DNA Methylation Pattern of Gene Promoters of MB-COMT, DRD2, and NR3C1 in Turkish Patients Diagnosed with Schizophrenia

Abstract

Objective

We aim to evaluate the methylation status of membrane-bound catechol-O-methyltransferase (MB-COMT) promotor, dopamine receptor D2 (DRD2), and nuclear receptor subfamily 3 group C member 1 (NR3C1) gene in patients with SCZ by comparing healthy controls.

Methods

A sample of 110 patients with SCZ and 100 age- and sex-matched healthy volunteers was included in the study. The interview was started by filling out data forms that included sociodemographic and clinical information. The Structured Clinical Interview for DSM-IV Axis I Disorders was used to confirming the diagnosis according to DSM-IV-TR criteria. Then the patients were evaluated with the Positive and Negative Symptoms Scale in terms of symptom severity. Methylation-specific polymerase chain reaction was used to determine the methylation status of MB-COMT promotor, DRD2, and NR3C1 gene from DNA material.

Results

When we compared the percentages of MB-COMT promotor, DRD2, and NR3C1 gene methylation status in SCZ patients with the healthy control group, the percentages of MB-COMT promotor (OR 0.466; 95% CI 0.268−0.809; p = 0.006), DRD2 (OR 0.439; 95% CI 0.375−0.514; p < 0.001), and NR3C1 (OR 0.003; 95% CI 0.001−0.011; p < 0.001) gene methylation status of SCZ was found to be significantly different from the control group. Whereas unmethylation of MB-COMT promotor and NR3C1 genes were associated with SCZ, the partial methylation of the DRD2 gene was related to the SCZ.

Conclusion

The MB-COMT promotor, DRD2, and NR3C1 gene methylation status may be associated with the SCZ in the Turkish population.

INTRODUCTION

Schizophrenia (SCZ) is characterized by the heterogonous presentation of positive, negative, and cognitive symptoms that cause significant impairments in psychosocial function, have a chronic course, and occur in nearly 1% of the world population [1]. The estimated heritability of SCZ and other psychotic disorders is as high as 60−80% [2]. However, genetics alone can not explain its incidence. Because it is well-known that environmental exposures can modify DNA methylation patterns, long- lasting alterations in gene expression patterns after environmental exposures imply that epigenetic mechanisms might play a critical role in psychiatric disorders [3]. Therefore, environmental risk factors exposed during early development and young adulthood also contribute to SCZ in susceptible individuals via modifications of DNA and DNA-associated histone proteins by methylation, acetylation, and phosphorylation [4].

Catechol-O-methyltransferase (COMT) is the critical enzyme responsible for dopamine metabolism in the brain’s cortical regions [5]. The COMT gene is placed on chromosome 22q11.21, has eight exons, and produces 271 amino acids that metabolize catecholamines [6]. COMT gene polymorphisms are associated with the enzyme activity: higher activity is related to the COMT Val allele, and lower activity is associated with the COMT Met allele [7,8]. Growing evidence has proposed the association of COMT genotypes in the pathophysiology of SCZ [9]. The relationship between COMT methylation and SCZ has concentrated on the soluble isoform (S-COMT) and the membrane-bound isoform (MB-COMT) [10]. Since the MB-COMT enzyme is included in dopamine and noradrenergic neurotransmission and is widely distributed in the peripheral blood and brain [11], therefore in our study, we studied the relationship between MB-COMT gene methylation and SCZ. Previous studies have published hypomethylation of MB-COMT in the brains of SCZ and bipolar disorder (BD) patients [12], and a similar hypo-methylated (~50%) MB-COMT promoter was in DNA derived from the saliva in SCZ and BD patients [13]. Recent research also reported hypomethyla-tion in the peripheral blood leukocytes of Malaysian SCZ patients compared to the control group [10].

Again, the dopamine receptor D2 (DRD2) gene localized on chromosome 11q23.2 can have Val96Ala, Leu141Leu, Val154Ile, Pro310Ser, Ser311Cys, TaqI A, A-241G, and -141C Ins/Del polymorphisms [14]. The D2 receptor is involved in affect regulation, learning, motivation, reward processing, and decision-making [15], all of which are crucial processes involved in neuropsychiatric disorders such as mood disorders [16], cognitive sequelae of SCZ [17], and attention deficit hyperactivity disorder [18]. DRD2 -141C insertion/deletion and Taq1A have been investigated as treatment response markers [19,20]. While -141C insertion/deletion Del allele carriers were significantly associated with a poorer antipsychotic treatment response than the Ins/Ins genotype, there were no significant differences in the treatment response frequencies among Taq1A A1 allele carriers relative to SCZ patients with the A2/A2 genotype or A2 allele carriers relative to SCZ patients with the A1/A1 genotype [21]. Based on this dopamine hypothesis, several antipsychotics have been developed, and several studies have been conducted to identify biomarkers for SCZ diagnosis and the treatment response concerning the gene for DRD2. Yoshino et al. showed hypomethylation of DRD2 in Japanese SCZ patients [22]. Therefore, DNA methylation alterations in DRD2 may influence gene expression and may be associated with SCZ.

The genes like nuclear receptor subfamily 3 group C member 1 (NR3C1) play a critical role in the hypothalamic-pituitary-adrenal (HPA)-axis regulation, consisting of 8 introns and 9 exons on chromosome 5q31-32, encodes the glucocorticoid receptor [23]. Altered NR3C1 methylation is related to early stress exposure. It thus may cause the occurrence of psychopathologies including major depressive disorder [24], SCZ [25], post-traumatic stress disorder [26], suicidal behavior [27], bulimia nervosa [28], borderline personality disorder [29], alcohol-tobacco consumption [30], and cocaine use disorder [31]. Recently, Misiak et al. [32] published that the patients with SCZ-spectrum disorders show altered levels of NR3C1 methylation that are significantly lower in first- episode psychosis patients and significantly higher in acutely relapsed SCZ patients. No earlier researches have shown the methylation status of MB-COMT promotor, DRD2, and NR3C1 gene on SCZ in the Turkish popula-tion. We hypothesized that alteration of the methylation status of MB-COMT promotor, DRD2, and NR3C1 gene might be related to the SCZ. Therefore, we aimed to evaluate the relationship between SCZ and methylation status of MB-COMT promotor, DRD2, and NR3C1 gene by comparing healthy controls.

METHODS

This case-control study included 110 SCZ patients and 100 age- and sex-matched healthy controls and utilized a consecutive sampling design. SCZ patients were consecutively gathered from State Hospital Psychiatry Outpa-tient Clinic for three months. The study was approved by the Clinical Research Ethics Committee of Istanbul Faculty of Medicine, under the ethical standard for human experimentation established by the Declaration of Helsinki (03/22.01.2021) [33]. We informed the patients in detail about the study’s purpose, method, and procedures and obtained all the participants’ written consent. The interview was started by filling out data forms that included sociodemographic and clinical information. Afterward, the Structured Clinical Interview for DSM-IV Axis-I Disorders (SCID-I) was used to exclude the psychiatric diagnosis and any psychiatric symptoms or non-specific psychological distress from the healthy control group. We recruited a healthy control group from the same geogra-phical areas as the patients, and they were well-matched with the patients’ group in terms of similar age, ethnicity, and sex. The Positive and Negative Symptoms Scale (PANSS) was used to evaluate positive symptoms, negative symptoms, and general psychopathology in psychotic patients and measure the severity of these symptoms [34,35]. Subjects of 18 to 65 years of age, of either sex, literate, agreed on the participation in the study, diagnosed with SCZ according to the SCID-I interview, had no other systemic/neurological disorder that may affect cognitive functions included in the study. We had excluded subjects who refused participation or had mental retardation, neurodevelopmental disorders, a diagnosis of axis-1 disorder other than SCZ, psychosis secondary to a general medical condition.

DNA Analyses

Blood samples and DNA extraction

The intravenous blood samples were collected from patients with SCZ and the control groups in 4 ml ethylenediaminetetraacetic acid tubes. Genomic DNA was obtained from the blood samples by using the GeneMark isolation kit (Plus Blood Genomic Purification Kit; Genemark, Atlanta, GA, USA).

Methylation-specific polymerase chain reaction

Bisulfite modification is accepted as the gold standard to determine the methylation status of DNA. To analyze, after isolation of DNA samples, we used the EZ-96 DNA Methylation-Gold kit according to manufacturer recommendations (Zymo Research): 10 minutes at 95°C, 40 cycles (30 seconds at 95°C, 40 seconds at annealing temperature for each primer, and 45 seconds at 72°C), and 72°C for 7 minutes. For methylation analysis of MB-COMT promotor [13], DRD2 [36], and NR3C1 [37] genes, two pairs of primers, one pair of methylated, and one pair of unmethylated, were used for each region. We showed primer sequences and annealing temperatures in Table 1.

Table 1.

Primer pairs and annealing temperatures for MB-COMT, DRD2, and NR3C1 genes

Gene	Primer set	Forward (5’-3’)	Reverse (5’-3’)	Annealing temp. (°C)/Cycle count
DRD2	MSP M MSP U	CGTTTAGGTCGGGGATCGTCG TGTTTAGGTTGGGGATTGTTG	GACGCCCGAACGCGAAAAACGCG AACACCCAAACACAAAAAACACA	67/40 56/40
MB-COMT	MSP M MSP U	TATTTTGGTTATCGTCGCGC TATTTTGGTTATTGTTGTGT	AACGAACGCAAACCGTAACG AACAAACACAAACCATAACA	56/40 56/40
NR3C1	MSP M MSP U	TCGGTTTCGTTCGTTCGTTTAGGTC TTGGTTTTGTTTGTTTGTTTAGGTT	CGTCCCGATCCCAACTACTTCGAC CCATCCCAATCCCAACTACTTCAAC	69/40 61/40

MB-COMT, membrane-bound catechol-O-methyltransferase; DRD2, dopamine receptor D2; NR3C1, nuclear receptor subfamily 3 group C member 1; PCR, polymerase chain reaction; MSP, methylation-specific PCR; M, methylated; U, unmethylated.

Statistical Analyses

Statistical analysis was performed using IBM SPSS version 21.0 (IBM Corp. released 2012, Armonk, NY, USA). Quantitative data (clinical parameters, MB-COMT promotor, DRD2, and NR3C1 gene methylation) represented as descriptive statistics included the minimum, maximum, mean, standard deviation, frequency, and percentage. The Pearson chi-square or Fisher’s exact test analyzed comparisons of MB-COMT promotor, DRD2, and NR3C1 gene methylation of SCZ patients. We accepted statistical significance as p < 0.05 for the results of all analyses. The power analysis was performed with the “G*power” software (version 3.0.5, http://www.psycho.uni-duesseldorf.de/abteilungen/aap/gpower3/).

RESULTS

MB-COMT Promotor, DRD2, and NR3C1 Gene Methylation Percentages of SCZ Patients

One hundred and ten patients diagnosed with SCZ were evaluated due to their clinical parameters, scale scores, MB-COMT promotor, DRD2, and NR3C1 gene methylation percentages, as shown in Table 2. In the MB-COMT gene methylation (partial methylation, unmethylation), 38.2% (n = 42) of the patients had partial methylated, 61.8% (n = 68) had unmethylated MB-COMT gene, in the DRD2 gene methylation (partial methylation, unmethylation), 100% (n = 110) of the healthy participants had partial methylated, 0% (n = 0) had unmethylated DRD2 gene, again in the NR3C1 gene methylation (partial methylation, unmethylation), 2.7% (n = 3) of the healthy participants had partial methylated, 97.3% (n = 107) had unmethylated NR3C1 gene.

Table 2.

The clinical characteristics and scale scores of SCZ patients

Variable		Schizophrenia (n = 110)
Sex	Male	80 (72.7)
	Female	30 (27.3)
MB-COMT	Partial	42 (38.2)
Methylation	Unmethylated	68 (61.8)
DRD2	Partial	110 (100)
Methylation	Unmethylated	0 (0)
NR3C1	Partial	3 (2.7)
Methylation	Unmethylated	107 (97.3)
Age		39.2 ± 8.9
Age of onset (yr)		24 ± 7.6
Number of hospt.		3.4 ± 4.5
Last hospt. (years ago)		5.5 ± 5.3
PANSS total		57.8 ± 12.9
PANSS psycho.		30.1 ± 7.2
PANSS neg.		16.2 ± 5.3
PANSS pos.		11.7 ± 3.7

Values are presented as number (%) or mean ± standard deviation.

SCZ, schizophrenia; MB-COMT, membrane-bound catechol-O- methyltransferase; DRD2, dopamine receptor D2; NR3C1, nuclear receptor subfamily 3 group C member 1; hospt., hospitalization; PANSS, positive and negative syndrome scale; pos., positive; neg., negative; psycho., psychopathology.

Comparison of Percentages of MB-COMT Promotor, DRD2, and NR3C1 Gene Methylation Status in Patients with SCZ to the Control Group

When comparing the scale score (PANSS pos., PANSS neg., PANSS psycho., PANSS total), duration of the disorder, age of onset, and the number of hospitalizations according to MB-COMT promotor, DRD2, and NR3C1 gene methylation status in patients with SCZ, there was no statistically significant difference found between the groups (data not shown). When the percentages of MB-COMT promoter gene methylation in SCZ patients were compared with the control group, the percentages of MB-COMT promoter methylation of SCZ were found to be significantly different from the control group (odds ratio [OR]: 0.466; 95% confidence interval [CI]: 0.268−0.809; p = 0.006). Comparing the percentages of DRD2 gene methylation in SCZ patients with the control group, the percentages of DRD2 gene methylation of SCZ was found to be significantly different from the control group (OR: 0.439; 95% CI: 0.375−0.514; p < 0.001). Again, when the percentages of NR3C1 gene methylation in SCZ patients were compared with the control group, the percentages of NR3C1 gene methylation of SCZ was found to be significantly different from the control group (OR: 0.003; 95% CI: 0.001−0.011; p < 0.001) (Table 3).

Table 3.

Comparison of frequencies of the MB-COMT, DRD2, and NR3C1methylation between SCZ patients and controls

Methylation	Genotype	SCZ (n = 110)	Healthy control (n = 100)	Odds ratio	95% confidence interval	pvalue*
MB-COMT	Unmethylation	68 (61.8)	43 (43.0)
	Partial methylation	42 (38.2)	57 (57.0)	0.466	0.268−0.809	0.006*
DRD2	Unmethylation	0 (0.0)	14 (14)
	Partial methylation	110 (100.0)	86 (86)	0.439	0.375−0.514	0.000*
NR3C1	Unmethylation	107 (97.3)	9 (9)
	Partial methylation	3 (2.7)	91 (91)	0.003	0.001−0.011	0.000*

Values are presented as number (%).

SCZ, schizophrenia; MB-COMT, membrane-bound catechol-O-methyltransferase; DRD2, dopamine receptor D2; NR3C1, nuclear receptor subfamily 3 group C member 1.

*Pearson chi-square.

DISCUSSION

This study demonstrated that the percentages of MB-COMT promotor, DRD2, and NR3C1 gene methylation status of SCZ patients were significantly different from the control group. Whereas unmethylation of MB-COMT promotor and NR3C1 genes were associated with SCZ, the partial methylation of the DRD2 gene was related to the SCZ. Growing evidence proposes that epigenetic alterations, such as DNA methylation and histone modifications, may contribute an additional explanation for the pathophysiology of SCZ [38]. Therefore, biological conditions like prenatal infections during development in the uterus [39], as well as social conditions like childhood trauma [40], the migrant status [41] might change gene expression leading to SCZ in genetically susceptible individuals [42]. There is abundant evidence for alterations of DNA methylation in SCZ, both at the site-specific and genome-wide levels [43]. DNA methylation alterations in the promoters of COMT [13], glutamate decarboxylase 1 (GAD1) [44], reelin (RELN) [45], DNA methyltransferase 1 (DNMT1) [46], DNA methyltransferase 3a, (DNMT3a) [46], serotonin receptor type-1 (HTR1A) [47], serotonin receptor type-2 (HTR2A) [48], and other genes have been shown [38]. Recent studies have investigated genome- wide methylation levels in the blood and brain tissue in SCZ with the development of the more advanced array- and sequencing-based techniques [43]. A few of these epigenome-wide association studies (EWAS) have validated the significance of GABA-associated genes in SCZ regarding aberrant methylation of Helt BHLH Transcription Factor (HELT) [49] and genes within the GAD1 regulatory network in SCZ brain tissue [50]. Moreover, Wockner et al. [51] recognized significant differential methylation in genes previously related to SCZ, including DNMT1, Nitric Oxide Synthase 1 (NOS1), and SRY-related HMG-box 10 (SOX10).

COMT has also been related to positive symptoms [52], negative symptoms [53], and cognitive deficits [54]. Besides, a recent meta-analysis showed that COMT was related to the severity of symptoms and cognitive parameters as well as treatment resistance in SCZ [55]. Previous researches in SCZ patients have reported hypomethyla-tion of MB-COMT in the peripheral blood [10,56], saliva [13], and brain [12]. Contrastly, the DNA methylation of S-COMT seems to be increased in the peripheral blood and the brain tissues of SCZ patients [57]. Our results also showed that the MB-COMT gene overexpression was statistically significant. Theoretically, the overexpression of MB-COMT is related to increasing dopamine degradation, which is consistent with the critical role in dopamine neurotransmission and the dopamine hypothesis of SCZ. Therefore, we speculate that the epigenetic alteration of MB-COMT in the peripheral blood could be a potential peripheral biomarker of SCZ. When we compared the PANSS scale scores, duration of disease, age of onset, and the number of hospitalizations due to MB-COMT promoter methylation status in patients with SCZ, there was no statistically significant difference. Similarly, Nour El Huda et al. [10] did not find significant associations between the COMT methylation percentages and age at onset, duration of illness, PANSS total score except for the psycho-pathological symptoms. We assume that the lower COMT methylation rates are specific to SCZ pathogenesis and independent of scale scores and other clinical parameters.

Recently, large-scale genome-wide association research identified a significant relationship between DRD2 and SCZ [58]. However, no trait biomarkers regarding DRD2 are available. Again, methylation of DNA is a critical epigenetic mechanism in the regulation of gene expression. The genetic and environmental factor’s impact on specific changes in DNA methylation is mainly unknown. From genome-wide methylation research comparing peripheral blood from SCZ discordant monozygotic twins, and healthy controls, differences in DNA methylation in several genes were identified as diagnostic biomarkers. However, DRD2 was not detected in those studies [38,59]. One notable finding in our study is that the methylation percentages of the DRD2 gene were significantly higher in SCZ patients compared to control subjects. When the literature was reviewed, it was seen that only several types of research about DNA methylation of DRD2 by using peripheral leukocytes had been reported. Increased promoter methylation of dopamine receptor genes, including DRD4, DRD5, and DRD2, was shown in SCZ patients, similar to our study [60]. Conversely, in a previous study, Yoshiro did not find significant associations between the methylation percentages at individual CpG sites and age at onset, duration of illness, BPRS, or DIEPSS; even lower methylation rates were reported at other CpG sites of DRD2 in the SCZ group [22]. Again, Zhang et al. [61] did not find methylated CpG sites at the same CpG sites (CpG1 to 7) in a sib-pair study. These DRD2 genes’ methylation results have highlighted that the DRD gene network, overall, is actively involved in the increased risk of SCZ.

The HPA axis is thought the primary system involved in the regulation of stress. The glucocorticoid receptor (GR) is encoded by the NR3C1 gene, binds the HPA axis stress hormone cortisol [62]. Numerous researches have identified abnormalities of GR in the brains of patients with SCZ and BD. Besides, the transcript encoding GR’s overall expression levels are reduced in areas of the amygdala, hippocampus, and temporal cortex in SCZ and BD [63]. Earlier studies have mainly concentrated on identifying the relationship between SCZ-related genetic variants and clinical parameters [64,65]. Park et al. [66] published that two single nucleotide polymorphisms of NR3C1 (rs7701443 and rs2963155) may be associated with susceptibility to SCZ in the Korean population. In the present study, we reported a statistically significant difference between the methylation status of the NR3C1 gene of SCZ patients and control groups. The participants carrying the unmethylated NR3C1 gene had a higher risk of developing SCZ in the Turkish population. Our results are in line with the Misiak et al. [32] study. They reported significantly lower methylation of 4 CpG sites (CpG2, CpG4, CpG7, and CpG8) at the NR3C1 gene in first-episode psychosis patients than the high familial risk of psychosis individuals and healthy controls. Again, in a study examining the methylation state of the NR3C1 gene promoter region (exons 1D, 1B, 1F, and 1H) and its role in Chinese SCZ patients, have been reported that NR3C1 methylation at specific CpG sites in exon 1D, 1B, 1H, and 1F regions was related to SCZ, usually with sex specificity [67]. These results develop our experience concerning the HPA system’s function in developing SCZ and fill the gap in correlative research on NR3C1 gene methylation in SCZ.

Our study’s strength is that the first study showing the methylation status of MB-COMT promotor, DRD2, and NR3C1 gene on SCZ in the Turkish population. Secondly, since SCZ patients and healthy participants were collected from the same location, our study’s findings more valuable. Besides the strengths of the present research, there are also several limitations. The first limitation was the small sample size, which can limit the statistical power. Secondly, our study found that only DNA methylation was analyzed, while other epigenetic mechanisms such as histone deacetylation and hyperacetylation or miRNA were not studied. Also, the effect of psychotropic drugs on the epigenome can not be ruled out. Therefore, the dosage and duration of treatment were not accounted for in the statistical analysis due to difficulty collecting consistent data. Future studies are needed to elucidate the effects of psychotropic drugs on the epigenome. Lastly, confounding environmental factors such as diet and lifestyle are difficult to assess and were not evaluated in this study. In conclusion, whereas unmethylation of MB-COMT promotor and NR3C1 genes were associated with SCZ, the partial methylation of the DRD2 gene was related to the SCZ. Considering the advantage of blood samples in terms of accessibility, the DNA methylation status of the MB-COMT promotor, DRD2, and NR3C1 gene could potentially be helpful for developing biomarkers for this psychiatric disorder. Confirming these findings with different ethnicities will better investigate the association between these epigenetic alterations and SCZ.