Abstract
Introduction
Efavirenz is an antihuman immunodeficiency virus (HIV) drug metabolized by cytochrome P450 2B6 (CYP2B6) enzyme. Cytochrome P450 2B6 is an enzyme that in humans is encoded by the CYP2B6 gene. Polymorphisms of this gene play a crucial role in the metabolism of drugs such as Efavirenz. This study aims to evaluate the frequency of three clinically significant CYP2B6 polymorphisms (CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T)) in three major Iranian ethnicities.
Methods
One hundred forty-seven participants from three main Iranian ethnicities were included in this study. After DNA extraction, CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T) were genotyped using tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS-PCR).
Results
The frequency of the mutated allele in the Iranian population for CYP2B6∗6 (516G > T) was 41.50 (95% CI: 35.81, 47.36), which was significantly lower than in Kurds (59.62, 95% CI: 45.10, 72.99). Similarly, Kurds had a higher frequency of mutated allele of CYP2B6∗5 (1459C > T) (46.15%, 95% CI: 32.23, 60.53) than in Iranians (24.49%, 95% CI: 19.68, 29.82). The frequency of A and G alleles of CYP2B6∗4 (785A > G) was 62.59% (95% CI: 56.78, 68.13) and 37.41 (95% CI: 31.87, 43.22), respectively.
Conclusion
Kurds are at higher risk of adverse drug reactions (ADRs) and insufficient anti-HIV response compared to other Iranians.
1. Introduction
Penalized medicine is an approach that evaluates and manages patients based on their predicted response to treatment. This approach is also beneficial to predict and prevent therapeutic resistance, which can enhance patients' outcomes. One of the main components of this approach is to predict the drugs' metabolism pace and consequently drug response and toxicity [1, 2]. Different pathways have been identified for the metabolism of drugs. One of the crucial pathways is cytochrome P450, which comprises different enzymes [3, 4]. One of the major components of cytochrome P450 is CYP2B6, which is responsible for the metabolism of drugs such as antiretrovirals such as efavirenz [5, 6].
Efavirenz ((S)-6-chloro-4-(cyclopropylethynyl)-1,4-dihydro-4-(trifluoromethyl)-2H-3,1-benzoxazin-2-one) is one of the nonnucleoside reverse transcriptase inhibitors, which is prescribed as first-line therapy in patients diagnosed with human immunodeficiency virus (HIV) infection. Antiretroviral medications have transformed HIV infection into a chronic disease, which can be managed effectively [7]. Efavirenz, which is a noncompetitive inhibitor of HIV-1 reverse transcriptase, is one of the most effective drugs prescribed for HIV infection [8].
Efavirenz is highly potent; nevertheless, it is attributed to several adverse effects including, QT interval (the time from the start of the Q wave to the end of the T wave in electrocardiogram) prolongation, dyslipidemia, hepatotoxicity, and neuropsychiatric side effects [8]. Although the drug is no longer recommended as the preferred initial antiretroviral therapy (ART) regimen for nonpregnant adults due to its neuropsychiatric adverse effects, it is still recommended in selected patients based on the New York State Department of Health (NYSDOH) acquired immunodeficiency syndrome (AIDS) institute guideline (AI) [9]. Furthermore, unlike in the United States, efavirenz is a vital part of the first-line therapeutic guideline in middle and low-income countries such as Iran and it is prescribed in almost all patients diagnosed with HIV infection [10]. Side effects of efavirenz are one of the biggest challenges for health services in managing HIV-positive patients [11]. Evaluation of the pharmacokinetics of efavirenz is the key in managing its adverse drug reactions (ADRs) [12].
This drug initially transforms to its primary metabolite, 8-hydroxyefavirenz, in the liver mainly by cytochrome P450 2B6 (CYP2B6) enzyme, followed by the formation of 8,14-dihydroxyefavirenz chiefly by the same drug-metabolizing P450 2B6 [13]. Figure 1 concisely shows the metabolic pathway of efavirenz pharmacokinetics [13]. CYP2B6 is encoded by the CYP2B6 gene, and its various polymorphisms, including CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T), are clinically relevant for HIV-infected patients treated with efavirenz. For instance, the TT genotype for CYP2B6∗6 (516G > T) is associated with increased EFV plasma concentrations, reduced clearance, and consequently increased efavirnez exposure compared to the GG or GT genotype [14, 15]. In other words, patients' genotype for some of the CYP2B6 polymorphisms predicts the pace of drug metabolism in their bodies.
Figure 1.

Schematic representation of efavirenz metabolism in the liver. It should be noted that the main route of efavirenz metabolism is 8-hydroxyefavirenz, which is predominately formed by CYP2B6. UGT, uridine 5′-diphospho-glucuronosyltransferase.
A recent study indicated that CYP2B6 polymorphisms are ethnically and geographically diverse among different populations, which results in differences in drugs, especially antiretrovirals, pharmacokinetics, and therapy outcomes [16]. Iran is a geographically diverse, and multiethnic country; Fars, Turk (Azerbaijanis), and Kurds comprise about 80 percent of the country's population [17]. The genotype and allele frequency of CYP2B6 polymorphisms have not been studied in any of its major ethnicities. This study aims to evaluate the frequency of three clinically important CYP2B6 polymorphisms (CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T)) in three major Iranian ethnicities.
2. Methods
2.1. Ethical Compliance
All patients consented to participate in genetic and molecular analyses and consented to publish the results. This study was verified by the Alborz University of Medical Sciences Ethical Committee (IR.ABZUMS.REC.1398.121).
2.2. Sample Collection and DNA Extraction
One hundred and forty seven participants were included in this study, comprising 26 Kurd, 52 Turk, and 69 Fars participants. Included participants aged between 18 and 77 years (median = 43, interquartile range (IQR) = 30 to 55). It should be noted that the number of participants from each ethnic group was calculated based on the ethnic composition of Iran [18]. Two milliliters of venous blood were gathered from each participant and drawn into a tube that contains ethylenediaminetetraacetic acid as an anticoagulant followed by DNA extraction using a molecular biological system transfer (MBST) salting-out kit (CinnaGen, Tehran, Iran) from the blood. Extracted DNA was stored at −20°C before genotyping.
2.3. Genotyping
CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T) were genotyped using tetra-primer amplification refractory mutation system polymerase chain reaction (ARMS–PCR). The amplification was conducted using 60 ng of extracted genomic DNA, 0.4 U Taq DNA polymerase (CinnaGen), six pmol of each primer, 10X PCR buffer, 0.5 mM dNTP, and 1.5 mM MgCl2. The mixture was initially denatured at 95°C for 3 minutes, followed by 32 cycles of 95°C for 1 minute, 56°C for 1 min, and 72°C for 2 min for CYP2B6 516G > T; 32 cycles of 95°C for 1 minute, 64°C for 50 seconds, and 72°C for 1 minute for CYP2B6 785A > G; 35 cycles of 95°C for 1 minute, 63°C for 1 min, and 72°C for 1 min for CYP2B6 1459C > T; followed by a final extension at 72°C for 10 min. Afterward, amplified fragments were run on a 1.5% agarose gel electrophoresis for 1 hour at 80 volt, ahead of staining using silver nitrate (CinnaGen) [19, 20]. Table 1 provides information on the primer sequences [6]. The DNA bands in the agarose gel were visualized under ultraviolet (UV) rays, and images were captured [19, 20]. Figure 2 schematically summarizes the genotyping process using Tetra-ARMS-PCR for CYP2B6∗6 (516G > T).
Table 1.
Polymorphism details and primers.
| rs | Allele | Nucleotide change | Amino acid change | Length of PCR products | Type | Primer sequences (5' > 3′) | |||
|---|---|---|---|---|---|---|---|---|---|
| rs3745274 | CYP2B6∗6 | (516G > T) | Gln172His | FU + RU = 600 | FU + RN = 353 | FU + RM = 353 | Missense | FU | TGTGTTGCCTGGGTCTAAATC |
| RU | CTGATTCTTCACATGTCTGCGT | ||||||||
| RN | AGCAGATGATGTTGGCGGTAATGGAC | ||||||||
| RM | TGATGTTGGCGGTAATGGAA | ||||||||
|
| |||||||||
| rs2279343 | CYP2B6∗4 | (785A > G) | Lys262Arg | FU + RU = 734 | FU + RN = 256 | FU + RM = 256 | Missense | FU | GTTCCCATGGAGGGATTGGG |
| RU | CTCTACACATCCAACCGCGTA | ||||||||
| RN | GAGCAGGTAGGTGTCGATGAGGTCCT | ||||||||
| RM | GTAGGTGTCGATGAGGTCCC | ||||||||
|
| |||||||||
| rs3211371 | CYP2B6∗5 | (1459C > T) | Arg487Cys | FU + RU = 381 | FU + RN = 206 | RU + FM = 209 | Missense | FU | CACACTGGTGACCTTCTGTGT |
| RU | CCTGCACTCACTTGCAATGT | ||||||||
| RN | CGCTTCCTGCCCCGCTGAAGGGGCTG | ||||||||
| FM | CAAAATACCCCCAACATACCAGATCT | ||||||||
Figure 2.

Process of SNP genotyping using Tetra-ARMS-PCR for CYP2B6∗6 (516G > T) in not-mutated (a) and mutated (b) DNAs. PCR product lengths of CYP2B6∗6 (516G > T) were FU + RU = 600, FU + RN = 353, and FU + RM = 353.
2.4. Statistical Analysis
Genotype and allele frequencies were carried out according to tetra-primer ARMS–PCR findings. The frequency of alleles and genotypes was accompanied by confidence intervals (CI) proportions, calculated based on the formula . Chi-square analysis was used for comparing allele frequencies in different ethnicities [21, 22]. A p value less than 0.05 was considered statistically significant.
3. Results
3.1. Allelic and Genotype Frequency of CYP2B6∗6 (516G > T)
Table 2 demonstrates the frequencies of CYP2B6∗6 (516G > T) genotypes in the Iranian population. The frequency of wild-type homozygotes is estimated to be 35.37% (95% CI: 27.67, 43.68), while the frequency of heterozygotes and mutated homozygotes was 46.26% (95% CI: 38.01, 54.66) and 18.37% (95% CI: 12.47, 25.59), respectively. The highest frequency of TT genotype was measured in the Kurd population (34.62%), whereas the lowest frequency was calculated in Turk participants (5.38%) (p value <0.05). It should be emphasized that Kurds' mutated allele frequency was 59.62% (95% CI: 45.10, 72.9), which was significantly higher than whole Iranian participants (p value <0.05). Allele frequencies of CYP2B6∗6 are available in Table 3. Also, an electrophoresis gel demonstrating different polymorphisms of CYP2B6∗6 is illustrated in Figure 3.
Table 2.
Genotype frequencies for CYP2B6 polymorphism in the Kurd, Turk, and Fars population.
| CYP2B6∗6 (516G > T) | ||||
| Ethnicity | GG | GT | TT | |
| Kurd (n = 26) | n | 4 | 13 | 9 |
| Percent (95% CI) | 15.38 (4.36, 34.87) | 50.00 (29.93, 70.07) | 34.62 (17.21, 55.67) | |
| Turk (n = 52) | n | 20 | 24 | 8 |
| Percent (95% CI) | 38.46 (25.30, 52.98) | 46.15 (32.23, 60.53) | 15.38 (5.58, 25.19) | |
| Fars (n = 69) | n | 26 | 31 | 12 |
| Percent (95% CI) | 37.68 (26.29, 50.17) | 44.93 (32.92, 57.38) | 17.39 (9.32,28.41) | |
| Total (n = 147) | n | 52 | 68 | 27 |
| Percent (95% CI) | 35.37 (27.67, 43.68) | 46.26 (38.01, 54.66) | 18.37 (12.47, 25.59) | |
|
| ||||
| CYP2B6∗4 (785A > G) | ||||
| Ethnicity | AA | AG | GG | |
| Kurd (n = 26) | n | 10 | 8 | 8 |
| Percent (95% CI) | 38.46(20.23, 59.43) | 30.77 (14.33, 51.79) | 30.77 (14.33, 51.79) | |
| Turk (n = 52) | n | 20 | 18 | 14 |
| Percent (95% CI) | 38.46 (25.30, 52.98) | 34.61 (21.97, 49.09) | 26.92 (15.57, 41.02) | |
| Fars (n = 69) | n | 34 | 30 | 5 |
| Percent (95% CI) | 49.28 (37.02, 61.59) | 43.48 (31.58, 55.96) | 7.25 (2.39, 16.11) | |
| Total (n = 147) | n | 64 | 56 | 27 |
| Percent (95% CI) | 43.54 (35.39, 51.95) | 38.10 (30.22, 46.46) | 18.37 (12.47, 25.59) | |
|
| ||||
| CYP2B6∗5 (1459C > T) | ||||
| Ethnicity | CC | CT | TT | |
| Kurd (n = 26) | n | 8 | 12 | 6 |
| Percent (95% CI) | 30.77 (14.33, 51.79) | 46.15 (26.59, 66.63) | 23.07 (8.97, 43.65) | |
| Turk (n = 52) | n | 40 | 8 | 4 |
| Percent (95% CI) | 76.92 (63.16, 87.47) | 15.38 (6.88, 28.08) | 7.69 (2.14, 18.54) | |
| Fars (n = 69) | n | 44 | 18 | 7 |
| Percent (95% CI) | 63.77 (51.31, 75.01) | 26.08 (16.25, 38.06) | 10.14 (4.18, 19.79) | |
| Total (n = 147) | n | 92 | 38 | 17 |
| Percent (95%CI) | 62.59 (54.23, 70.42) | 25.85 (18.99, 33.71) | 11.56 (6.88, 17.87) | |
Table 3.
Allele frequencies in Iranian populations.
| CYP2B6∗6 (516G > T) | ||||
| Ethnicity | G | T | χ2 statistic | p value |
| Total (n = 147) | 58.50 (52.64, 64.19) | 41.50 (35.81, 47.36) | ||
| Kurd (n = 26) | 40.38 (27.01, 54.90) | 59.62 (45.10, 72.99) | 5.8808 | 0.015∗ |
| Turk (n = 52) | 61.54 (51.49, 70.91) | 38.46 (29.09, 48.51) | 0.2932 | 0.588 |
| Fars (n = 69) | 60.14 (51.47, 68.38) | 39.86 (31.62, 48.53) | 0.1046 | 0.746 |
|
| ||||
| CYP2B6∗4 (785A > G) | ||||
| Ethnicity | A | G | χ2 statistic | p value |
| Total (n = 147) | 62.59 (56.78, 68.13) | 37.41 (31.87, 43.22) | ||
| Kurd (n = 26) | 53.85 (39.47, 67.77) | 46.15 (32.23, 60.53) | 1.422 | 0.233 |
| Turk (n = 52) | 55.77 (45.70, 65.50) | 44.23 (34.50, 54.30) | 1.4975 | 0.221 |
| Fars (n = 69) | 71.01 (62.69, 78.42) | 28.98 (21.58, 37.31) | 2.9442 | 0.086 |
|
| ||||
| CYP2B6∗5 (1459C > T) | ||||
| Ethnicity | C | T | χ2 statistic | p value |
| Total (n = 147) | 75.51 (70.18, 80.32) | 24.49 (19.68, 29.82) | ||
| Kurd (n = 26) | 53.85 (39.47, 67.77) | 46.15 (32.23, 60.53) | 10.3442 | 0.0012∗ |
| Turk (n = 52) | 84.62 (76.22, 90.94) | 15.38 (9.06, 23.78) | 3.6983 | 0.054 |
| Fars (n = 69) | 76.81 (68.87,83.57) | 23.19 (16.43, 31.13) | 0.087 | 0.768 |
∗ p value for χ2 test is statistically significant (p value <0.05).
Figure 3.

CYP2B6∗6 gene electrophoresis findings for three samples with genotypes of GG, TT, and GT from left to right. FU, forward outer primer; RU, reverse outer primer; RN, reverse nonmutant primer, RM, reverse mutant primer; the leftmost well is filled with a 100 bp DNA ladder.
3.2. Allelic and Genotype Frequency of CYP2B6∗4 (785A > G)
The allelic and genotype frequency of CYP2B6∗4 in three major Iranian ethnicities is illustrated in Table 2. A great proportion of Iranians had wild-type homozygote genotypes for CYP2B6∗4 (43.54%, 95% CI: 35.39, 51.95). Furthermore, as shown in Table 3, mutated allele frequency was found to be 37.41% (95% CI: 31.87, 43.22) in the Iranian population. The highest and lowest G allele frequency was measured in Kurd (46.15, 95% CI: 32.23, 60.53) and Fars (28.98, 95% CI: 21.58, 37.31) participants (p value <0.05).
3.3. Allelic and Genotype Frequency of CYP2B6∗5 (1459C > T)
As Table 2 depicts data regarding CYP2B6∗5 (1459C > T) polymorphism, CC, CT, and TT frequency were 62.59%, 25.85%, and 11.56%, respectively. Among ethnicities, Turks showed the highest frequency for CC (76.92%, 95% CI: 63.16, 87.47), followed by 63.77% (95% CI: 51.31, 75.01) for Fars participants. On the other hand, Kurd participants showed a significantly higher frequency for the T allele (46.15%, 95% CI: 32.23, 60.53) compared to Iranians (62.59%, 95% CI: 54.23, 70.42) (p value <0.05). Frequencies of alleles in each ethnicity are summarized in Table 2.
4. Discussion
This study demonstrates the allele frequency of CYP2B6 mutations, which are clinically significant in the metabolism of efavirenz in three major Iranian ethnicities. The conclusion derived from the data obtained in the present study showed that Kurds, which comprise about 10 percent of the country's population, are found to be attributed at higher risk of both decreased and increased efavirenz metabolism compared to other Iranian ethnicities due to their higher frequency of CYP2B6∗6 and CYP2B6∗5, respectively.
As demonstrated in Figure 1, efavirenz pharmacokinetic is closely linked to CYP2B6 and its polymorphisms play a crucial role in the metabolization pace of the drug [13]. That is to say, the large intersubject variability of efavirenz exposure could be explained by the CYP2B6 genetic variations [23]. Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline suggests CYP2B6 genotyping prior to prescription of efavirenz-containing antiretroviral therapy, as CYP2B6 is highly polymorphic and some of its variants lead to substantial differences in plasma efavirenz exposure [24]. For instance, CYP2B6∗6 (516G > T) results in aberrant splicing, which in turn leads to reduced CYP2B6 expression. Table 4 summarizes the effects of CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T) polymorphisms in efavirenz metabolization and provides the frequencies of CYP2B6 polymorphisms.
Table 4.
The effects of CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T) polymorphisms in efavirenz metabolization and mutated allele frequency of CYP2B6 polymorphisms worldwide, especially in West Asia.
| Polymorphism | CYP2B6 | Efavirenz metabolization | Proposed mechanism | Studies' findings (mutated allele percentage) | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Current study | Iran (Mazani) [6] | Iran (Baloch) [25] | West Asian [26] | Italian [27] | Caucasian [28] | German [29] | United Kingdom [30] | ||||
| CYP2B6∗6 (516G > T) | Reduced expression [31, 32] | Poor metabolization | (i) Aberrant splicing [33] (ii)Higher protein expression in COS-1 cells [34] (iii) Demethylation catalytic activity with the substrate 4-trifluoromethylcoumarin [34] |
41.50 | 48 | 10.4 | 21.5 | 29.1 | 25.6 | 25 | 28.1 |
|
| |||||||||||
| CYP2B6∗4 (785A > G) | Reduced expression [32] | Poor metabolization | (i) Higher protein expression in COS-1 cells [34] (ii) Demethylation catalytic activity with the substrate 4-trifluoromethylcoumarin [34] |
37.41 | 43 | 23.1 | 14.7 | 2.82 | 4 | 5 | 1.1 |
|
| |||||||||||
| CYP2B6∗5 (1459C > T) | Increased activity [35] | Rapid metabolization | (i) Unknown. | 24.49 | 0.08 | 2.4 | NR | 17.3 | 10.9 | 9.5 | 12.2 |
COS, CV-1 (simian) in origin and carrying the SV40 genetic material; NR, not reported.
Not only in-vitro studies demonstrated that CYP2B6∗6 (516G > T) is associated with the decreased catalytic activity of CYP2B6 and decreased efavirenz metabolism [35–37] but also clinical studies proved that CYP2B6∗6 (516G > T) is associated with increased efavirenz level in plasma [32, 38, 39]. In other words, previous studies revealed that populations with a higher frequency of CYP2B6∗6 are at higher risk of efavirenz toxicity. In this study, Kurds were identified as a population with CYP2B6∗6 mutated homozygote genotype (TT) frequencies as high as 34 percent.
The greatness of this percentage becomes more tangible when compared to previous studies. For instance, Haas et al.'s study reported a TT frequency of 20 percent in its African-Americans participants. They concluded that African-Americans have greater efavirenz plasma exposure during HIV therapy and should be considered a high-risk group in terms of efavirenz ADR [40]. The findings of the Gounden et al. study in South African HIV-infected patients were also similar to Haas et al.'s study [41]. On the other hand, studies conducted in Mozambican, Zimbabwean, and Senegalese populations reported a CYP2B6∗6 allele frequency higher than Kurd participants in this study [42–44]. To consider the study's small sample, we reported all frequencies with their 95% confidence intervals. It is noteworthy that even the lowest 95% confidence interval of TT frequency in the Kurd population is higher than the TT frequency reported in some previous studies [40, 45].
Zakeri et al.'s study, which is the single study conducted in Iran to evaluate the frequency of CYP2B6 variants, showed that CYP2B6∗6 allele frequency is 10.2% in the Baloch population in southeast Iran [44]. Their findings were consistent with our results in Turk and Fars populations. Conversely, the T allele was more frequent in the Kurd population than in the Baloch population. We should keep in mind that the Baloch ethnicity, which comprises only about 2 percent of the country's population [18], is not a representative sample of whole Iranians. Moreover, there is a significant geographical distance between Balochs predominantly living in the southeast and Kurds residence in the country's northwest.
Moreover, Zakeri et al. showed that the prevalence of mutated homozygote of CYP2B6∗4 (785A > G) (GG), which is attributed to decreased CYP2B6 activity, in Baloch ethnicity is 10.4 (7.8–13.8) percent [25], which is relatively lower than the results of this study. These findings can also be justified by the small share of Balochs in Iran's population and geographic considerations. On the other hand, the frequency of the G allele reported in this study is similar to other ethnic populations such as Timorians (29.2 percent) [46], Malays (37.2 percent) [47], and Indians (36.3 percent) [48].
Similar to CYP2B6∗6, the mutated allele frequency of CYP2B6∗5 (1459C > T) is higher in Kurds than in other Iranian ethnicities. TT phenotype leads to the increased catalytic activity of CYP2B6 and increased efavirenz metabolism [35]. Having a high frequency of both CYP2B6∗6 and ∗5 puts Kurds at higher risk of inadequate drug exposure and ADRs, prioritizing this ethnicity for testing CYP2B6 variants over other Iranian ethnicities. Arenaz et al. investigated the potential differences in allele frequencies of the CYP2B6 gene between Spaniards and Central Americans. They showed that the frequency of the T allele ranges from 1.0 percent in Japanese ethnicity to 14.0 in Caucasian (German) ethnicity. Although the frequency of CYP2B6∗5 in their study is not as high as ours, their findings verified that CYP2B6∗5 frequency is vastly different among ethnicities [49].
There are several limitations to our study. First, the sample size of the current study was small, and other cross-sectional studies with larger sample sizes should be conducted to evaluate the allele frequency in Iranian ethnicities and identify high-risk ethnicity groups. Moreover, in this study, three major mutations of CYP2B6 were evaluated (CYP2B6∗6 (516G > T), CYP2B6∗4 (785A > G), and CYP2B6∗5 (1459C > T)), while other minor mutations such as CYP2B6∗15 (1172T > A), CYP2B6∗11 (136A > G), CYP2B6∗2 (64C > T), and CYP2B6∗3 (777C > A) in CYP2B6 may also play a role in the drug metabolism. More importantly, sequence analysis was not conducted in this study. The lack of sequence analysis warns us to interpret the data of the investigated CYP2B6 polymorphisms more carefully.
In conclusion, this study revealed that a high frequency of CYP2B6∗6 and ∗5 leads to an increase in the risk of ADRs and insufficient anti-HIV response in Kurds, respectively. This study proposes genotyping for clinically significant mutations, especially in Kurds, before anti-HIV therapy with efavirenz.
Acknowledgments
This study was funded by Alborz University of Medical Sciences. The authors wish to thank all staff members of the National Institute of Genetic Engineering and Biotechnology (NIGEB), especially Parisa Veiskrami and Fardis Markazi Laboratory. The authors are also grateful to Dr. Mostafa Qorbani for his scientific support.
Contributor Information
Roshanak Jazayeri, Email: roshanakjazayeri@gmail.com.
Massoud Houshmand, Email: massoud47672610housh8mand@yahoo.com.
Data Availability
The raw data supporting the conclusions of this article will be made available by the corresponding authors without undue reservation.
Disclosure
The funder had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Authors' Contributions
PM drafted the manuscript; PM and SSN conducted the experiments; BTF participated in sample collection and revised the manuscript critically. RJ and MH supervised the experiments and revised the manuscript critically. All authors read and approved the final version of the manuscript.
References
- 1.Goetz L. H., Schork N. J. Personalized medicine: motivation, challenges, and progress. Fertility and Sterility . 2018;109(6):952–963. doi: 10.1016/j.fertnstert.2018.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sabnis A. J., Bivona T. G. Principles of resistance to targeted cancer therapy: lessons from basic and translational cancer biology. Trends in Molecular Medicine . 2019;25(3):185–197. doi: 10.1016/j.molmed.2018.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Micaglio E., Locati E. T., Monasky M. M., Romani F., Heilbron F., Pappone C. Role of pharmacogenetics in adverse drug reactions: an update towards personalized medicine. Frontiers in Pharmacology . 2021;12 doi: 10.3389/fphar.2021.651720.651720 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rotondo J. C., Giari L., Guerranti C., et al. Environmental doses of perfluorooctanoic acid change the expression of genes in target tissues of common carp. Environmental Toxicology and Chemistry . 2018;37(3):942–948. doi: 10.1002/etc.4029. [DOI] [PubMed] [Google Scholar]
- 5.Langmia I. M., Just K. S., Yamoune S., Brockmöller J., Masimirembwa C., Stingl J. C. CYP2B6 functional variability in drug metabolism and exposure across populations—implication for drug safety, dosing, and individualized therapy. Frontiers in Genetics . 2021;12 doi: 10.3389/fgene.2021.692234.692234 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hashemi-Soteh M. B., Hosseini E., Fazelnia S., Ghasemian-Sorbeni F., Madahian S., Shiran M. R. Frequencies of CYP2B64, 5, and 6 alleles within an Iranian population (Mazandaran) Genetics Research . 2021;2021:6. doi: 10.1155/2021/8703812.8703812 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Benzaken A. S., Pereira G. F. M., Costa L., Tanuri A., Santos A. F., Soares M. A. Antiretroviral treatment, government policy and economy of HIV/AIDS in Brazil: is it time for HIV cure in the country? AIDS Research and Therapy . 2019;16(1):19–27. doi: 10.1186/s12981-019-0234-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Vrouenraets S. M., Wit F. W., Tongeren J. V., Lange J. M. Efavirenz: a review. Expert Opinion on Pharmacotherapy . 2007;8(6):851–871. doi: 10.1517/14656566.8.6.851. [DOI] [PubMed] [Google Scholar]
- 9.Merrick S. T. Selecting an Initial ART Regimen . Baltimore, MD, USA: Johns Hopkins University; 2019. [PubMed] [Google Scholar]
- 10.Guidelines for AIDS care and treatment. 2017. http://healthab.kaums.ac.ir//UploadedFiles/files/aids.nojavan.bozorgsal.pdf .
- 11.Abutika R. A. Burden of Neuropsychiatric Adverse Effects and Changes in Weight Among Hiv Infected Patients Switched from an Efavirenz Based to a Dolutegravir Based First Line Regimen at the Kenyatta National Hospital . Nairobi, Kenya: University of Nairobi; 2020. [Google Scholar]
- 12.Apostolova N., Blas-Garcia A., Galindo M. J., Esplugues J. V. Efavirenz: what is known about the cellular mechanisms responsible for its adverse effects. European Journal of Pharmacology . 2017;812:163–173. doi: 10.1016/j.ejphar.2017.07.016. [DOI] [PubMed] [Google Scholar]
- 13.McDonagh E. M., Lau J. L., Alvarellos M. L., Altman R. B., Klein T. E. PharmGKB summary: efavirenz pathway, pharmacokinetics. Pharmacogenetics and Genomics . 2015;25(7):363–376. doi: 10.1097/fpc.0000000000000145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Wyen C., Hendra H., Vogel M., et al. Impact of CYP2B6 983T>C polymorphism on non-nucleoside reverse transcriptase inhibitor plasma concentrations in HIV-infected patients. Journal of Antimicrobial Chemotherapy . 2008;61(4):914–918. doi: 10.1093/jac/dkn029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Leger P., Dillingham R., Beauharnais C. A., et al. CYP2B6 variants and plasma efavirenz concentrations during antiretroviral therapy in Port-au-Prince, Haiti. The Journal of Infectious Diseases . 2009;200(6):955–964. doi: 10.1086/605126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Li J., Menard V., Benish R. L., et al. Worldwide variation in human drug-metabolism enzyme genes CYP2B6 and UGT2B7: implications for HIV/AIDS treatment. Pharmacogenomics . 2012;13(5):555–570. doi: 10.2217/pgs.11.160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Factbook. T. W. Iran. 2021. https://www.cia.gov/the-world-factbook/countries/iran 2021 .
- 18.CIA. The World Factbook (Iran) McLean, Virginia: CIA; 2021. [Google Scholar]
- 19.Dehbozorgi M., Kamalidehghan B., Hosseini I., et al. Prevalence of the CYP2C192 (681 G>A), 3 (636 G>A) and 17 (−806 C>T) alleles among an Iranian population of different ethnicities. Molecular Medicine Reports . 2018;17(3):4195–4202. doi: 10.3892/mmr.2018.8377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Haghshenas M., Kamalidehghan B., Bagheri A., et al. Prevalence of the CYP2D610 (C100T), 4 (G1846A), and 14 (G1758A) alleles among Iranians of different ethnicities. Drug Design, Development and Therapy . 2015;9:2627–2634. doi: 10.2147/dddt.s79709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ott J., Rao D. C. A chi-square test to distinguish allelic association from other causes of phenotypic association between two loci. Genetic Epidemiology . 1985;2(1):79–84. doi: 10.1002/gepi.1370020108. [DOI] [PubMed] [Google Scholar]
- 22.Balram C., Sharma A., Sivathasan C., Lee E. J. D. Frequency of C3435T single nucleotide MDR1 genetic polymorphism in an Asian population: phenotypic–genotypic correlates. British Journal of Clinical Pharmacology . 2003;56(1):78–83. doi: 10.1046/j.1365-2125.2003.01820.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Burger D., van Der Heiden I., La Porte C., et al. Interpatient variability in the pharmacokinetics of the HIV non‐nucleoside reverse transcriptase inhibitor efavirenz: the effect of gender, race, and CYP2B6 polymorphism. British Journal of Clinical Pharmacology . 2006;61(2):148–154. doi: 10.1111/j.1365-2125.2005.02536.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Desta Z., Gammal R. S., Gong L., et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for CYP2B6 and efavirenz‐containing antiretroviral therapy. Clinical Pharmacology & Therapeutics . 2019;106(4):726–733. doi: 10.1002/cpt.1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zakeri S., Amiri N., Pirahmadi S., Dinparast Djadid N. Genetic variability of CYP2B6 polymorphisms in southeast Iranian population: implications for malaria and HIV/AIDS treatment. Archives of Iranian Medicine . 2014;17(10):685–691. [PubMed] [Google Scholar]
- 26.1000 Genomes Project Consortium, Auton A., Brooks L. D., et al. A global reference for human genetic variation. Nature . 2015;526(7571):68–74. doi: 10.1038/nature15393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Carano F., Sarno S., De Fanti S., et al. Genetic variability of CYP2D6, CYP2B6, CYP2C9 and CYP2C19 genes across the Italian Peninsula. Annals of Human Biology . 2018;45(1):66–71. doi: 10.1080/03014460.2017.1378368. [DOI] [PubMed] [Google Scholar]
- 28.Lang T., Klein K., Fischer J., et al. Extensive genetic polymorphism in the human CYP2B6 gene with impact on expression and function in human liver. Pharmacogenetics . 2001;11(5):399–415. doi: 10.1097/00008571-200107000-00004. [DOI] [PubMed] [Google Scholar]
- 29.Kirchheiner J., Klein C., Meineke I., et al. Bupropion and 4-OH-bupropion pharmacokinetics in relation to genetic polymorphisms in CYP2B6. Pharmacogenetics . 2003;13(10):619–626. doi: 10.1097/00008571-200310000-00005. [DOI] [PubMed] [Google Scholar]
- 30.Krishna S., Planche T., Agbenyega T., et al. Bioavailability and preliminary clinical efficacy of intrarectal artesunate in Ghanaian children with moderate malaria. Antimicrobial Agents and Chemotherapy . 2001;45(2):509–516. doi: 10.1128/aac.45.2.509-516.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Siccardi M., Almond L., Schipani A., et al. Pharmacokinetic and pharmacodynamic analysis of efavirenz dose reduction using an in vitro–in vivo extrapolation model. Clinical Pharmacology & Therapeutics . 2012;92(4):494–502. doi: 10.1038/clpt.2012.61. [DOI] [PubMed] [Google Scholar]
- 32.Sukasem C., Chamnanphon M., Koomdee N., et al. High plasma efavirenz concentration and CYP2B6 polymorphisms in Thai HIV-1 infections. Drug Metabolism and Pharmacokinetics . 2013;28(5):391–397. doi: 10.2133/dmpk.dmpk-12-rg-120. [DOI] [PubMed] [Google Scholar]
- 33.Hofmann M. H., Blievernicht J. K., Klein K., et al. Aberrant splicing caused by single nucleotide polymorphism c. 516G> T [Q172H], a marker of CYP2B66, is responsible for decreased expression and activity of CYP2B6 in liver. Journal of Pharmacology and Experimental Therapeutics . 2008;325(1):284–292. doi: 10.1124/jpet.107.133306. [DOI] [PubMed] [Google Scholar]
- 34.Jinno H., Tanaka-Kagawa T., Ohno A., et al. Functional characterization of cytochrome P450 2B6 allelic variants. Drug Metabolism & Disposition . 2003;31(4):398–403. doi: 10.1124/dmd.31.4.398. [DOI] [PubMed] [Google Scholar]
- 35.Zhang H., Sridar C., Kenaan C., Amunugama H., Ballou D. P., Hollenberg P. F. Polymorphic variants of cytochrome P450 2B6 (CYP2B6. 4–CYP2B6. 9) exhibit altered rates of metabolism for bupropion and efavirenz: a charge-reversal mutation in the K139E variant (CYP2B6. 8) impairs formation of a functional cytochrome P450-reductase complex. Journal of Pharmacology and Experimental Therapeutics . 2011;338(3):803–809. doi: 10.1124/jpet.111.183111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ariyoshi N., Ohara M., Kaneko M., et al. Q172H replacement overcomes effects on the metabolism of cyclophosphamide and efavirenz caused by CYP2B6 variant with Arg262. Drug metabolism and disposition . 2011;39(11):2045–2048. doi: 10.1124/dmd.111.039586. [DOI] [PubMed] [Google Scholar]
- 37.Desta Z., Saussele T., Ward B., et al. Impact of CYP2B6 polymorphism on hepatic efavirenz metabolism in vitro. Pharmacogenomics . 2007;8 doi: 10.2217/14622416.8.6.547. [DOI] [PubMed] [Google Scholar]
- 38.Abdelhady A. M., Shugg T., Thong N., et al. Efavirenz inhibits the human ether‐a‐go‐go related current (hERG) and induces QT interval prolongation in CYP2B66 6 allele carriers. Journal of Cardiovascular Electrophysiology . 2016;27(10):1206–1213. doi: 10.1111/jce.13032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Swart M., Skelton M., Ren Y., Smith P., Takuva S., Dandara C. High predictive value of CYP2B6 SNPs for steady-state plasma efavirenz levels in South African HIV/AIDS patients. Pharmacogenetics and Genomics . 2013;23(8):415–427. doi: 10.1097/fpc.0b013e328363176f. [DOI] [PubMed] [Google Scholar]
- 40.Haas D. W., Ribaudo H. J., Kim R. B., et al. Pharmacogenetics of efavirenz and central nervous system side effects: an Adult AIDS Clinical Trials Group study. AIDS . 2004;18(18):2391–2400. [PubMed] [Google Scholar]
- 41.Gounden V., van Niekerk C., Snyman T., George J. A. Presence of the CYP2B6 516G> T polymorphism, increased plasma Efavirenz concentrations and early neuropsychiatric side effects in South African HIV-infected patients. AIDS Research and Therapy . 2010;7(1):p. 32. doi: 10.1186/1742-6405-7-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Nyakutira C., Röshammar D., Chigutsa E., et al. High prevalence of the CYP2B6 516G ⟶ T (6) variant and effect on the population pharmacokinetics of efavirenz in HIV/AIDS outpatients in Zimbabwe. European Journal of Clinical Pharmacology . 2008;64(4):357–365. doi: 10.1007/s00228-007-0412-3. [DOI] [PubMed] [Google Scholar]
- 43.Arnaldo P., Thompson R. E., Lopes M. Q., Suffys P. N., Santos A. R. Frequencies of cytochrome P450 2B6 and 2C8 allelic variants in the Mozambican population. Malaysian Journal of Medical Sciences: MJMS . 2013;20(4):13–23. [PMC free article] [PubMed] [Google Scholar]
- 44.Mehlotra R. K., Ziats M. N., Bockarie M. J., Zimmerman P. A. Prevalence of CYP2B6 alleles in malaria-endemic populations of West Africa and Papua New Guinea. European Journal of Clinical Pharmacology . 2006;62(4):267–275. doi: 10.1007/s00228-005-0092-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Hiratsuka M., Takekuma Y., Endo N., et al. Allele and genotype frequencies of CYP2B6 and CYP3A5 in the Japanese population. European Journal of Clinical Pharmacology . 2002;58(6):417–421. doi: 10.1007/s00228-002-0499-5. [DOI] [PubMed] [Google Scholar]
- 46.Hananta L., Astuti I., Sadewa A. H., Alice J., Hutagalung J., Mustofa The Prevalence of <italic&gt;CYP2B6&lt;/italic&gt; Gene Polymorphisms in Malaria-endemic Population of Timor in East Nusa Tenggara Indonesia. Osong public health and research perspectives . 2018;9(4):192–196. doi: 10.24171/j.phrp.2018.9.4.08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ismail R., Fauzi H., Musa N., Talib N., Mohamad N., Zulkafli M. Haplotypes frequencies of CYP2B6 in Malaysia. Journal of Postgraduate Medicine . 2012;58(4):p. 235. doi: 10.4103/0022-3859.105439. [DOI] [PubMed] [Google Scholar]
- 48.Varshney E., Saha N., Tandon M., Shrivastava V., Ali S. Prevalence of poor and rapid metabolizers of drugs metabolized by CYP2B6 in North Indian population residing in Indian national capital territory. SpringerPlus . 2012;1(1):34–37. doi: 10.1186/2193-1801-1-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Arenaz I., Vicente J., Fanlo A., et al. Haplotype structure and allele frequencies of CYP2B6 in Spaniards and Central Americans. Fundamental & Clinical Pharmacology . 2010;24(2):247–253. doi: 10.1111/j.1472-8206.2009.00753.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The raw data supporting the conclusions of this article will be made available by the corresponding authors without undue reservation.
