Skip to main content
Pathogens logoLink to Pathogens
. 2022 Sep 30;11(10):1129. doi: 10.3390/pathogens11101129

Leptospira spp. Prevalence in Cats from Southern Italy with Evaluation of Risk Factors for Exposure and Clinical Findings in Infected Cats

Giulia Donato 1,*, Marisa Masucci 1,*, Katrin Hartmann 2, Marga G A Goris 3, Ahmed A Ahmed 3, Joy Archer 4, Angela Alibrandi 5, Maria Grazia Pennisi 1
Editor: Valentina Virginia Ebani
PMCID: PMC9609655  PMID: 36297186

Abstract

Leptospirosis is a worldwide zoonotic disease, but feline leptospirosis is rarely reported. This study aimed at investigating Leptospira spp. prevalence in cats from southern Italy, evaluating risk factors, clinical findings and laboratory data associated with infection. The serum of 112 cats was investigated by microscopic agglutination test (MAT), detecting anti-Leptospira antibodies against 14 pathogenic serovars. Blood and urine samples were tested by a real-time polymerase chain reaction targeting the lipL32 gene of pathogenic Leptospira. Antibodies against serovars Poi, Bratislava, Arborea, Ballum, Pomona and Lora were detected in 15.3% (17/111) of cats (titers range: 20–320). Leptospira spp. DNA was found in 3% (4/109) of blood and 9% (10/111) of urine samples. The spring season was the only risk factor for urinary Leptospira DNA shedding. Laboratory abnormalities significantly associated and/or correlated with Leptospira spp. positivity were anemia, monocytosis, neutrophilia, eosinopenia, increased alanine aminotransferase activity, hypoalbuminemia and hyperglobulinemia. In the investigated areas, cats are frequently infected by Leptospira spp. and can represent an additional reservoir or sentinel for a risk of infection. Moreover, some laboratory changes could be compatible with a pathogenic effect of Leptospira spp. in the feline host.

Keywords: leptospirosis, leptospires, infection, zoonosis, feline, microscopic agglutination test, MAT, polymerase chain reaction, PCR, epidemiology

1. Introduction

Leptospirosis is a zoonotic disease caused by Gram-negative, spirochetal bacteria belonging to the genus Leptospira. Leptospires are highly motile, elongated, helically coiled bacteria characterized by hook-shaped ends [1,2,3]. Currently, Leptospira interrogans sensu latu includes more than 260 pathogenic serovars belonging to 26 serogroups [1], and according to the European consensus statement on leptospirosis in dogs and cats, serogroups Icterohaemorragiae, Canicola, Grippotyphosa, Pomona, Sejroe, Ballum, Autumnalis and Bratislava are the most frequently identified in cats [2]. Leptospirosis is reported worldwide, and cases of feline leptospirosis have been described in Africa (Algeria and Reunion Island) [4,5,6], Asia (Iran, Japan, Malaysia, Taiwan and Thailand) [7,8,9,10,11,12,13,14], America (Brazil, Chile, Canada, Mexico, the Caribbean island of Saint Kitts and the USA) [15,16,17,18,19,20,21,22,23,24,25,26], Europe (the Czech Republic, Estonia, Germany, Greece, Serbia and Spain) [27,28,29,30,31,32,33], the United Kingdom (Scotland) [34], and Oceania (New Zealand and Australia) [35,36,37]. In Italy, Stefanetti and others [38] retrospectively investigated the role of Leptospira spp. in cases of abortion, stillbirth and neonatal mortality in cats, but none of the pathologic samples (placenta, pooled organs of fetuses and neonates) were found positive. Antibody prevalence and prevalence of Leptospira DNA in urine reported in cats range between 4% to 33.3% and 0% to 67.8%, respectively [1]. Although clinical signs in infected cats seem to be rare, they can shed leptospires in their urine and might represent a reservoir or incidental hosts in the transmission [1,2,3]. The close interaction between cats and humans offers ideal conditions for zoonotic transmission [39]. Cats can become infected by hunting prey that harbors leptospires or after exposure to infectious urine of cohabiting dogs, cats, and other species like pigs and cows [1,2,3]. Living outdoors, in urban areas and being an old cat or a hunting cat have been reported as possible risk factors for Leptospira spp. exposure. No associations have been reported with sex and/or breed [2,3]. Although in Italy, cases of leptospirosis are widely reported in dogs [40,41,42,43,44,45,46] and humans [47,48,49,50] and Leptospira spp. infection has been reported in other host species [51,52,53,54,55,56,57,58,59,60,61,62], only one study so far has investigated Leptospira spp. prevalence in cats [38]. The present study aimed to investigate Leptospira spp. prevalence in cats from southern Italy, evaluating risk factors for exposure and describing clinical findings and laboratory data on infected cats.

2. Results

2.1. Cat Demographic, Clinical and Clinicopathological Data

One hundred and twelve cats were included in the study, of which 111 blood serum samples, 111 urine samples and 109 K3EDTA blood samples were collected.

Twenty-six cats (23.2%) were from Sicily and 86 cats (76.8%) were from Calabria. Cats coming from Sicily and Calabria differed in age, lifestyle and environment. Particularly, adult cats (Fisher’s exact test, p = 0.0284) and cats living in suburban areas (Fisher’s exact test, p = 0.0354) were more frequently enrolled in Sicily, and most of the cats from Calabria lived outdoors rather than indoors (Fisher’s exact test, p = 0.0354) or indoor/outdoor (Fisher’s exact test, p = 0.0196).

Signalment and history of the enrolled cats are shown in Table 1, and the clinical findings are reported in Table 2. Clinicopathological abnormalities are reported in the supplementary Table S1. Cats were aged between 5 and 204 months (median 24 months, 25th percentile 10.5 months and 75th percentile 72 months). At physical examination, nasal discharge was reported as the only respiratory tract sign; gastrointestinal signs included stomatitis, vomiting and diarrhea; skin lesions were alopecia, hyperkeratosis, scaling, and abscess; and ocular signs included conjunctivitis and keratoconjunctivitis.

Table 1.

Data from signalment and history of enrolled cats (n (%)) and cats positive for Leptospira spp. according to antibody positivity (Ab+) and PCR positivity from urine (uDNA+) and blood (bDNA+).

Variable All Cats Ab+ uDNA+ bDNA+
Region
Sicily 26 (23.2) 4 (23.5) 1 (10.0) 3 (75.0)
Calabria 86 (76.8) 13 (76.5) 9 (90.0) 1 (25.0)
Sex
Male 51 (45.5) 8 (47.1) 2 (20.0) 2 (50.0)
Female 61 (54.5) 9 (52.9) 8 (80.0) 2 (50.0)
Age group
Junior (6–24 months) 28 (25.0) 4 (23.5) 3 (30.0) 0
Adult (25–96 months) 61 (54.5) 8 (47.1) 6 (60.0) 3 (75.0)
Senior (>96 months) 23 (20.5) 5 (29.4) 1 (10.0) 1 (25.0)
Lifestyle and Origin
Outoor 35 (31.2) 4 (23.5) 3 (30.0) 1 (25.0)
Outdoor and indoor 16 (14.3) 4 (23.5) 2 (20.0) 1 (25.0)
Indoor 61 (54.5) 9 (53.0) 5 (50.0) 2 (50.0)
Single-cat household 17 (27.9) 2 (22.2) 2 (40.0) 0
Multi-cat household 29 (47.5) 3 (33.3) 2 (40.0) 0
Rescue cattery 15 (24.6) 4 (44.5) 1 (20.0) 2
Foundling cat 27 (44.3) 4 (44.5) 3 (60.0) 2
Not-foundling cat 34 (55.7) 5 (55.5) 2 (40.0) 0
Cohabitation with dogs 15 (13.4) 2 (11.8) 2 (20.0) 0
No cohabitation with dogs 97 (86.6) 15 (88.2) 8 (80.0) 4
Enrollment Season
Autumn 15 (13.4) 3 (17.7) 2 (20.0) 1 (25.0)
Winter 61 (54.5) 9 (52.9) 2 (20.0) 3 (75.0)
Spring 33 (29.5) 4 (23.5) 6 (60.0) 0
Summer 3 (2.6) 1 (5.9) 0 0
Environment
Urban 84 (75.0) 12 (70.6) 8 (80.0) 3 (75.0)
Suburban 26 (23.2) 5 (29.4) 2 (20.0) 1 (25.0)
Rural 2 (1.8) 0 0 0
Total 112 17/111 10/111 4/109

Table 2.

Data from clinical findings of enrolled cats (n (%)) and cats positive for Leptospira spp. according to antibody positivity (Ab+) and PCR positivity from urine (uDNA+) and blood (bDNA+).

Variable All Cats Ab+ uDNA+ bDNA+
Mucous membranes
Normal 106 (94.6) 17 10 4
Pale 5 (4.5) 0 0 0
Jaundice 1 (0.9) 0 0 0
Body Condition Score < 3/5 ^ 11 (9.8) 4 (23.5) 1 (10.0) 1 (25.0)
Muscle Condition Score > ¼ ^ 15 (13.4) 4 (23.5) 0 1 (25.0)
Lymph node enlargement 27 (24.1) 4 (23.5) 3 (30.0) 2 (50.0)
Respiratory tract signs 10 (8.9) 0 1 (10.0) 0
Gastrointestinal signs 4 (3.6) 0 1 (10.0) 0
Skin lesions 14 (12.5) 3 (17.6) 2 (20.0) 1 (25.0)
Ocular lesions 6 (5.4) 2 (11.8) 0 1 (25.0)
Oral lesions 33 (29.5) 4 (23.5) 5 (50.0) 0
Total 112 17/111 10/111 4/109

^ = body condition and muscle condition scores were rated following a 5/5 [63] and 4/4 [64] scoring system, respectively.

2.2. Leptospira spp. Antibody Prevalence

Antibodies against Leptospira spp. were detected in 15.3% (17/111) of the cats. Antibody titers ranged from 20 to 320. The most frequently detected positivity was against serovar Poi (9/17 of Ab+ cats), followed by Bratislava (5/17) and Arborea (3/17), while antibodies against serovars Ballum, Pomona, Lora and Mini were less frequently detected (Table 3). Antibody titers against at least two serovars belonging to different serogroups were detected in two cats: one cat (cat 2) was positive for Jez Bratislava (titer 20) and Poi (titer 20) strains belonging to different serogroups; another cat (cat 6) was positive for the Jez Bratislava (titer 320) and Lora (titer 80) strains belonging to the same serogroup (Australis), and for the Sari (titer 80) and Arborea (titer 40) strains belonging to two other serogroups (Table 3). Four Ab+ cats (cats 6,8,9,16) shed pathogenic Leptospira DNA in their urine, and in two other cats (cats 3, 7), leptospiraemia was observed (Table 3).

Table 3.

Description of species, serogroups, serovars, strains found, number of cats for each strain and description of the relative antibody (Ab) titer, cat code (ID), sex, age (months), region of origin (C: Calabria; S: Sicily), month and season of sampling, and negativity (−) or positivity (+) in urine (u+) or blood (b+) found with PCR.

Species Serogroup Serovar Strain n (%) Ab Titer ID Sex Age Region Month Season u+ b+
L. borgpetersenii Javanica Poi Poi 9 (52.9) 20 7 F 48 S February Winter − +
20 2 F 48 C January Winter − −
20 8 F 8 S April Spring + −
20 9 F 17 C November Autumn + −
20 10 F 12 C January Winter − −
20 11 M 192 S January Winter − −
20 12 M 36 C January Winter − −
20 13 M 48 C January Winter − −
40 14 F 48 S April Spring − −
L. borpetersenii Ballum Arborea Arborea 3 (17.6) 20 16 F 6 C January Winter + −
40 6 M 120 C April Spring + −
80 17 F 120 C January Winter − −
L. borpetersenii Mini Mini Sari 1 (5.9) 80 6 M 120 C April Spring + −
L. borgpetersenii Ballum Ballum Mus 127 1 (5.8) 80 1 F 6 C February Winter − −
L. interrogans Australis Bratislava Jez Bratislava 5 (29.4) 20 2 F 48 C January Winter − −
20 3 M 168 C October Autumn − +
20 4 M 72 C November Autumn − −
40 5 M 9 C July Summer − −
320 6 M 120 C April Spring + −
L. interrogans Australis Lora Lora 1 (5.9) 80 6 M 120 C April Spring + −
L. interrogans Pomona Pomona Pomona 1 (5.9) 20 15 M 120 C April Spring − −

2.3. Leptospira spp. DNA Detection in Blood and Urine

Three percent (4/109) of K3EDTA blood samples and 9% (10/111) of urine samples evaluated by polymerase chain reaction (PCR) were positive, with an overall molecular prevalence of 12% (14/112). No cats were simultaneously positive in blood and urine.

Twenty-five of the 111 cats were positive for at least one test, with an overall prevalence (Ab+/ DNA+) of 22.5%. A positive correlation between antibody positivity and urinary DNA shedding (Spearman’s Rho test, rs = 0.215; p = 0.024) was found.

Based on PCR and antibody data, four different patterns were evidenced, and they are reported in Table 4 together with their significant associations.

Table 4.

Infection patterns obtained by molecular and antibody assays, with the number of cats showing a specific pattern and their significant associations with the investigated variables compared to the Leptospira u and/or b and Ab negative pattern.

Leptospira PCR-u/b Ab n Variable p OR 95% CI
Positive Positive 6 Monocytosis 0.0206 10.14 1.964–47.64
Positive Negative 8 Neutrophilia 0.0027 19.14 3.528–106.2
Albumin decreased 0.0154 11.25 2.213–56.95
Markers of inflammations 0.0303 ∞ 1.167–∞
Negative Positive 11 Anemia 0.0329 5.286 1.441–18.9
Lymphocytosis <0.0001 750 41.35–7904
Eosinopenia 0.0315 7.714 1.614–33.66
Negative Negative 86 - - - -

u/b = PCR performed in urine and blood samples; a positive result is related to at least one tissue, while a negative result concerns both of them; Ab = result of testing for antibody detection; n = number of cats; markers of inflammation = one or several of the following abnormalities: LAI, increased SAA, increased GLOB, decreased ALB; ∞ = 100% of positive cats showed at least one clinicopathological sign of inflammation; - = no significant associations found. Results of Fisher’s exact test are represented by p values, OR (odds ratio) and 95% CI (confidence intervals).

2.4. Risk Factors and Correlation with Clinical and Laboratory Variables

The spring season and Leptospira DNA detection in urine were significantly associated (univariate logistic regression analysis: p = 0.032, OR = 4.327, 95% CI = 1.131–16.549; multivariate logistic regression analysis: p = 0.034, OR = 4.871, 95% CI = 1.127–21.057). Moreover, urinary Leptospira DNA shedding was more frequently found in cats enrolled during the spring season compared to those enrolled during wintertime (Fisher’s exact test; p = 0.0184, OR = 6.808, 95% CI = 1.531–34.15). None of the three cats enrolled in the summer tested positive.

Statistically significant haematological and biochemical changes according to Leptospira spp. DNA and antibody positivity are shown in Table 5. Leptospira spp. antibody positivity was significantly associated (Fisher’s exact test) with monocytosis and positively correlated (Spearman’s Rho test) to monocyte count, anemia and increased ALT values. Leptospira spp. DNA detection was positively correlated to monocyte (uDNA+; DNA+) and neutrophil (bDNA+; DNA+) counts (Spearman’s Rho test) and significantly associated (Fisher’s exact test) with hyperglobulinemia (uDNA+) and neutrophilia (DNA+). Anemia, neutrophilia, monocytosis and hypoalbuminemia were significantly associated (Fisher’s exact test) and positively correlated (Spearman’s Rho test) with Leptospira positivity in at least one test (Ab+/ DNA+). Anemia, neutrophilia and monocytosis were also significantly associated (Fisher’s exact test) and positively correlated (Spearman’s Rho test) with Leptospira Ab+/uDNA+. Eosinopenia was significantly associated (Fisher’s exact test) with Leptospira Ab+/uDNA+ (Table 5). No significant associations were found with the type of anemia and reticulocyte hemoglobin content (RETIC-HGB).

Table 5.

Statistically significant haematological changes associated with Leptospira spp. DNA and antibody positivity.

Leptospira Positivity Anemia Neutrophilia Monocytosis Eosinopenia Hypoalbuminemia Hyperglobulinemia Increased ALT
FE Srho FE Srho FE Srho FE Srho FE Srho FE Srho FE Srho
Ab+
versus
Ab−
NS rs = 0.198
p = 0.037
NS NS p = 0.0001
OR = 24.82
95%CI = 4.973–125.2
rs = 0.283
p = 0.004
NS NS NS NS NS NS NS rs = 0.372
p = 0.047
u+
versus
u−
NS NS NS NS NS rs = 0.203
p = 0.038
NS NS NS NS p = 0.0328
OR = 4.803
95%CI = 1.229–16.55
NS NP NS
b+
versus
b−
NP NS NS rs = 0.200
p = 0.042
NS NS NP NS NS NS NS NS NS NS
DNA+
versus
DNA−
NS NS p = 0.0164
OR = 5.571
95%CI = 1.548–22.4
rs = 0.288
p = 0.003
NS rs = 0.208
p = 0.036
NS NS NS NS NS NS NS NS
Ab+ and/or u+
versus
Ab− and/or u−
p = 0.015
OR = 4.32
95%CI = 1.434–12.23
rs = 0.252
p = 0.008
p = 0.0818
OR = 3.067
95%CI= 0.8726–9.158
rs = 0.218
p = 0.027
p = 0.0076
OR = 5.357
95%CI = 1.664–17.27
rs = 0.292
p = 0.003
p = 0.0487
OR = 4.75
95%CI = 1.249–17.35
NS NS NS NS NS NP NS
Ab+ and/or DNA+
versus
Ab− and/or DNA−
p = 0.0399
OR = 3.792
95%CI = 1.282–10.7
rs = 0.228
p = 0.016
p = 0.0398
OR = 3.773
95%CI = 1.246–10.75
rs = 0.257
p = 0.008
p = 0.013
OR = 4.625
95%CI = 1.471–14.48
rs = 0.265
p = 0.007
NS NS p = 0.0345
OR = 4.471
95%CI = 1.227–15.98
rs = 0.229
p = 0.020
NS NS NP NS

Ab+ (antibody positivity), u+ (molecular positivity in urine), b+ (molecular positivity in blood), DNA+ (molecular positivity in urine and/or blood), Ab+ and/or u+ (antibody and/or molecular positivity in urine), Ab+ and/or DNA+ (antibody and/or molecular positivity in blood and/or urine). FE = Fisher’s Exact test; Srho = Spearman’s rho test; p = p value; OR = odds ratio; CI = confidence interval; rs = Spearman’s rank correlation coefficient; NS = not significant; NP = not performed; ALT = alanine aminotransferase.

3. Discussion

This is the first study that reported the prevalence of Leptospira spp. in a population of cats from Southern Italy (Sicily and Calabria regions), evaluating antibody prevalence and the presence of DNA in blood and urine. Considering the differences existing in the feline population of the Sicily and Calabria regions, the prevalence of Leptospira spp. in the two regions was not compared. Antibodies against Leptospira spp. were detected in 15.3% of the cats, with titers ranging from 20 to 320. The cut-off dilution used in the present study for positivity was 1:20, in accordance with the one used in previous epidemiological studies [8,33], but lower than in most other studies where 1:100 was considered the cut-off dilution [1]. However, in the present study, antibody detection was aimed at investigating the exposure of studied cats to Leptospira spp. at some point in their lives, and the level of positivity of samples was not relevant. Therefore, a dilution of 1:20 was considered appropriate, as reported previously [8,33]. Moreover, there is no consensus on the most appropriate cut-off value in cats, and cats seem to respond to infection with low antibody titers [8,22,26,29,34,35]. The reason for low titers in cats tested in this study could be due to serovars not tested and/or cross-reaction with some others that we tested. Moreover, infected cats might mount a lower antibody response compared to dogs [8,19]. Additionally, cats generally could have a short-term immune response, with a rapid decline in titers [22,35].

The most common serovar detected in the study was Poi (9/17 of antibody positive cats), followed by Bratislava (5/17 of antibody positive cats) and Arborea (3/17 of antibody positive cats), and less frequently, serovars Ballum, Pomona, Lora and Mini were found. Unexpectedly, positivity for serogroups reported to be the most frequently involved in feline leptospirosis in Europe, according to the European consensus statement on leptospirosis, such as Canicola, Grippotyphosa, Sejroe and Icterohaemorrhagiae [1,2], was not detected. Antibodies against the serovars Poi, Arborea, and Mini were never reported before in cats; however, the most frequent seroreactivity found in the present study involved serovars previously described in other hosts in Italy, such as wild boars [59], pigs [60,61], wolves [62], Hystrix cristata [56], horses [52,55], dairy cattle [54] and wild ruminants [51], kennel dogs [42,43,46] and humans [50]. Moreover, Tagliabue et al. [43] reported in various host species, antibody-positivity against serogroups Australis (dogs, wild boars, horses, hares, swine, foxes and rodents), Sejroe (cattle, sheep, goats and buffaloes), Icterohaemorrhagiae (dogs, goats and foxes), Pomona (swine, cattle and wild species) and Grippotyphosa (hares).

In the present study, 3% of blood samples and 9% of urine samples were PCR positive. Few have studies investigated Leptospira spp. in blood samples, reporting a prevalence ranging from 1.12% to 11.9% [1,7,13,65]. Instead, a few more studies have investigated Leptospira spp. DNA shedding in urine [7,8,14,19,26,27,30,33,65] reporting a prevalence ranging from 0% to 67.8% [1], with the possibility of long-lasting leptospiral DNA shedding (eight months) after the first presentation [27]. According to the European consensus statement on leptospirosis [2], the MAT is the most widely used diagnostic test for acute leptospirosis in dogs; however, it does not provide any information about whether an animal is a carrier. Cats are supposed to respond to infection with a rapid immune response, followed by a rapid decline in titers [22,35] and high titers can reflect either a recent or active infection, or re-infection [19]. In dogs with consistent clinical signs, a positive blood PCR is suggestive of acute leptospirosis, while a positive urine PCR indicates renal shedding, which can occur in both acutely infected animals and chronic renal carriers [2]. In dogs, leptospiraemia can be found for the first 10 days after infection and thereafter, leptospires can be found in urine. However, leptospiraemia is transient and urinary shedding can be intermittent, and therefore, a negative result in these samples does not rule out leptospirosis [2]. In two older experimental studies, cats were infected orally [66] or subcutaneously [67], and leptospires were detected by blood and urine bacterial culture. Leptospiraemia was observed [66] 6–10 days post infection (p.i.) and persisted for 1–7 days. Leptospiruria was documented in both studies after 12–28 days p.i. and persisted for 2–8 weeks [66,67]. However, anti-Leptospira spp. antibodies were detected by MAT shortly after the first week p.i. and for the following 8–12 weeks [66,67]. Leptospiruria was found in both antibody-positive and -negative cats, supporting the hypothesis that urinary shedding can happen both at an early stage and at a later stage of infection, as reported previously [2]. Leptospiraemia was found in both antibody-positive (Table 3: cat 3, cat 7) and -negative cats (n = 2), and this would suggest that seroconversion can occur after the initial infection when leptospiraemia is still ongoing, as reported in experimental studies [66,67]. The positivity of these cats was at the cut-off level, and a longitudinal evaluation could clarify if leptospiraemia can coexist only with a low antibody titer. No cats were simultaneously positive in blood and urine PCRs. Therefore, according to molecular and antibody assays, four potential infection patterns (Table 4) were identified in the present study, but their interpretation is not easy because little information is available from experimental studies and natural follow-up infections [67]. Interpretation of paired MAT titers collected one or two weeks apart is suggested to confirm a recent infection [2], and a single titer interpretation can limit the MAT sensitivity and specificity, and this could be a limitation of the present study. Other limitations of this study were the lack of culture of biological samples (blood, urine and tissues) as definitive proof of infection [2] and the lack of follow-up to avoid false negative results due to intermittent urine shedding.

Few studies have investigated possible risk factors for Leptospira spp. exposure in cats. These were old age [14,26,29], being an older cat > 1 [30] or ≥4 years old [8], being a cat considered a hunter by the owner, the presence of another cat in the household [19,30], living close to dairy cattle herds [9], being a shelter cat, and having access to the outdoors [31,65] were associated with higher Leptospira spp. positivity rates. Moreover, leptospirosis is considered a seasonal disease, and heavy rainfall or flooding were associated with human and animal outbreaks [2]. In a previous study conducted in Quebec, the antibody prevalence among cats was statistically higher between June and August, which are the warmest and most humid months of the year in Quebec [19]. In another study conducted in Iowa, the risk of antibody positivity was significantly higher in spring than in summer or fall [15]. Moreover, in the present study, urinary Leptospira DNA shedding was more frequently found in cats enrolled during spring, but no association with age group, lifestyle, origin or environment, as reported in previous studies, was found. It is not easy to explain the spring rise of urinary DNA shedding we observed. Spring rainfall levels are variable in Southern Italy and various factors influence the dynamics of the murine populations, which play an important role in Leptospira epidemiology.

Cats can be infected with leptospires, but clinical signs seem to be rare, and infection is usually clinically inapparent [3]. However, clinical signs have been reported in some infected cats [3]. Previous studies described cases of feline leptospirosis reporting anorexia, lethargy, dehydration, weight loss, polyuria and polydipsia, vomiting, hematuria, uveitis, lameness, ascites and hepatomegaly [23,34]. In the present study, association between Leptospira spp. exposure and clinical signs was not found, however positive cats presented with various physical abnormalities such as reduced BCS and muscle mass, enlarged lymph nodes, conjunctivitis and keratoconjunctivitis, stomatitis, nasal discharge, vomiting and diarrhea, alopecia, hyperkeratosis, scaling and abscesses. Some CBC abnormalities, such as neutrophilia [23,25] or neutropenia [34], monocytosis [25], lymphocytosis [34] or lymphopenia and thrombocytopenia [23], were reported in previous case reports of leptospirosis in cats. In the present study, significant associations with anemia, neutrophilia, monocytosis and eosinopenia, compatible with an inflammatory condition and stress response, were found. Significant associations were also found between other inflammation markers, such as hypoalbuminemia and hyperglobulinemia, and Leptospira spp. positivity, and a significant association with increased ALT activity in antibody-positive cats was found. The liver is one of the major target organs of leptospires, and in dogs, a mild liver enzyme increase with possible worsening to severe liver failure and signs of hepatic encephalopathy can occur [2]. In cats, liver involvement is rarely reported [27,34], with mild increases in liver enzymes (alkaline phosphatase (ALP), ALT and aspartate aminotransferase (AST). After the end of leptospiraemia, leptospires can persist in sites like the renal tubules with the development of interstitial nephritis [2]. Interstitial nephritis [23,36], azotemia [23,34], low urine specific gravity, proteinuria and ultrasound changes (marked decrease in the definition of the corticomedullary junction, irregular kidney shape) [23] have been reported in cats with Leptospira infection. Some studies also investigated the association between Leptospira spp. and chronic kidney disease (CKD), but the results are still controversial [19,24,27]. In the present study, possible associations between increased sCr or BUN values, the presence of low USG or proteinuria and Leptospira spp. positivity were investigated, but no significant associations were found. However, the lack of a longitudinal evaluation of the Leptospira spp.-positive cats cannot exclude the possibility that chronic renal damage could develop later.

4. Materials and Methods

4.1. Power and Sample Size

Assuming a 3.3% prevalence of leptospiral DNA shedding and 17.9% of anti-Leptospira antibodies in cats (17.9%) [27], a sample size of about 110–115 cats was required (95% CI; 4.5% precision for the prevalence of DNA shedding and 7.0% precision for antibody prevalence).

4.2. Study Sites, Cat Enrollment and Sampling Procedures

Between January 2018 and May 2019, cats were enrolled in southern Italy at two veterinary clinics located in Sicily (Ospedale Veterinario Universitario Didattico, Università degli Studi di Messina, Messina) and Calabria (Clinica Veterinaria Camagna, Reggio Calabria). Signalment, history and physical examination findings were collected, and the data that were recorded are listed in Table 1 and Table 2 and the supplementary Table S1.

Three to five milliliters of blood were taken from each cat: one milliliter was placed into a K3EDTA tube, used within 24 h for a complete blood count (CBC), and the leftovers were stored at −20 °C until DNA extraction. The remaining blood was used to perform blood smears and to obtain serum after clotting in a plain tube and centrifugation. Serum was stored at −20 °C until further use for biochemical and antibody testing. Urine samples (about five ml) were obtained by cystocentesis or free catch and used for urinalysis within two hours after collection. Within 24 h after collection, urine supernatant was used for the evaluation of the urine protein to creatinine ratio (UPC), and aliquots of urine samples were stored at −20 °C for PCR following the preparation described by Sprißler and others [8]. Briefly, urine was centrifuged at 13,000 rpm for 15 min at room temperature within 24 h after collection. The supernatants were discarded and the pellets were washed with phosphate buffered saline (PBS) and transferred into an Eppendorf tube (Eppendorf, Hamburg, Germany). After a second centrifugation step (13.000 rpm, room temperature, 15 min), the supernatant was discarded, and the pellet was resuspended in 180 µL animal tissue lysis (ATL) buffer (Qiagen, Hilden, Germany) and stored at −20 °C until DNA extraction.

4.3. Clinicopathological Evaluation

The clinicopathological parameters statistically evaluated are listed in the supplementary Table S1. The CBC was performed using a laser haematology analyzer (IDEXX ProCyteDx® Hematology Analyzer, Idexx Laboratories, Westbrook, ME, USA). Blood smears were stained with May-Grünwald-Giemsa stain and examined to assess the morphology of blood cells, platelet estimate, leukocyte differential count and the detection of haemoparasites [68].

The biochemical profile was performed by the Catalyst Dx® Chemistry Analyzer (Idexx Laboratories, Westbrook, ME, USA), liquid chromatography-mass spectrometry for the evaluation of symmetric dimethylarginime (SDMA) (IDEXX Laboratories, Novara, Italia S.r.l) and by a latex agglutination reaction on an automated analyzer AU480 for the evaluation of serum amyloid A (SAA) (Beckman Coulter, Brea, California at the Department of Veterinary Medicine, Cambridge University, UK).

Urinalysis was performed by dipstick analysis (Combur 9 Test strips, Roche Diagnostics, Indianapolis, Indiana, USA), urine specific gravity (USG) was measured by a Vet 360 refractometer (Reichert, Seefeld, Germany) and microscopic evaluation of urine sediment by using the Kova glasstic slides (Kova International, Garden Grove, CA, USA). The UPC was assessed with the Catalyst Dx® Chemistry Analyzer (Idexx Laboratories, Westbrook, ME, USA).

4.4. Microscopic Agglutination Test (MAT)

Anti-Leptospira antibodies (Ab) were evaluated by a microscopic agglutination test (MAT), performed at the World Organization for Animal Health (OIE) and National Collaborating Centre for Reference and Research on Leptospirosis, Amsterdam, the Netherlands. MAT was performed following the technique described by Goris and Hartskeerl [69]. Serial two-fold dilutions of serum were tested from 1:20 to 1:640. A positive value was considered when antibody titers were ≥1:20 [8]. Fourteen serovars (Arborea, Ballum, Bratislava, Canicola, Copenhageni, Grippotyphosa, Icterohaemorragiae, Hardjo, Lora, Mini, Patoc, Poi, Pomona, Tarassovi) belonging to 11 serogroups (Australis, Ballum, Canicola, Grippotyphosa, Icterohaemorrhagiae, Javanica, Mini, Pomona, Sejroe, Semaranga, Tarassovi) were used as antigens. The Leptospira species, serogroups, serovars and strains evaluated are described in Table 6. Reference strains, from the collection of the OIE and National Collaborating Centre for Reference and Research on Leptospirosis, Amsterdam University Medical Center (Amsterdam, The Netherlands) were used.

Table 6.

Leptospira species, serogroups, serovars and strains evaluated.

Species Serogroup Serovar Strain
L. borgpetersenii Ballum Ballum Mus 127
L. interrogans Canicola Canicola Hond Utrecht IV
L. interrogans Australis Bratislava Jez Bratislava
L. kirschneri Grippotyphosa Grippotyphosa Duyster
L. interrogans Icterohaemorragiae Icterohaemorragiae Kantorowic
L. borgpetersenii Javanica Poi Poi
L. interrogans Icterohaemorrhagiae Copenhageni M20
L kirschneri Grippotyphosa Grippotyphosa Moskva V
L. interrogans Pomona Pomona Pomona
L. interrogans Sejroe Hardjo Hardjoprajitno
L. borgpetersenii Tarassovi Tarassovi Perepelitsin
L. interrogans Australis Lora Lora
L.borpetersenii Ballum Arborea Arborea
L.borpetersenii Mini Mini Sari
L.biflexa Semeranga Patoc Patoc I

4.5. DNA Extraction from K3EDTA Blood and Urine Samples

DNA was extracted from 200 µL of K3EDTA blood using the PureLink Genomic DNA kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. At the end of the extraction procedure, DNA was eluted in 100 µL of PureLink genomic elution buffer and stored at −20 °C until used.

DNA was extracted from urine using a Qiagen DNA Micro Extraction kit (Qiagen, Hilden, Germany) according to the tissue manufacturer’s protocol but with the lysis period reduced to 1 h. To elute DNA, 54 µL Qiagen AE buffer was used.

4.6. Polymerase Chain Reaction for Detection of Leptospira DNA

DNA extracted from K3EDTA blood and urine samples was tested with PCR described by Ahmed and others [70]. Primers and probe sequences targeting lipL32 gene-specific for pathogenic Leptospira (LipgrF2, LipgrR2, and LipgrP1) and the internal set primers, probe, and synthetic internal control template sequences (IntoF2, IntoR2, IntoP1, and PlasintS1) are listed in Table 7. Between 100–500 copies per reaction of genomic DNA extracted from Leptospira interrogans strain Kantorowic was used as a positive control. The PCR was performed, including the internal control template to monitor the reaction performance and double-distilled DNase/RNase-Free water as a negative control. All samples, as well as positive control and negative control, were tested in duplicate. Results were considered positive if Ct values were recorded in at least one duplicate and were ≤40.

Table 7.

List of the sequence of lipL32, internal set primers, probe and synthetic internal control used in the study according to Ahmed and others [70].

Oligo ID Sequence Sequence Source
LipgrF2 5′CGCTGAAATGGGAGTTCGTATGATTTCC3′ lipL32
LipgrR2 5′GGCATTGATTTTTCTTCYGGGGTWGCC3′ lipL32
LipgrP1 5′FAM GGCGAAATCGGKGARCCAGGCGAYGG3′BHQ1 lipL32
IntoF2 5′TAGAATCATTGAATCTATCACATCTCATG3′ Internal Control
IntoR2 5′TTGAACTAAATGTAGACTAAAGATGATCG’3 Internal Control
IntoP1 5′TxRd TTCACATTAACATTCAATAATCAATCATGAA3′BHQ2 Internal Control
PlasintS1 5′CTATAGAATCATTGAATCTATCACATCTCATGT ACTTCACATTAACATTCAATAATCAATCATGAATTAATTCAAT TTCTGATATGAATCGATCATCTTTAGTCTACATTTAGTTCAATATATC3′ Internal Control artificial template

4.7. Statistical Analysis

Descriptive statistic was performed for all the evaluated numerical variables. Chi-squared test or Fisher’s exact test were used to evaluate the relationship between anti-Leptospira Ab positivity (Ab+), Leptospira DNA in urine (uDNA+), blood (bDNA+), urine and/or blood (DNA+), Ab positivity and/or DNA in urine (Ab+/uDNA+), Ab positivity and/or DNA in urine and/or blood (Ab+/DNA+) and variables found in all statistical units, in accordance with some of the aforementioned categories, are described in Table 1 and Table 2 and the Supplementary Table S1. Fisher’s exact test was used to evaluate the relationship between the four infection patterns (u+ and/or b+ and Ab−, u+ and/or b+ and Ab+, u− and/or b− and Ab+, u− and/or b− and Ab−) obtained with molecular (Leptospira PCR u/b−DNA+) and antibody (Ab+) tests related to Leptospira and the investigated variables are reported in Table 1 and Table 2 and the supplementary Table S1. Fisher’s exact test was also used to evaluate the relationship between the various types of antibody or molecular positivity described above and the type of anemia (regenerative/non regenerative; mild/moderate/severe; micro/normo/macrocytic; hypo/normochromic) and reticulocyte hemoglobin (RETIC-HGB) (low/normal). This statistical analysis was performed using GraphPad Prism Software.

Spearman’s Rho test was used to measure the strength of correlation between Leptospira Ab+, uDNA+, bDNA+, DNA+, Ab+/uDNA+, Ab+/ DNA+ and variables related to clinical findings, CBC and biochemical profile parameters described in Table 1 and Table 2 and the Supplementary Table S1. Spearman’s Rho test was used to measure the strength of correlation between the four infection patterns obtained with molecular and antibody investigations related to Leptospira and the investigated variables reported in Table 1 and Table 2 and the supplementary Table S1. Univariate and multivariate logistic regression analysis models were developed to identify predictive factors for uDNA+, bDNA+, Ab+ of categorical variables sex (males/females), age (junior: 6–24 months; adult: 25–96 months; senior: >96 months), lifestyle (indoor/outdoor/indoor-outdoor), origin (foundling/not foundling), environment (urban/suburban/rural), cohabitation with dogs (yes/no) and enrollment season (spring/ summer, autumn, winter). This statistical analysis was performed using SPSS 22.0 for Windows. p-values lower than 0.05 were considered statistically significant.

5. Conclusions

In the present study, cats were frequently infected by or exposed to Leptospira spp. in southern Italy, and feline infection seems to be caused by the same serovars found in other animal species in Italy. The spring season was the only detected risk factor for urinary DNA shedding. This means that cats can have a role in the epidemiology of leptospirosis, as an additional reservoir or just as sentinels for a risk of infection. Moreover, changes in CBC, ALT and some markers of inflammation found in Leptospira spp.-positive cats are potentially compatible with a pathogenic effect.

Acknowledgments

Clinica Veterinaria Camagna for valuable clinical support and free use of equipment. Angela Burrascano (University of Messina) for technical collaboration.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/pathogens11101129/s1, Table S1: Data from complete blood count, and biochemical profile of enrolled cats (n (%)) and cats positive for Leptospira spp. according to antibody positivity (Ab+) and PCR positivity from urine (uDNA+) and blood (bDNA+).

Author Contributions

Conceptualization, G.D., M.G.P., M.M., K.H. and M.G.A.G.; methodology, G.D., M.G.P., M.M., K.H., J.A., M.G.A.G., and A.A.A.; software, G.D., M.M. and A.A.; validation, G.D., M.G.P., M.M., K.H., M.G.A.G. and A.A.A.; formal analysis, G.D., M.G.P., M.M., K.H. and M.G.A.G.; investigation, G.D. and M.G.P.; resources, M.G.P. and K.H.; data curation, G.D., M.G.P., M.M. and A.A.; writing—original draft preparation, G.D.; writing—review and editing, G.D., M.G.P., M.M., K.H., J.A., M.G.A.G. and A.A.; supervision, M.G.P., K.H. and M.G.A.G.; project administration, M.G.P. and K.H. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics and Welfare Committee of the Department of Veterinary Medicine, University of Messina (UniME) (018_2017 approved on 20 November 2017).

Informed Consent Statement

Informed consent was obtained from owners of all subjects involved in the study.

Data Availability Statement

The data set analyzed for the current study is available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research received no external funding.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Murillo A., Goris M., Ahmed A., Cuenca R., Pastor J. Leptospirosis in cats: Current literature review to guide diagnosis and management. J. Feline Med. Surg. 2020;22:216–228. doi: 10.1177/1098612X20903601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Schuller S., Francey T., Hartmann K., Hugonnard M., Kohn B., Nally J.E., Sykes J. European consensus statement on leptospirosis in dogs and cats. J. Small Anim. Pract. 2015;56:159–179. doi: 10.1111/jsap.12328. [DOI] [PubMed] [Google Scholar]
  • 3.Hartmann K., Egberink H., Pennisi M.G., Lloret A., Addie D., Belák S., Boucraut-Baralon C., Frymus T., Gruffydd-Jones T., Hosie M.J., et al. Leptospira species infection in cats: ABCD guidelines on prevention and management. J. Feline Med. Surg. 2013;15:576–581. doi: 10.1177/1098612X13489217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Desvars A., Naze F., Benneveau A., Cardinale E., Michault A. Endemicity of leptospirosis in domestic and wild animal species from Reunion Island (Indian Ocean) Epidemiol. Infect. 2012;141:1154–1165. doi: 10.1017/S0950268812002075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zaidi S., Bouam A., Bessas A., Hezil D., Ghaoui H., Ait-Oudhia K., Drancourt M., Bitam I. Urinary shedding of pathogenic Leptospira in stray dogs and cats, Algiers: A prospective study. PLoS ONE. 2018;13:e0197068. doi: 10.1371/journal.pone.0197068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gomard Y., Lagadec E., Humeau L., Pinet P., Bureau S., Da Silva D., Turpin M., Mattoir Y.S., Georger S., Mavingui P., et al. Feral cats do not play a major role in leptospirosis epidemiology on Reunion Island. Epidemiol. Infect. 2019;147:e97. doi: 10.1017/S0950268819000190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Alashraf A.R., Lau S.F., Khor K.H., Khairani-Bejo S., Bahaman A.R., Roslan M.A., Rahman M.S.A., Goh S.H., Radzi R. Serological Detection of Anti-Leptospira Antibodies in Shelter Cats in Malaysia. Top. Companion Anim. Med. 2019;34:10–13. doi: 10.1053/j.tcam.2018.12.002. [DOI] [PubMed] [Google Scholar]
  • 8.Sprißler F., Jongwattanapisan P., Luengyosluechakul S., Pusoonthornthum R., Prapasarakul N., Kurilung A., Goris M., Ahmed A., Reese S., Bergmann M., et al. Leptospira infection and shedding in cats in Thailand. Transbound. Emerg. Dis. 2019;66:948–956. doi: 10.1111/tbed.13110. [DOI] [PubMed] [Google Scholar]
  • 9.Garoussi M.T., Mehravaran M., Abdollahpour G., Khoshnegah J. Seroprevalence of leptospiral infection in feline population in urban and dairy cattle herds in Mashhad, Iran. Vet. Res. Forum. 2015;6:301–304. [PMC free article] [PubMed] [Google Scholar]
  • 10.Chan K.W., Hsu Y.H., Hu W.L., Pan M.J., Lai J.M., Huang K.C., Chou S.J. Serological and PCR detection of feline leptospira in southern Taiwan. Vector Borne Zoonotic Dis. 2014;14:118–123. doi: 10.1089/vbz.2013.1324. [DOI] [PubMed] [Google Scholar]
  • 11.Mosallanejad B., Ghorbanpoor Najafabadi M., Avizeh R., Abdollahpour G., Kousar A. Serological survey of leptospiral infection of cats in Ahvaz, south-western of Iran. Int. J. Vet. Res. 2011;5:49–52. [Google Scholar]
  • 12.Khalili M., Sakhaee E., Amiri F.B., Safat A.A., Afshar D., Esmaeili S. Serological evidence of leptospirosis in Iran; A systematic review and meta-analysis. Microb. Pathog. 2019;138:103833. doi: 10.1016/j.micpath.2019.103833. [DOI] [PubMed] [Google Scholar]
  • 13.Ngasaman R., Saechan V., Prachantasena S., Yingkajorn M., Sretrirutchai S. Investigation of Leptospira Infection in Stray Animals in Songkhla, Thailand: Leptospirosis Risk Reduction in Human. Vector Borne Zoonotic Dis. 2020;20:432–435. doi: 10.1089/vbz.2019.2549. [DOI] [PubMed] [Google Scholar]
  • 14.Kakita T., Kuba Y., Kyan H., Okano S., Morita M., Koizumi N. Molecular and serological epidemiology of Leptospira in-fection in cats in Okinawa Island, Japan. Sci. Rep. 2021;11:10365. doi: 10.1038/s41598-021-89872-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Palerme J.-S., Lamperelli E., Gagne J., Cazlan C., Zhang M., Olds J.E. Seroprevalence of Leptospira spp., Toxoplasma gondii, and Dirofilaria immitis in Free-Roaming Cats in Iowa. Vector Borne Zoonotic Dis. 2019;19:193–198. doi: 10.1089/vbz.2017.2255. [DOI] [PubMed] [Google Scholar]
  • 16.Pratt N., Conan A., Rajeev S. Leptospira Seroprevalence in Domestic Dogs and Cats on the Caribbean Island of Saint Kitts. Vet. Med. Int. 2017;2017:5904757. doi: 10.1155/2017/5904757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dos Santos L.F., Guimarães M.F., de Souza G.O., da Silva I.W.G., Santos J.R., Azevedo S.S., Labruna M.B., Heinemann M.B., Horta M.C. Seroepidemiological survey on Leptospira spp. infection in wild and domestic mammals in two distinct areas of the semi-arid region of northeastern Brazil. Trop. Anim. Health Prod. 2017;49:1715–1722. doi: 10.1007/s11250-017-1382-9. [DOI] [PubMed] [Google Scholar]
  • 18.Ortega-Pacheco A., Guzmán-Marín E., Acosta-Viana K.Y., Vado-Solís I., Jiménez-Delgadillo B., Cárdenas-Marrufo M., Pérez-Osorio C., Puerto-Solís M., Jiménez-Coello M. Serological survey of Leptospira interrogans, Toxoplasma gondii and Trypanosoma cruzi in free roaming domestic dogs and cats from a marginated rural area of Yucatan Mexico. Vet. Med. Sci. 2017;3:40–47. doi: 10.1002/vms3.55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Rodriguez J., Blais M.-C., Lapointe C., Arsenault J., Carioto L., Harel J. Serologic and Urinary PCR Survey of Leptospirosis in Healthy Cats and in Cats with Kidney Disease. J. Vet. Intern. Med. 2014;28:284–293. doi: 10.1111/jvim.12287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Azócar-Aedo L., Monti G., Jara R. Leptospira spp. in Domestic Cats from Different Environments: Prevalence of Antibodies and Risk Factors Associated with the Seropositivity. Animals. 2014;4:612–626. doi: 10.3390/ani4040612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lapointe C., Plamondon I., Dunn M. Feline leptospirosis serosurvey from a Quebec referral hospital. Can. Vet. J. 2013;54:497–499. [PMC free article] [PubMed] [Google Scholar]
  • 22.Markovich J., Ross L., McCobb E. The Prevalence of Leptospiral Antibodies in Free Roaming Cats in Worcester County, Massachusetts. J. Vet. Intern. Med. 2012;26:688–689. doi: 10.1111/j.1939-1676.2012.00900.x. [DOI] [PubMed] [Google Scholar]
  • 23.Arbour J., Blais M.-C., Carioto L., Sylvestre D. Clinical Leptospirosis in Three Cats (2001–2009) J. Am. Anim. Hosp. Assoc. 2012;48:256–260. doi: 10.5326/JAAHA-MS-5748. [DOI] [PubMed] [Google Scholar]
  • 24.Shropshire S.B., Veir J.K., Morris A.K., Lappin M.R. Evaluation of the Leptospira species microscopic agglutination test in experimentally vaccinated cats and Leptospira species seropositivity in aged azotemic client-owned cats. J. Feline Med. Surg. 2016;18:768–772. doi: 10.1177/1098612X15593902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ojeda J., Salgado M., Encina C., Santamaria C., Monti G. Evidence of interspecies transmission of pathogenic Leptospira between livestock and a domestic cat dwelling in a dairy cattle farm. J. Vet. Med. Sci. 2018;80:1305–1308. doi: 10.1292/jvms.16-0361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bourassi E., Savidge C., Foley P., Hartwig S. Serologic and urinary survey of exposure to Leptospira species in a feral cat population of Prince Edward Island, Canada. J. Feline Med. Surg. 2021;23:1155–1161. doi: 10.1177/1098612X211001042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Weis S., Rettinger A., Bergmann M., Llewellyn J.R., Pantchev N., Straubinger R., Hartmann K. Detection of Leptospira DNA in urine and presence of specific antibodies in outdoor cats in Germany. J. Feline Med. Surg. 2016;19:470–476. doi: 10.1177/1098612X16634389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Obrenovic S., Radojicic S., Stevic N., Bogunovic D., Vakanjac S., Valcic M. Seroprevalence of cat leptospirosis in Belgrade (Serbia) Acta Vet.-Beogr. 2014;64:510–518. [Google Scholar]
  • 29.Mylonakis M.E., Bourtzi-Hatzopoulou E., Koutinas A.F., Petridou E., Saridomichelakis M.N., Leontides L., Siochu A. Leptospiral seroepidemiology in a feline hospital population in Greece. Vet. Rec. 2005;156:615–616. doi: 10.1136/vr.156.19.615. [DOI] [PubMed] [Google Scholar]
  • 30.Dorsch R., Ojeda J., Salgado M., Monti G., Collado B., Tomckowiack C., Tejeda C., Müller A., Eberhard T., Klaasen H.L.B.M., et al. Cats shedding pathogenic Leptospira spp.-An underestimated zoonotic risk? PLoS ONE. 2020;15:e0239991. doi: 10.1371/journal.pone.0239991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lehtla A., Must K., Lassen B., Orro T., Jokelainen P., Viltrop A. Leptospira spp. in Cats in Estonia: Seroprevalence and Risk Factors for Seropositivity. Vector Borne Zoonotic Dis. 2020;20:524–528. doi: 10.1089/vbz.2019.2555. [DOI] [PubMed] [Google Scholar]
  • 32.Kovská A., Schánilec P., Treml F., Dušková M., Agudelo R.C.F. Seroprevalence of Antibodies against Borrelia burgdorferi s. l. and Leptospira interrogans s. l. in Cats in district of Brno and its environs, the Czech Republic. Ann. Agric. Env. Med. 2020;27:356–360. doi: 10.26444/aaem/122804. [DOI] [PubMed] [Google Scholar]
  • 33.Murillo A., Cuenca R., Serrano E., Marga G., Ahmed A., Cervantes S., Caparrós C., Vieitez V., Ladina A., Pastor J. Leptospira Detection in Cats in Spain by Serology and Molecular Techniques. Int. J. Environ. Res. Public Health. 2020;17:1600. doi: 10.3390/ijerph17051600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Agunloye C.A., Nash A.S. Investigation of possible leptospiral infection in cats in Scotland. J. Small Anim. Pract. 1996;37:126–129. doi: 10.1111/j.1748-5827.1996.tb02360.x. [DOI] [PubMed] [Google Scholar]
  • 35.Shophet R. A serological survey of leptospirosis in cats. N. Z. Vet. J. 1979;27:236–246. doi: 10.1080/00480169.1979.34662. [DOI] [PubMed] [Google Scholar]
  • 36.Harkness A., Smith B., Fowler G. An isolation of Leptospira serotype Pomona from a domestic cat. N. Z. Vet. J. 1970;18:175–176. doi: 10.1080/00480169.1970.33893. [DOI] [PubMed] [Google Scholar]
  • 37.Dybing N.A., Jacobson C., Irwin P., Algar D., Adams P.J. Leptospira Species in Feral Cats and Black Rats from Western Australia and Christmas Island. Vector Borne Zoonotic Dis. 2017;17:319–324. doi: 10.1089/vbz.2016.1992. [DOI] [PubMed] [Google Scholar]
  • 38.Stefanetti V., Compagnone A., Sordini C., Passamonti F., Rampacci E., Moscati L., Marenzoni M.L. Retrospective Bio-molecular Investigation of Coxiella burnetii and Leptospira spp. DNA in Cases of Abortion, Stillbirth and Neonatal Mortality in Dogs and Cats. Top. Companion Anim. Med. 2018;33:122–125. doi: 10.1053/j.tcam.2018.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Bhat A.H. Bacterial zoonoses transmitted by household pets and as reservoirs of antimicrobial resistant bacteria. Microb. Pathog. 2021;155:104891. doi: 10.1016/j.micpath.2021.104891. [DOI] [PubMed] [Google Scholar]
  • 40.Balboni A., Mazzotta E., Boniotti M.B., Bertasio C., Bellinati L., Lucchese L., Battilani M., Ceglie L., Marchione S., Esposito G., et al. Outbreak of Leptospira borgpetersenii Serogroup Sejroe Infection in Kennel: The Role of Dogs as Sentinel in Specific Environments. Int. J. Environ. Res. Public Health. 2022;19:3906. doi: 10.3390/ijerph19073906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Piredda I., Bertoldi L., Benvenuto G., Palmas B., Pedditzi A., Pintore P., Chisu V. First Isolation and Molecular Typing of Pathogenic and Intermediate Leptospira Species from Urine of Symptomatic Dogs. Vet. Sci. 2021;8:304. doi: 10.3390/vetsci8120304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Furlanello T., Reale I. Leptospirosis and immune-mediated hemolytic anemia: A lethal association. Vet. Res. Forum. 2019;10:261–265. doi: 10.30466/VRF.2019.99876.2385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tagliabue S., Figarolli B.M., D’Incau M., Foschi G., Gennero M.S., Giordani R., Giordani R., Natale A., Papa P., Ponti N., et al. Serological surveillance of Leptospirosis in Italy: Two-year national data (2010–2011) Vet. Ital. 2016;52:129–138. doi: 10.12834/VetIt.58.169.2. [DOI] [PubMed] [Google Scholar]
  • 44.Balboni A., Zamagni S., Bertasio C., Boniotti M.B., Troìa R., Battilani M., Dondi F. Identification of Serogroups Australis and Icterohaemorrhagiae in Two Dogs with a Severe Form of Acute Leptospirosis in Italy. Pathogens. 2020;9:351. doi: 10.3390/pathogens9050351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Furlanello T., Reale I. First description of reactive arthritis secondary to leptospirosis in a dog. Iran. J. Vet. Res. 2020;21:146–149. [PMC free article] [PubMed] [Google Scholar]
  • 46.Piredda I., Ponti M.N., Piras A., Palmas B., Pintore P., Pedditzi A., Chisu V. New Insights on Leptospira Infections in a Canine Population from North Sardinia, Italy: A Sero-Epidemiological Study. Biology. 2021;10:507. doi: 10.3390/biology10060507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Vitale M., Agnello S., Chetta M., Amato B., Vitale G., Bella C.D., Vicari D., Presti V.D.M.L. Human leptospirosis cases in Palermo Italy. The role of rodents and climate. J. Infect. Public Health. 2018;11:209–214. doi: 10.1016/j.jiph.2017.07.024. [DOI] [PubMed] [Google Scholar]
  • 48.Bertelloni F., Cilia G., Turchi B., Pinzauti P., Cerri D., Fratini F. Epidemiology of leptospirosis in North-Central Italy: Fifteen years of serological data (2002–2016) Comp. Immunol. Microbiol. Infect. Dis. 2019;65:14–22. doi: 10.1016/j.cimid.2019.04.001. [DOI] [PubMed] [Google Scholar]
  • 49.Lagi F., Corti G., Meli M., Pinto A., Bartoloni A. Leptospirosis Acquired by Tourists in Venice, Italy. J. Travel Med. 2013;20:128–130. doi: 10.1111/j.1708-8305.2012.00669.x. [DOI] [PubMed] [Google Scholar]
  • 50.Magi G., Mingoia M., Morroni G., Fioriti S., Coccitto S.N., Di Sante L., Giovanetti E., Brenciani A. Human leptospirosis in the Marche region: Over 10 years of surveillance. Microbiol. Immunol. 2020;65:85–88. doi: 10.1111/1348-0421.12853. [DOI] [PubMed] [Google Scholar]
  • 51.Andreoli E., Radaelli E., Bertoletti I., Bianchi A., Scanziani E., Tagliabue S., Mattiello S. Leptospira spp. infection in wild ruminants: A survey in Central Italian Alps. Vet. Ital. 2014;50:285–291. doi: 10.12834/VETIT.1309.06. [DOI] [PubMed] [Google Scholar]
  • 52.Ebani V.V., Bertelloni F., Pinzauti P., Cerri D. Seroprevalence of Leptospira spp. and Borrelia burgdorferi sensu lato in Italian horses. Ann. Agric. Environ. Med. 2012;19:237–240. [PubMed] [Google Scholar]
  • 53.Grippi F., Giudice E., Di Pietro S., Sciacca C., Santangelo F., Galluzzo P., Barreca S., Guercio A. Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: Two herd cases in Sicily (Italy) J. Vet. Res. 2020;64:73–78. doi: 10.2478/jvetres-2020-0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Aliberti A., Blanda V., Presti V.D.M.L., Macaluso G., Galluzzo P., Bertasio C., Sciacca C., Arcuri F., D’Agostino R., Ippolito D., et al. Leptospira interrogans Serogroup Pomona in a Dairy Cattle Farm in a Multi-Host Zootechnical System. Vet. Sci. 2022;9:83. doi: 10.3390/vetsci9020083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Vera E., Taddei S., Cavirani S., Schiavi J., Angelone M., Cabassi C.S., Schiano E., Quintavalla F. Leptospira Seroprevalence in Bardigiano Horses in Northern Italy. Animals. 2020;10:23. doi: 10.3390/ani10010023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Coppola F., Cilia G., Bertelloni F., Casini L., D’Addio E., Fratini F., Cerri D., Felicioli A. Crested Porcupine (Hystrix cristata L.): A New Potential Host for Pathogenic Leptospira Among Semi-Fossorial Mammals. Comp. Immunol. Microbiol. Infect. Dis. 2020;70:101472. doi: 10.1016/j.cimid.2020.101472. [DOI] [PubMed] [Google Scholar]
  • 57.Cilia G., Bertelloni F., Piredda I., Ponti M.N., Turchi B., Cantile C., Parisi F., Pinzauti P., Armani A., Palmas B., et al. Presence of pathogenic Leptospira spp. in the reproductive system and fetuses of wild boars (Sus scrofa) in Italy. PLOS Negl. Trop. Dis. 2020;14:e0008982. doi: 10.1371/journal.pntd.0008982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Cilia G., Bertelloni F., Angelini M., Cerri D., Fratini F. Leptospira Survey in Wild Boar (Sus scrofa) Hunted in Tuscany, Central Italy. Pathogens. 2020;9:377. doi: 10.3390/pathogens9050377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Cilia G., Bertelloni F., Cerri D., Fratini F. Leptospira fainei Detected in Testicles and Epididymis of Wild Boar (Sus scrofa) Biology. 2021;10:193. doi: 10.3390/biology10030193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Bertasio C., Papetti A., Scaltriti E., Tagliabue S., D’Incau M., Boniotti M.B. Serological Survey and Molecular Typing Reveal New Leptospira Serogroup Pomona Strains among Pigs of Northern Italy. Pathogens. 2020;9:332. doi: 10.3390/pathogens9050332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Macaluso G., Torina A., Blanda V., Guercio A., Lastra A., Giacchino I., D’Agostino R., Sciacca C., D’Incau M., Bertasio C., et al. Leptospira in Slaughtered Fattening Pigs in Southern Italy: Serological Survey and Molecular Typing. Animals. 2022;12:585. doi: 10.3390/ani12050585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bregoli M., Pesaro S., Ustulin M., Vio D., Beraldo P., Galeotti M., Cocchi M., Lucchese L., Bertasio C., Boniotti M.B., et al. Environmental Exposure of Wild Carnivores to Zoonotic Pathogens: Leptospira Infection in the First Free Living Wolf (Canis lupus Linnaeus, 1758) Found Dead in the Friuli Venezia Giulia Region. Int. J. Environ. Res. Public Health. 2021;18:2512. doi: 10.3390/ijerph18052512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Courcier E.A., O’Higgins R., Mellor D.J., Yam P.S. Prevalence and risk factors for feline obesity in a first opinion practice in Glasgow, Scotland. J. Feline Med. Surg. 2010;12:746–753. doi: 10.1016/j.jfms.2010.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.World Small Animal Veterinary Association Muscle Condition Score. [(accessed on 22 August 2022)]. Available online: https://wsava.org/wp-content/uploads/2020/01/Muscle-Condition-Score-Chart-for-Cats.pdf.
  • 65.Holzapfel M., Taraveau F., Djelouadji Z. Serological and molecular detection of pathogenic Leptospira in domestic and stray cats on Reunion Island, French Indies. Epidemiol. Infect. 2021;149:e299. doi: 10.1017/S095026882100176X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Shophet R., Marshall R. An Experimentally Induced Predator Chain Transmission of Leptospira Ballum from Mice to Cats. Br. Vet. J. 1980;136:265–270. doi: 10.1016/S0007-1935(17)32291-1. [DOI] [PubMed] [Google Scholar]
  • 67.Larsson C.E., Santa Rosa C.A., Larsson M.H., Birgel E.H., Fernandes W.R., Paim G.V. Laboratory and clinical features of experimental feline leptospirosis. Int. J. Zoonoses. 1985;12:111–119. [PubMed] [Google Scholar]
  • 68.Piaton E., Fabre M., Goubin-Versini I., Bretz-Grenier M.F., Courtade-Saïdi M., Vincent S., Belleannée G., Thivolet F., Boutonnat J., Debaque H., et al. Guidelines for May-Grünwald-Giemsa staining in haematology and non-gynaecological cy-topathology: Recommendations of the French Society of Clinical Cytology (SFCC) and of the French Association for Quality Assurance in Anatomic and Cytologic Pathology (AFAQAP) Cytopathology. 2016;27:359–368. doi: 10.1111/cyt.12323. [DOI] [PubMed] [Google Scholar]
  • 69.Goris M.G., Hartskeerl R.A. Leptospirosis Serodiagnosis by the Microscopic Agglutination Test. Curr. Protoc. Microbiol. 2014;32:12E.5.1–12E.5.18. doi: 10.1002/9780471729259.mc12e05s32. [DOI] [PubMed] [Google Scholar]
  • 70.Ahmed A.A., Goris M.G.A., Meijer M.C. Development of lipL32 real-time PCR combined with an internal and extraction control for pathogenic Leptospira detection. PLoS ONE. 2020;15:e0241584. doi: 10.1371/journal.pone.0241584. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The data set analyzed for the current study is available from the corresponding author upon reasonable request.


Articles from Pathogens are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES