to be more divergent than others (18). Regarding intragenomic heterogeneity between different copies of the 16S rRNA gene, nucleotide variations occur frequently in the V1, V2, and V6 regions (5). In the present study, 16S rRNA intraspecific heterogeneity was higher in V2 and V6 than in other regions in the genus Elizabethkingia. This result is compatible with the results of the above-mentioned studies (5, 18).

The sequence of the 16S rRNA gene has been widely used as an indicator for the taxonomic classification of prokaryotic microbes. The sequence variability between different copies of the 16S rRNA gene is commonly less than 1% (9, 10). Nevertheless, the intragenomic heterogeneity among different 16S rRNA gene sequences has raised concerns over the use of 16S rRNA gene sequencing for species identification. Regarding 16S rRNA gene sequencing, Pei et al. (9) analyzed 883 prokaryotic genomes of 568 bacterial species in the GenBank database and discovered that 10% of the genomes possessed >1% dissimilarity in the multiple copies of the 16S rRNA gene. Moreover, 7 species were determined to have substantial intragenomic variations in the 16S rRNA gene which led to the species being misclassified. Větrovský et al. (10) investigated 1,690 genomes in 909 bacterial species and found that 2.4% of the genomes demonstrated >1% dissimilarity between the multiple copies of the 16S rRNA gene. The highly divergent sequences of the 16S rRNA gene affect its application for taxonomic classification in some genomes (10).

In this study, the variation between the different copies of the 16S rRNA gene in all Elizabethkingia isolates was <1%. In the phylogenetic tree inferred from the 16S rRNA gene, E. meningoseptica, E. anophelis, and E. argenteiflava were clearly separately clustered. However, E. miricola, E. bruuniana, E. ursingii, and E. occulta strains were phylogenetically close, and these strains were described as the “E. miricola cluster” (19). Among these strains, we discovered that Elizabethkingia strain G4123 demonstrated considerable variations in the multiple copies of the 16S rRNA genes. The species for Elizabethkingia strain G4123 was confirmed to be E. ursingii through iDDH and ANI analysis based on whole-genome sequences. Conventional DDH has been regarded as a gold standard in prokaryote taxonomy. However, wet lab DDH is a time-consuming, labor-intensive, and potentially error-prone method (20, 21). With the advance in high-throughput sequencing technology, analysis of genomic sequences has become an accurate alternative method for conventional DDH. Among the bioinformatics methods, iDDH by in silico genome-to-genome comparison (20, 22) and ANI between pairwise genomes (21, 23) are considered to be accurate methods of species delineation. In the present study, we found that only 1 copy of the 16S rRNA gene approached similarity to the 16S rRNA gene of E. ursingii type strain G4122; the other 4 copies were closer to E. miricola type strain DSM 14571. Therefore, using 16S rRNA gene sequencing to discriminate between closely related strains with multiple copies of the 16S rRNA gene may have disadvantages.

Several limitations should be noted in our study. First, the whole-genome sequences of Elizabethkingia strains in the present study were obtained from the NCBI genome sequence repository. Although some concerns have been raised about the reliability of the public genome database (24), GenBank is considered a reliable database (25). Moreover, sequences submitted to GenBank have required review and verification for accuracy since 2012 (26). All complete whole-genome sequences of Elizabethkingia strains published in GenBank were submitted after 2014. Therefore, sequence data used in our study are considered accurate and reliable. Second, 16S rRNA gene sequences of clinical isolates were completed using Sanger sequencing. Therefore, we have no information on how many copies of 16S rRNA genes exist in the clinical isolates. Finally, additional genes or more whole-genome sequence studies might be needed to accurately speciate Elizabethkingia isolates.

In conclusion, the results of the present study indicate that the intragenomic heterogeneity among the multiple copies of 16S rRNA genes in Elizabethkingia species is limited. Although 16S rRNA gene sequencing can correctly identify common Elizabethkingia species, variations among the multiple copies of 16S rRNA genes can affect the identification of phylogenetically close species. Further studies are warranted to investigate the role of other marker genes on the taxonomic classification of these closely related taxa.

MATERIALS AND METHODS

Ethics.

This study was conducted in accordance with the Declaration of Helsinki and the national standards of Taiwan and was approved by the institutional review board (EMRP-109-007). The requirement for informed consent was waived because the analysis of data gathered from a public database and the retrospective analysis of clinical isolates routinely collected from patients posed no more than a minimal risk of harm to patients.

Whole-genome sequences.

The complete whole-genome sequences of Elizabethkingia species were downloaded from GenBank in the NCBI genome sequence repository (https://www.ncbi.nlm.nih.gov/genome/; accessed on 10 October 2021). Thirty-four complete whole-genome sequences of Elizabethkingia species were available as of the time of writing, comprising 6 E. meningoseptica strains, 22 E. anophelis strains, 3 E. miricola strains, 2 E. bruuniana strains, and 1 E. ursingii strain. In the 6 E. meningoseptica strains, 3 whole-genome sequences were repeated (strain KC1913; GenBank accession number CP035809.1 is strain KC1913, GenBank accession number CP014338.1 is strain NCTC10016, and GenBank accession number LS483376.1). Finally, 32 complete genome sequences were included in the analysis.

Strains used in this study.

Clinical isolates of Elizabethkingia species, obtained between 2005 and 2020, were collected from 5 hospitals in Taiwan, namely, E-Da Hospital, Kaohsiung Medical University Hospital, E-Da Cancer Hospital, National Cheng Kung University Hospital, and Taichung Veterans General Hospital. These isolates had been routinely collected from patients in accordance with clinical requirements. All isolates were initially identified as Elizabethkingia species by clinical microbiology laboratories using API/ID32 phenotyping kits (bioMérieux, Marcy l’Etoile, France), the Phoenix 100 ID/AST automated microbiology system (Becton, Dickinson Co., Sparks, MD, USA), the Vitek 2 automated identification system (bioMérieux), or the Vitek MALDI-TOF MS system (bioMérieux). Isolates were stored as glycerol stocks at −80°C until use.

16S rRNA gene sequencing of clinical isolates.

The frozen bacterial glycerol stocks were thawed and subcultured on tryptic soy agar with 5% sheep blood (Becton, Dickinson, Sparks, MD, USA) for the experiments. Bacterial DNA was prepared using a Wizard genomic DNA purification kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. All PCRs were performed using the GeneAmp 9700 system (Applied Biosystems, Foster City, CA, USA). Primers used to amplify the internal fragments of the 16S rRNA gene are listed in Table 3. PCR conditions were as described previously (27, 28). Amplicons (1,498 bp) were initially sequenced with primary sequencing primers (Table 3) by using the 3730xl DNA analyzer (Applied Biosystems). The sequencing chromatograms of the 16S rRNA genes were inspected for double peaks by using the Poly Peak Parser (http://yosttools.genetics.utah.edu/PolyPeakParser/; accessed on 12 November 2021) (29). If a region with double peaks was identified, additional sequencing using the respective supplementary primers (Table 3) was performed to verify the double peaks through chromatography.

TABLE 3.

Primers for PCR amplification and sequencing of the 16S rRNA gene in this study

Primer purpose and name Sequence (5′–3′)
Primers for 16S rRNA amplification
 8f CACGGATCCAGACTTTGAT(C/T)(A/C)TGGCTCAG
 1512r GTGAAGCTTACGG(C/T)TAGCTTGTTACGACTT
Primary sequencing primers for 16S rRNA
 8f CACGGATCCAGACTTTGAT(C/T)(A/C)TGGCTCAG
 534r ATTACCGCGGCTGCTGG
 534f CCAGCAGCCGCGGTAAT
 968f AACGCGAAGAACCTTAC
 1512r GTGAAGCTTACGG(C/T)TAGCTTGTTACGACTT
Supplementary sequencing primers for 16S rRNA
 1100f (C/T)AACGAGCGCAACCC
 1100r GGGTTGCGCTCGTTG
 337f GACTCCTACGGGAGGC(A/T)GCAG
 785f GGATTAGATACCCTGGTA
 907r CCGTCAATTCCTTT(A/G)AGTTT
 805r GACTACCAGGGTATCTAATC
 518r GTATTACCGCGGCTGCTGG
 1492r CGGTTACCTTGTTACGACTT

Sequence analysis and phylogenetic tree construction.

The sequences were aligned using ClustalW v2.1 with the default options in MEGA v7.0.26 (https://www.megasoftware.net/). The 16S rRNA sequences of the clinical isolates were compared with the sequence of each type strain: E. meningoseptica type strain KC1913 (GenBank accession number CP035809.1), E. miricola type strain DSM 14571 (GenBank accession number VNHK01000025.1), E. anophelis type strain R26 (GenBank accession number CP023401.1), E. anophelis subsp. endophytica strain JM-87 (GenBank accession number FLSU01000044.1; reclassified as E. anophelis), E. bruuniana type strain G0146 genome (GenBank accession number CP014337.1), E. ursingii type strain G4122 (GenBank accession number LNOK01000023.1), E. occulta type strain G4070 (GenBank accession number MAHX01000006.1), and E. argenteiflava type strain YB22 (GenBank accession number JAAABJ010000676.1). The similarity, identity, and variety between sequences were calculated using EMBOSS Water (https://www.ebi.ac.uk/Tools/psa/emboss_water/; accessed on 2 December 2021). The nucleotide identity of 16S rRNA genes between the clinical isolate and type strains was calculated. The species of Elizabethkingia was identified if the isolate shared the highest sequence identity and the identity was ≥99.5% (30). The locations of nucleotide alterations in the 9 hypervariable regions, namely, V1 (nt 69 to 99), 2 (nt 137 to 242), V3 (nt 433 to 497), V4 (nt 576 to 682), V5 (nt 822 to 879), V6 (nt 986 to 1043), V7 (nt 1117 to 1173), V8 (nt 1243 to 1294), and V9 (nt 1435 to 1465), of the 16S rRNA gene were mapped (31). The phylogenetic relationship was determined using MEGA v7.0.26.

Whole-genome sequence analysis for species identification.

To accurately determine the species of Elizabethkingia strain G4123 (GenBank accession no. CP016377.1), iDDH and ANI values were calculated using Genome-to-Genome Distance Calculator v3.0 (20, 22) and OrthoANI v0.93 (23), respectively. An iDDH cutoff of 70% (20, 22) and an ANI cutoff of 95% (21, 23) were used as species delimitation criteria. The heat maps were produced using CIMminer (https://discover.nci.nih.gov/cimminer/, accessed on 25 June 2022).

Statistical analysis.

We used IBM SPSS Statistics for Windows v24 (IBM Corp., Armonk, NY, USA) to perform statistical analysis with Fisher’s exact test for categorical variables and Student's t test for continuous variables. A two-tailed P value of <0.05 was considered statistically significant. The maximum-likelihood method based on the Jukes-Cantor model (JC69) was used to estimate the evolutionary distance in the phylogenetic tree constructed with MEGA v7.0.26.

Data availability.

The GenBank accession numbers of 16S rRNA gene sequences of the clinical Elizabethkingia isolates in the present study are available in Table S1 in the supplemental material.

ACKNOWLEDGMENTS

This work was supported by grants EDPJ107069, EDPJ109070, and EDPJ110062 from E-Da Hospital and MOST 109-2314-B-214-006-MY2 and 111-2314-B-214-006 from the Ministry of Science and Technology, Taiwan.

Footnotes

Supplemental material is available online only.

Supplemental file 1
Supplemental material. Download spectrum.01338-22-s0001.pdf, PDF file, 0.1 MB (99.8KB, pdf)

Contributor Information

Jiun-Nong Lin, Email: jinoli@kmu.edu.tw.

Susan Realegeno, Quest Diagnostics.

REFERENCES

  • 1.Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc Natl Acad Sci USA 82:6955–6959. doi: 10.1073/pnas.82.20.6955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Church DL, Cerutti L, Gürtler A, Griener T, Zelazny A, Emler S. 2020. Performance and application of 16S rRNA gene cycle sequencing for routine identification of bacteria in the clinical microbiology laboratory. Clin Microbiol Rev 33:e00053-19. doi: 10.1128/CMR.00053-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lee ZM, Bussema C, Schmidt TM. 2009. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea. Nucleic Acids Res 37:D489–D493. doi: 10.1093/nar/gkn689. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kim JY, Kim YB, Song HS, Chung WH, Lee C, Ahn SW, Lee SH, Jung MY, Kim TW, Nam YD, Roh SW. 2017. Genomic analysis of a pathogenic bacterium, Paeniclostridium sordellii CBA7122 containing the highest number of rRNA operons, isolated from a human stool sample. Front Pharmacol 8:840. doi: 10.3389/fphar.2017.00840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Coenye T, Vandamme P. 2003. Intragenomic heterogeneity between multiple 16S ribosomal RNA operons in sequenced bacterial genomes. FEMS Microbiol Lett 228:45–49. doi: 10.1016/S0378-1097(03)00717-1. [DOI] [PubMed] [Google Scholar]
  • 6.Klappenbach JA, Dunbar JM, Schmidt TM. 2000. rRNA operon copy number reflects ecological strategies of bacteria. Appl Environ Microbiol 66:1328–1333. doi: 10.1128/AEM.66.4.1328-1333.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Michon AL, Jumas-Bilak E, Imbert A, Aleyrangues L, Counil F, Chiron R, Marchandin H. 2012. Intragenomic and intraspecific heterogeneity of the 16S rRNA gene in seven bacterial species from the respiratory tract of cystic fibrosis patients assessed by PCR-temporal temperature gel electrophoresis. Pathol Biol (Paris) 60:e30–e35. doi: 10.1016/j.patbio.2011.03.014. [DOI] [PubMed] [Google Scholar]
  • 8.Espejo RT, Plaza N. 2018. Multiple ribosomal RNA operons in bacteria; their concerted evolution and potential consequences on the rate of evolution of their 16s rRNA. Front Microbiol 9:1232. doi: 10.3389/fmicb.2018.01232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pei AY, Oberdorf WE, Nossa CW, Agarwal A, Chokshi P, Gerz EA, Jin Z, Lee P, Yang L, Poles M, Brown SM, Sotero S, Desantis T, Brodie E, Nelson K, Pei Z. 2010. Diversity of 16S rRNA genes within individual prokaryotic genomes. Appl Environ Microbiol 76:3886–3897. doi: 10.1128/AEM.02953-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Větrovský T, Baldrian P. 2013. The variability of the 16S rRNA gene in bacterial genomes and its consequences for bacterial community analyses. PLoS One 8:e57923. doi: 10.1371/journal.pone.0057923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Case RJ, Boucher Y, Dahllöf I, Holmström C, Doolittle WF, Kjelleberg S. 2007. Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl Environ Microbiol 73:278–288. doi: 10.1128/AEM.01177-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lin JN, Lai CH, Yang CH, Huang YH, Lin HH. 2018. Clinical manifestations, molecular characteristics, antimicrobial susceptibility patterns and contributions of target gene mutation to fluoroquinolone resistance in Elizabethkingia anophelis. J Antimicrob Chemother 73:2497–2502. doi: 10.1093/jac/dky197. [DOI] [PubMed] [Google Scholar]
  • 13.Lin JN, Lai CH, Yang CH, Huang YH. 2019. Elizabethkingia infections in humans: from genomics to clinics. Microorganisms 7:295. doi: 10.3390/microorganisms7090295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nicholson AC, Gulvik CA, Whitney AM, Humrighouse BW, Graziano J, Emery B, Bell M, Loparev V, Juieng P, Gartin J, Bizet C, Clermont D, Criscuolo A, Brisse S, McQuiston JR. 2018. Revisiting the taxonomy of the genus Elizabethkingia using whole-genome sequencing, optical mapping, and MALDI–TOF, along with proposal of three novel Elizabethkingia species: Elizabethkingia bruuniana sp. nov., Elizabethkingia ursingii sp. nov., and Elizabethkingia occulta sp. nov. Antonie Van Leeuwenhoek 111:55–72. doi: 10.1007/s10482-017-0926-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hwang JH, Kim J, Kim JH, Mo S. 2021. Elizabethkingia argenteiflava sp. nov., isolated from the pod of soybean, Glycine max. Int J Syst Evol Microbiol 71. doi: 10.1099/ijsem.0.004767. [DOI] [PubMed] [Google Scholar]
  • 16.Lin JN, Lai CH, Yang CH, Huang YH, Lin HF, Lin HH. 2017. Comparison of four automated microbiology systems with 16S rRNA gene sequencing for identification of Chryseobacterium and Elizabethkingia species. Sci Rep 7:13824. doi: 10.1038/s41598-017-14244-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Johnson JS, Spakowicz DJ, Hong BY, Petersen LM, Demkowicz P, Chen L, Leopold SR, Hanson BM, Agresta HO, Gerstein M, Sodergren E, Weinstock GM. 2019. Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis. Nat Commun 10:5029. doi: 10.1038/s41467-019-13036-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kim M, Morrison M, Yu Z. 2011. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods 84:81–87. doi: 10.1016/j.mimet.2010.10.020. [DOI] [PubMed] [Google Scholar]
  • 19.Kenna DTD, Fuller A, Martin K, Perry C, Pike R, Burns PJ, Narayan O, Wilkinson S, Hill R, Woodford N, Logan JMJ, Turton JF. 2018. rpoB gene sequencing highlights the prevalence of an E. miricola cluster over other Elizabethkingia species among UK cystic fibrosis patients. Diagn Microbiol Infect Dis 90:109–114. doi: 10.1016/j.diagmicrobio.2017.10.014. [DOI] [PubMed] [Google Scholar]
  • 20.Meier-Kolthoff JP, Auch AF, Klenk HP, Göker M. 2013. Genome sequence-based species delimitation with confidence intervals and improved distance functions. BMC Bioinformatics 14:60. doi: 10.1186/1471-2105-14-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Richter M, Rosselló-Móra R. 2009. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci USA 106:19126–19131. doi: 10.1073/pnas.0906412106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Meier-Kolthoff JP, Sardà Carbasse J, Peinado-Olarte RL, Göker M. 2022. TYGS and LPSN: a database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res 50:D801–D807. doi: 10.1093/nar/gkab902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lee I, Kim YO, Park SC, Chun J. 2016. OrthoANI: an improved algorithm and software for calculating average nucleotide identity. Int J Syst Evol Microbiol 66:1100–1103. doi: 10.1099/ijsem.0.000760. [DOI] [PubMed] [Google Scholar]
  • 24.Tørresen OK, Star B, Mier P, Andrade-Navarro MA, Bateman A, Jarnot P, Gruca A, Grynberg M, Kajava AV, Promponas VJ, Anisimova M, Jakobsen KS, Linke D. 2019. Tandem repeats lead to sequence assembly errors and impose multi-level challenges for genome and protein databases. Nucleic Acids Res 47:10994–11006. doi: 10.1093/nar/gkz841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Leray M, Knowlton N, Ho SL, Nguyen BN, Machida RJ. 2019. GenBank is a reliable resource for 21st century biodiversity research. Proc Natl Acad Sci USA 116:22651–22656. doi: 10.1073/pnas.1911714116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Benson DA, Karsch-Mizrachi I, Clark K, Lipman DJ, Ostell J, Sayers EW. 2012. GenBank. Nucleic Acids Res 40:D48–D53. doi: 10.1093/nar/gkr1202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hantsis-Zacharov E, Shakéd T, Senderovich Y, Halpern M. 2008. Chryseobacterium oranimense sp. nov., a psychrotolerant, proteolytic and lipolytic bacterium isolated from raw cow’s milk. Int J Syst Evol Microbiol 58:2635–2639. doi: 10.1099/ijs.0.65819-0. [DOI] [PubMed] [Google Scholar]
  • 28.Shewmaker PL, Steigerwalt AG, Nicholson AC, Carvalho MdG, Facklam RR, Whitney AM, Teixeira LM. 2011. Reevaluation of the taxonomic status of recently described species of Enterococcus: evidence that E. thailandicus is a senior subjective synonym of “E. sanguinicola” and confirmation of E. caccae as a species distinct from E. silesiacus. J Clin Microbiol 49:2676–2679. doi: 10.1128/JCM.00399-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hill JT, Demarest BL, Bisgrove BW, Su YC, Smith M, Yost HJ. 2014. Poly peak parser: method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products. Dev Dyn 243:1632–1636. doi: 10.1002/dvdy.24183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Janda JM, Abbott SL. 2007. 16S rRNA gene sequencing for bacterial identification in the diagnostic laboratory: pluses, perils, and pitfalls. J Clin Microbiol 45:2761–2764. doi: 10.1128/JCM.01228-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Brosius J, Palmer ML, Kennedy PJ, Noller HF. 1978. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc Natl Acad Sci USA 75:4801–4805. doi: 10.1073/pnas.75.10.4801. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Supplemental material. Download spectrum.01338-22-s0001.pdf, PDF file, 0.1 MB (99.8KB, pdf)

Data Availability Statement

The GenBank accession numbers of 16S rRNA gene sequences of the clinical Elizabethkingia isolates in the present study are available in Table S1 in the supplemental material.


Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES