Abstract
The immune receptor TREM1 (Triggering receptor expressed on myeloid cells 1) is a master regulator of inflammatory response. Compelling evidence suggests important pathological roles for TREM1 in various types of solid tumors. However, the role of TREM1 in hematologic malignancies is not known. Our previous study demonstrated that TREM1 cooperates with diminished DNA damage response to induce expansion of pre-leukemic hematopoietic stem cells (HSC) in mice deficient for the Fanconi anemia gene Fanca. Here we investigated TREM1 in leukemogenesis using mouse models of the DNA repair-deficient Fanca-/- and the oncogenic MLL-AF9 or KrasG12D. We found that Trem1 was highly expressed in preleukemic HSC and leukemia stem cells (LSC). By selective deletion of the Trem1 gene in the hematopoietic compartment, we showed that ablation of Trem1 reduced leukemogenic activity of the pre-leukemic HSC and LSC in mice. Trem1 was required for the proliferation of the pre-leukemic HSC and LSC. Further analysis revealed that Trem1 expression in preleukemic HSC and LSC was associated with persistent DNA damage, prolonged oncogenic stress, and a strong inflammatory signature. Targeting several top Trem1 inflammatory signatures inhibited the proliferation of pre-leukemic HSC and LSC. Collectively, our observations uncover previously unknown expression and function of TREM1 in malignant stem cells, and identify TREM1 as a driver of leukemogenesis.
Introduction
Triggering receptor expressed on myeloid cells 1 (TREM1, also known as CD354) is a member of the super immunoglobulin family initially found expressed on a select group of myeloid cells.1,2 Compelling evidence suggests important pathological roles for TREM1 not only in acute infection-induced reactions but also in chronic inflammatory disorders including various types of cancers.2 In fact, TREM1 is found overexpressed in a variety of cancers,3 including colorectal cancer,4 hepatocellular carcinoma,5 lung cancer,6 and prostate tumors.7 Recent studies showed that TREM1 expression in patients with non-small cell lung cancer is associated with cancer recurrence and poor survival, suggesting that TREM1 may play an important role in cancer progression.6 Furthermore, pharmacological inhibition of TREM1 attenuates tumor growth and prolongs survival in experimental pancreatic cancer8 and lung cancer.9 Analysis of transcriptome data of 33 cancers from The Cancer Genome Atlas using UALCAN (http://ualcan.path.uab.edu/)10 showed that TREM1 is upregulated in at least 14 types of cancers, especially kidney renal clear cell carcinoma, cervical squamous cell carcinoma and glioblastoma, and that TREM1 expression is closely correlated with poor prognosis in kidney renal clear cell carcinoma and cervical squamous cell carcinoma. Overexpression of TREM1 is also found in hematologic malignancies, and it was shown that a high level of TREM1 expression was correlated with poor prognosis in five subsets of acute myeloid leukemia (AML) cells (BloodSpot). However, the underlying mechanisms of action of TREM1 in cancer development are poorly understood.
DNA damage response/repair (DDR) is a complex signal transduction network that is required for the preservation of the integrity of the genome and for ensuring its accurate transmission through generations. To counteract DNA damage, DDR machinery orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. Unrepaired damage results in cellular senescence or apoptosis while erroneously repaired DNA lesions can lead to mutations.11 Dysregulation of the DDR and repair systems can cause human disorders, which are associated with susceptibility to cancer, accelerated aging, and developmental abnormalities.12 Given the enormous regenerative potential coupled with lifetime persistence of hematopoietic stem cells (HSC) in the body, tight control of HSC genome stability is demanded. In fact, the DDR has been considered as an evolutionary trade-off between blood regeneration and leukemia suppression.13 Indeed, failure to accurately repair DNA damage in HSC is associated with bone marrow (BM) failure and leukemogenesis.13 Using a mouse model deficient for the major Fanconi anemia (FA) gene Fanca, our recent studies demonstrated a temporal correlation of diminished DDR with elevated immune response in Fanca-/- pre-leukemic HSC and argued for the effectiveness of DDR as the cellular machinery preventing the transition of the initiating pre-leukemic HSC population into a leukemia stem cell (LSC) population with transformed properties.14
It is known that oncogene-driven proliferation must be associated with inhibition of apoptosis and senescence to allow malignant outgrowth.15,16 In response to oncogenic activation, normal cells induce genetically encoded programs, mainly growth arrest, apoptosis and senescence, which prevent deregulated proliferation and thus protect multicellular organisms from cancer progression.17,18 Mixed lineage leukemia (MLL) is an H2Kme3-depositing protein active during early development.19 MLL-rearrangements are present in about 10% of acute leukemias. Among these, the translocation t(9;11)(p22;q23) is mainly associated with AML and fuses AF9 to MLL (MLL-AF9).20 Oncogenic Ras mutations (mutations of NRAS and KRAS genes) also occur in various leukemias,21 including AML,22 chronic myelomonocytic leukemia23 and juvenile myelomonocytic leukemia.24 However, the underlying mechanisms by which these oncogenes promote malignant transformation in leukemia remains controversial.
In this study, we investigated the role of TREM1 in leukemogenesis and show that persistent DNA damage and prolonged oncogenic stress induces the expression of Trem1 in pre-leukemic HSC and LSC. This aberrant Trem1 expression promotes leukemic development and is associated with enhanced proliferation and inflammatory response.
Methods
Mice and treatment
Trem1 conditional knockout mice (Trem1-floxed) were generated by the Transgenic core facility at Cincinnati Children’s Hospital Medical Center using CRISPR-Cas9 technology. Mutant mice were produced on a C57BL/6J background. To generate Trem1flox/+ mice, guide RNA (gRNA) targeting exon 2 of the mouse Trem1 locus (5’ gRNA [GTGGAGGTTGAAGGTCCTCA] and 3’ gRNA [AGAGGTGGGAAGGGCCAAA]), along with Cas9 were injected into single-cell embryos to create the conditional knockout allele. To genotype the Trem1flox/+ mouse line, forward primer, 5’- ATCTTTGGCAGGGACAAGATAGTC-3’ and reverse primer, 5’- AGGGGAATCGACGCACAGGAAC-3’ were used to detect the Exon2 wild-type allele (156 bp) or Exon2 floxed allele (173 bp). Gender- and age-matched littermates were selected and used for the following experiments.
Fanca+/- mice were provided by Dr. Madeleine Carreau (Laval University).25 MLL-AF9 transgenic mice20 were obtained from Jackson Laboratory (Stock #: 009079) and interbred with Trem1fl/flVav1Cre mice. LSL-KrasG12D mice (Jackson Laboratory, Stock #: 008179)26 were crossed with a tamoxifen-inducible deleter strain (CreER; Jackson Laboratory, Stock #: 008463)27 to generate LSL-KrasG12D;CreER offspring. For Cre-mediated gene deletion, animals were injected intraperitoneally with 100 μL of tamoxifen (20 mg/mL; 80 mg/kg body weight; Sigma-Aldrich, St. Louis, MO, USa) once every 24 h for a total of 5 consecutive days.28
The DNA damage-induced Fanca-/- pre-leukemia model was established as previously described.14 Briefly, 6- to 8-week-old mice were intraperitoneally injected with 0.3 mg/kg of mitomycin C (MMC; Sigma-Aldrich, St Louis, MO, USA) weekly for 6 weeks. All the animals, including BoyJ (C57BL/6: B6, CD45.1+) recipient mice, were maintained in the animal facility at the Hillman Cancer Center at the University of Pittsburgh. All experimental procedures conducted in this study were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh.
Bone marrow transplantation
One thousand freshly isolated BM LSK cells from Fanca-/-;Trem1fl/flVav1Cre mice and the Fanca-/-;Trem1fl/fl control mice, 3,000 BM c-Kit+ cells from MLL-AF9;Trem1fl/flVav1Cre mice and the MLL-AF9;Trem1fl/fl control mice, or 3,000 green fluorescent protein (GFP)-sorted virus-transduced BM c-Kit+ cells from 2-month-old MLL-AF9 mice (CD45.2+), along with 2X105 protector cells from congenic BoyJ mice (CD45.1+), were transplanted into lethally irradiated (11.75 Gy) BoyJ mice. Recipients were subjected to total body irradiation at the indicated time points. For serial bone marrow transplantation (BMT), 1-3x106 whole BM cells from primary recipients were pooled and injected into sublethally irradiated (7.0 Gy) BoyJ recipients. Donor-derived chimera were detected by flow cytometry at 16 weeks after transplantatiion using antibodies against CD45.1 and CD45.2.
For Trem1+ and Trem1- cell transplantation, 100 sorted Trem1+SLAM (Lin-Sca1+c-kit+CD150+CD48- cells) and Trem1–
SLAM cells from Fanca-/- pre-leukemic mice, along with 2x105 protector cells from congenic BoyJ mice (CD45.1+), were transplanted into lethally irradiated BoyJ recipients. Donor-derived chimera were detected by flow cytometry at 16 weeks after transplantation. For secondary transplants, 1x106 CD45.2+ cells from the primary recipients at 4 months after BMT were transplanted into sublethally irradiated BoyJ recipients. Donor-derived chimerism and myeloid expansion were determined by flow cytometry. Cytological and morphological analyses were conducted using Wright-Giemsa staining. Survival of the recipients was plotted using the Kaplan-Meier curve method.
Statistical analysis
A paired or unpaired Student t-test was used for two-group comparisons, and one-way analysis of variance was used for comparisons of more than two groups. P values less than 0.05 were considered statistically significant. Results are presented as mean ± standard deviation. In the figures, * indicates P<0.05; ** indicates P<0.01 and *** indicates P<0.001.
Results
Trem1 is expressed in pre-leukemic hematopoietic stem cells and leukemic stem cells
We previously showed that the immune receptor TREM1 cooperates with a diminished DDR to induce pre-leukemic HSC expansion using a mouse model deficient for the Fanca gene.14 To further understand the role of Trem1 in leukemogenesis, we employed two leukemic models (Figure 1A) to investigate the underlying mechanisms in vivo: (i) the DNA damage-induced Fanca-/- pre-leukemic model; and (ii) the MLL-AF9 (MA9) transgenic model, in which the expression of the oncogenic MLL-AF9 fusion protein results in development of AML beginning around 5 months of age.20 We first established pre-leukemic and leukemic Fanca-/- mice as previously described,14 and measured the levels of Trem1 expression in the pre-leukemic HSC and LSC by quantitative polymerase chain reaction (qPCR). We found that Trem1 mRNA level was significantly elevated in the SLAM (LSKCD48-CD150+ cells; enriched for HSC; Online Supplementary Figure S1A) cells of the pre-leukemic Fanca-/- mice, as compared to those in wild-type (WT) mice (Figure 1B). This was accompanied by a 40-50% increase in Trem1+SLAM cells in the pre-leukemic mice over the number of such cells in WT controls (Figure 1C). Trem1 expression and the percentage of Trem1+SLAM cells were even higher in the Fanca-/- leukemic mice than in the Fanca-/- pre-leukemic mice (Figure 1D, E). We also observed a progressive increase in Trem1 expression in BM c-Kit+ cells (enriched for MA9 LSC)29 of the MA9 mice over the period of 5 months (Figure 1F). Leukemia was confirmed by accumulation of Mac1+Gr1+ cells in peripheral blood by flow cytometry (Online Supplementary Figure S1B) and Wright-Giemsa staining of peripheral blood (Online Supplementary Figure S1C) from the Fanca-/- and MA9 leukemic mice. Thus, these data indicate that Trem1 is expressed in pre-leukemic HSC and LSC.
Deletion of Trem1 does not alter steady-state hematopoiesis
To further investigate the role of Trem1 in leukemogenesis, we employed CRISPR-Cas9 technology to generate a conditional Trem1 knockout mouse strain (Trem1fl/fl) (Online Supplementary Figure S2A). By using a previously described Vav1Cre deleter strain,30 we were able to selectively ablate Trem1 expression in the hematopoietic compartment at both mRNA and protein levels (Online Supplementary Figure S2B-D).
To determine whether ablation of Trem1 affected normal hematopoiesis, we first analyzed blood counts, BM cellularity, the frequency, and absolute numbers of total hematopoietic stem and progenitor cells (HSPC: LSK [Lin-Sca1+c-Kit+] cells) and HSC (SLAM) in Trem1fl/flVav1Cre mice. We found no significant differences between Trem1fl/flVav1Cre mice and the Trem1fl/fl controls under homeostatic conditions, as evidenced by comparable complete blood counts (Figure 2A), total BM cell counts (Figure 2B) and flow cytometry-based phenotypic analysis of BM LSK and SLAM populations (Figure 2C). These data suggest that Trem1 is not required for the maintenance of normal hematopoiesis.
To determine HSPC proliferation, we sorted LSK cells from Trem1fl/flVav1Cre and the Trem1fl/fl control mice and performed colony-forming-unit-cell (CFU-C) assays. We found that HSPC from Trem1fl/flVav1Cre and Trem1fl/fl control mice produced comparable CFU-C colonies (Figure 2D). Competitive in vivo transplantation assays showed no significant differences in repopulating capacity between Trem1fl/flVav1Cre HSC and the Trem1fl/fl control HSC (Figure 2E). Contributions to myeloid and lymphoid lineages were also similar between Trem1fl/flVav1Cre and Trem1fl/fl HSC (Figure 2F). However, we observed that the repopulating capacity of Trem1fl/flVav1Cre HSC in secondary recipients was significantly higher than that of Trem1fl/fl HSC (Figure 2G). These data suggest that Trem1 deletion does not influence hematopoiesis under homeostatic conditions.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells promotes leukemogenesis
To determine the role of Trem1 in leukemia development in vivo, we established three leukemogenic models (Figure 3A): (i) Fanca-/- leukemia expressing the conditional Trem1fl/fl; (ii) MA9 leukemia expressing the conditional Trem1fl/fl; and (iii) MA9 leukemia expressing the Trem1 protein. We then analyzed LSC expansion and leukemia development in the transplanted recipients in the context of Trem1 expression. We found that deletion of Trem1 significantly reduced LSC-enriched donor SLAM cells in the recipient mice transplanted with LSK cells from Fanca-/-;Trem1fl/flVav1Cre mice compared to those from the Fanca-/-;Trem1fl/fl controls (Figure 3B). Consistently, ablation of Trem1 markedly prolonged the survival of the recipients transplanted with Fanca-/-;Trem1fl/flVav1Cre cells compared to those transplanted with the Fanca-/-;Trem1fl/fl control cells (Figure 3C). Similar results were obtained with the recipients transplanted with donor cells from leukemic MA9 mice at the age of 5 months old (when the mice develop AML),29 in which deletion of Trem1 significantly reduced LSC-enriched CD45.2+c-Kit+ cells in the recipients transplanted with cells from 5-month-old MA9;Trem1fl/flVav1cre mice compared to those in the recipients transplanted with cells from age-matched MA9;Trem1fl/fl mice (Figure 3D). Consequently, ablation of Trem1 greatly extended latency in the recipients of MA9;Trem1fl/flVav1cre cells compared to those of MA9;Trem1fl/fl cells (Figure 3E).
Figure 1.
Trem1 is expressed in pre-leukemic hematopoietic stem cells and leukemic stem cells. (A) Schematic presentation of the experimental design. (B) Aberrant Trem1 expression in Fanca-/- pre-leukemic hematopoietic stem cells (HSC). Wild-type (WT) and Fanca-/- mice were injected intraperitoneally with 0.3 mg/kg of mitomycin C (MMC) weekly for 6 weeks. RNA was extracted from SLAM cells isolated from the indicated mice followed by quantitative polymerase chain reaction (qPCR) analysis using the primers listed in Online Supplementary Table S1 (n=8-10 mice/group). (C) Increased Trem1-expressing HSC in Fanca-/- preleukemic mice. Left: representative flow cytometry analysis of percentages of bone marrow Trem1+ SLAM cells in the mice described in (B). Right: quantification (n=8-10 mice/group). (D) Increased Trem1 expression in leukemia stem cells (LSC) from Fanca-/- leukemic mice. FACS-isolated LSK cells from the mice described in (B) were subjected to two rounds of bone marrow transplantation (BMT) to establish Fanca-/- leukemia in secondary transplanted recipient mice. Donor-derived SLAM cells were isolated from the secondary recipients and subjected to qPCR analysis for Trem1 expression (n=12 mice/group). (E) Quantification of flow cytometry analysis of percentages of bone marrow Trem1+ SLAM cells in the secondary recipients (n=12 mice/group). (F) Progressive increase in Trem1 expression in MLL-AF9 (MA9) LSC. Bone marrow c-Kit+ cells from 1- to 5-month-old MA9 mice were subjected to qPCR for Trem1 expression. WT mice were used as controls (n=6 mice/group).
To compare the ability of Trem1+ and Trem1- pre-leukemic HSC to induce leukemia, we purified Trem1+SLAM and Trem1–-SLAM cells from Fanca-/- pre-leukemic mice (Online Supplementary Figure S3A), and performed serial BMT. We found that although all primary recipients survived for more than 12 months without signs of leukemia, the recipients transplanted with Trem1+ HSC exhibited donor BM hypercellularity (Online Supplementary Figure S3B) and increased accumulation of donor-derived phenotypic HSC in the BM (Online Supplementary Figure S3C). Furthermore, the secondary recipients of Trem1+ cohorts gave rise to lethal leukemias within 100 days, while the majority of recipients transplanted with Trem1- cells survived over 100 days after BMT (Online Supplementary Figure S3D). Leukemia was confirmed by accumulation of Mac1+Gr1+CD45.2+ cells in peripheral blood (Online Supplementary Figure S3E) and Wright-Giemsa staining of peripheral blood (Online Supplementary Figure S3F). These data indicate that Trem1+ pre-leukemic HSC have greater leukemogenic potential than that of Trem1- pre-leukemic HSC.
Figure 2.
Deletion of Trem1 does not alter steady-state hematopoiesis. (A) Complete blood count of 8-week-old Trem1fl/flVav1Cre mice and the Trem1fl/fl controls (n=7-8 mice). (B) Whole bone marrow cell (WBMC) counts (n=7-8 mice). (C) Bone marrow LSK and SLAM cell counts (n=7-8), and (D) colony-forming cell (CFC) counts are shown for the Trem1fl/flVav1Cre mice and the Trem1fl/fl controls (n=6 mice). (E) Deletion of Trem1 does not affect hematopoietic repopulation in primary transplant recipients. One hundred SLAM cells from Trem1fl/flVav1Cre mice and Trem1fl/fl controls were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived chimerism was determined by flow cytometry of peripheral blood (PB) at different time points after bone marrow transplantation (BMT) (n=10 mice). (F) Deletion of Trem1 does not affect multi-lineage reconstitution in primary transplant recipients. Percentages of donor-derived myeloid, T, and B cells were measured by flow cytometry 16 weeks after BMT (n=10 mice). (G) Deletion of Trem1 increases long-term hematopoietic repopulation. One to three million WBMC from the primary recipients were pooled and injected into sublethally irradiated BoyJ recipients. Donor-derived chimerism was determined by flow cytometry at different time points after BMT (n=12 mice).
To substantiate the observation that Trem1 promotes leukemia, we transduced c-kit+ cells from MA9 mice at the age of 2 months, at which time Trem1 expression is not detectable (see Figure 1F above), with a lentiviral vector expressing eGFP or eGFP-Trem1 (Figure 3A). We achieved >5-fold higher Trem1 expression in GFP-Trem1 cells than in eGFP control cells (Online Supplementary Figure S4A, B). Remarkably, overexpression of Trem1 greatly increased LSC-enriched CD45.2+c-Kit+ cells in the recipients transplanted with eGFP-Trem1-transduced MA9 cells compared to the recipients transplanted with eGFP control cells (Figure 3F). Consistently, overexpression of Trem1 markedly shortened latency in the recipients of GFP-Trem1-transduced MA9 cells compared to the latency in recipients of eGFP control cells (Figure 3G). Together, these data suggest that Trem1 expression in pre-leukemic HSC and LSC promotes leukemogenesis.
Figure 3.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells promotes leukemogenesis. (A) Schematic presentation of the experimental design. (B) Deletion of Trem1 suppresses Fanca-/- leukemic stem cell (LSC) expansion in transplant recipient mice. LSK cells from Fanca-/-;Trem1fl/flVav1Cre mice and the Fanca-/-;Trem1fl/fl controls subjected to 6 weeks of treatment with mitomycin C (MMC) were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived CD45.2+ SLAM cells were analyzed by flow cytometry 4 weeks after bone marrow transplantation (BMT) (n=10 mice). (C) Deletion of Trem1 extends the latency of Fanca-/- leukemia. Survival of the recipient mice groups described in (B) was monitored and plotted by the Kaplan-Meier method (n=9-10 mice/group). (D) Ablation of Trem1 suppresses MLL-AF9 LSC expansion in transplant recipients. Bone marrow c-Kit+ cells from MLL-AF9;Trem1fl/flVav1Cre mice and the MLL-AF9;Trem1fl/fl controls were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived CD45.2+c-Kit+ cells were analyzed by flow cytometry 4 weeks after BMT (n=10 mice). (E) Ablation of Trem1 extends the latency of MLL-AF9 leukemia. Survival of the recipient mice groups described in (D) was monitored and plotted by Kaplan-Meier method (n=10-11 mice/group). (F) Forced expression of Trem1 increases MLL-AF9 LSC expansion in transplant recipients. Bone marrow c-Kit+ cells from 2-month-old MLL-AF9 mice were transduced with lentiviral vector expressing eGFP-Trem1 or eGFP alone. The transduced GFP+ cells were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived GFP+ c-Kit+ cells were analyzed by flow cytometry 4 weeks after BMT (n=10 mice). (G) Forced expression of Trem1 shortens the latency of MLL-AF9 leukemia. Survival of the recipient mice groups described in (F) was monitored and plotted by the Kaplan-Meier method (n=10-13 mice). (B & C): the Fanca-/-leukemia model; (D & E) the MA9 model; and (F & G) the MA9+ Trem1 model.
Figure 4.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with increased proliferation. (A) Deletion of Trem1 reduces myeloid colony formation by Fanca-/- leukemia stem cell (LSC)-enriched donor LSK cells. LSK cells from Fanca-/-;Trem1fl/flVav1Cre mice and the Fanca-/-;Trem1fl/fl controls subjected to 6 weeks of treatment with mitomycin C (MMC) were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived CD45.2+LSK cells were subjected to colony-forming unit (CFU) assays 4 weeks after bone marrow transplantation (BMT) (n=6 mice). (B) Deletion of Trem1 reduces Ki67+ proliferating Fanca-/- LSC-enriched donor LSK cells. The CD45.2+LSK cells from the recipient mice in (A) were gated for Ki67-positive nuclear stain. Representative flow cytometry (left) and quantification (right) are shown (n=6 mice). (C) Ablation of Trem1 reduces myeloid colony formation by MLL-AF9 LSC-enriched donor c-Kit+ cells. Bone marrow c-Kit+ cells from MLL-AF9;Trem1fl/flVav1Cre mice and the MLL-AF9;Trem1fl/fl controls were transplanted, along with 2x105 competitor cells from congenic mice, into lethally irradiated BoyJ recipients. Donor-derived CD45.2+c-Kit+ cells were subjected to CFU assays 4 weeks after BMT (n=6 mice). (D) Ablation of Trem1 reduces Ki67-positive proliferating MLL-AF9 LSC-enriched donor c-Kit+ cells. The CD45.2+c-Kit+ cells from the recipient mice in (C) were gated for Ki67-positive nuclear stain (n=8-9 mice). (E) Deletion of Trem1 does not increase apoptosis in Fanca-/- LSC-enriched donor LSK cells. The CD45.2+LSK cells from the recipient mice in (A) were gated for annexin V-positive staining. Representative flow cytometry (left) and quantification (right) are shown (n=6 mice). (F) Deletion of Trem1 does not increase apoptosis in MLL-AF9 LSC-enriched donor c-Kit+ cells. The CD45.2+c-Kit+ cells from the recipient mice in (C) were gated for annexin V-positive staining (n=7-8 mice). (G) Ablation of Trem1 does not render Fanca-/- LSC-enriched donor LSK cells or MLL-AF9 LSC-enriched donor c-Kit+ cells more sensitive to growth factor-deprived conditions. The CD45.2+LSK cells from the recipient mice in (A) or the CD45.2+c-Kit+ cells from the recipient mice in (C) were cultured in serum-free StemCell medium supplemented with stem cell factor, Flt3 ligand and thrombopoietin for 72 h followed by factor withdrawal. Cell viability was determined by absorbance using a CellTiter 96 Aqueous One Solution Cell Proliferation (MTS) assay after factor withdrawal for 24 h (n=6-8 assays).
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with increased proliferation but has no effect on sensitivity to apoptosis
To explore the underlying mechanism by which Trem1 promotes leukemogenesis, we next examined the rates of proliferation and apoptosis in the LSC-enriched donor cells from the leukemic mice transplanted with cells from Fanca-/-;Trem1fl/flVav1Cre or MA9;Trem1fl/flVav1Cre mice, 4 weeks after transplantation. We found that deletion of Trem1 significantly reduced myeloid colony formation by CD45.2+LSK cells from the leukemic mice transplanted with the Fanca-/-;Trem1fl/flVav1Cre cells compared to those of Fanca-/-;Trem1fl/fl control cells, as determined by CFU assay (Figure 4A). Furthermore, there was a lower percentage of proliferating (Ki67-positive) CD45.2+LSK cells from the leukemic mice transplanted with the Fanca-/-;Trem1fl/flVav1Cre cells compared to those of Fanca-/-;Trem1fl/fl control cells, as determined by nuclear Ki67 staining (Figure 4B). We obtained similar results in the experiments with the MA9;Trem1fl/flVav1Cre and MA9;Trem1fl/fl leukemic cells, in which ablation of Trem1 significantly inhibited the proliferation of the LSC-enriched CD45.2+c-kit+ cells (Figure 4C, D). However, deletion of Trem1 did not significantly increase apoptosis in the leukemia from Fanca-/-;Trem1fl/flVav1Cre pre-leu-kemic cells or MA9;Trem1fl/flVav1Cre leukemic cells, as compared to those from Fanca-/-;Trem1fl/fl or MA9;Trem1fl/fl control cells, respectively (Figure 4E, F). Furthermore, ablation of Trem1 did not render either Fanca-/- or MA9 leukemic cells more sensitive to growth factor-deprived culture conditions, as detected by MTS assay (Figure 4G). Taken together, these results indicate that Trem1 promotes leukemic cell proliferation but has limited effect on apoptosis sensitivity.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with persistent DNA damage and prolonged oncogenic stress
Since our previous studies demonstrated that Trem1 cooperates with diminished DDR in pre-leukemic HSC ex-pansion,1 4 we asked whether Trem1 expression in Fanca-/-pre-leukemic HSC was associated with persistent DNA damage. To this end, we treated the SLAM cells from WT and pre-leukemic Fanca-/- mice with MMC in culture for 2 h and performed flow cytometry analysis for g-H2AX, an established marker of double-strand breaks,31 at different times after treatment. We found that MMC induced robust expression of g-H2AX at 4 h after treatment in both Fanca-/- and WT cells; however, WT cells efficiently repaired double-strand breaks, as evidenced by a progressive decline of g-H2AX within 16 h after MMC treatment (Figure 5A). In contrast, the MMC-treated Fanca-/- cells retained high levels of g-H2AX throughout the 16-h period (Figure 5A), indicative of persistent DNA damage. Correlated with this DNA damage kinetics, Trem1 expression was persistently elevated during the 8- to 16-h period of observation in Fanca-/- cells, whereas Trem1 expression remained undetectable in WT cells (Figure 5B).
Next, we investigated whether prolonged oncogenic stress could also lead to aberrant expression of Trem1 in LSC. We utilized two leukemia models, MLL-AF9 and KrasG12D, to induce prolonged oncogenic stress in vitro. For the MLL-AF9 model, we infected WT LSK cells with a retroviral vector expressing eGFP-MLL-AF9 or eGFP alone, and subjected the transduced cells to culture in growth factor-supplemented medium for different periods of time. We observed persistent elevation of Trem1 expression during 4 to 12 days of culture in cells expressing MLL-AF9, whereas Trem1 expression remained undetectable in those expressing eGFP alone (Figure 5C). For the KrasG12D model, we isolated LSK cells from KrasG12DCreER mice and cultured the cells in growth factor-supplemented medium in the presence of 4-hydroxytamoxifen (4-OHT; to induce Cre-mediated expression of KrasG12D) for different periods of time. We found that prolonged treatment of the KrasG12DCreER cells with 4-OHT induced a persistent increase in Trem1 expression during 3 to 9 days of culture, as compared to negligible Trem1 expression in the cells cultured in the absence of 4-OHT (Figure 5D). These results indicate that prolonged oncogenic stress induces aberrant expression of Trem1 in LSC-enriched leukemic cells.
Figure 5.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with persistent DNA damage and prolonged oncogenic stress. (A) Persistent DNA damage in Fanca-/- pre-leukemic hematopoietic stem cells (HSC). LSK cells from wild-type (WT) and pre-leukemic Fanca-/- mice were treated with mitomycin C (MMC) in culture for 2 h and analyzed by flow cytometry for g-H2AX at different time points after treatment. Representative flow plots (left) and mean fluorescence intensity (MFI) kinetics (right) are shown. 0 h: untreated control (n=6 experiments). (B) Trem1 expression is specifically induced by persistent DNA damage in Fanca-/- pre-leukemic HSC. RNA was then extracted from the cells described in (A) and subjected to quantitative polymerase chain reaction (qPCR) analysis for Trem1 expression using the primers listed in Online Supplementary Table S1. Samples were normalized to the level of GAPDH mRNA (n=6 assays/group). **MMC vs. untreated control (0 h). (C) Prolonged oncogenic stress induces Trem1 expression in MLL-AF9 leukemic stem cell (LSC)-enriched cells. WT LSK cells were transduced with retroviral vector expressing eGFP-MLL-AF9 or eGFP alone, and the transduced cells were subjected to culture in growth factor-supplemented medium. RNA was then extracted from the sorted GFP+ LSK cells at different time points followed by qPCR analysis for Trem1 expression. Samples were normalized to the level of GAPDH mRNA (n=6 assays). (D) Prolonged oncogenic stress induces Trem1 expression in KrasG12D LSC-enriched cells. LSK cells from KrasG12DCreER and KrasG12D control mice were cultured in growth factors-supplemented medium in the presence of 4-OHT. RNA was then extracted from the sorted LSK cells at different time points followed by qPCR analysis for Trem1 expression. Samples were normalized to the level of GAPDH mRNA (n=6 assays).
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with enhanced inflammation
Inflammation is a key feature of leukemia.32,33 TREM1 is known to trigger and amplify inflammatory responses.1,2 T o explore the relationship between Trem1, inflammation and leukemia progression, we measured 248 inflammation-related genes using an nCounter Mouse Inflammation multiplex panel. We observed 20 significantly dysregulated genes in LSK cells of pre-leukemic Fanca-/-;Trem1fl/fl mice compared to those from LSK cells from Fanca-/-;Trem1fl/flVav1Cre mice (Figure 6A); and in 5-month-old MA9;Trem1fl/fl mice compared with those of age-matched MA9;Trem1fl/flVav1Cre mice (Figure 6A).
Among the top five upregulated inflammatory genes, we noted that Ccr1, Il1r1, Nlrp3 and Tlr2 were upregulated in both Fanca-/- and MA9 cells (Online Supplementary Figure S5A, B). CCR1 and its ligand CCL3 have recently been shown to promote leukemogenesis.34 IL1R1 and NLRP3 are key components of the NLPR3 inflammasome, which plays important roles in hematologic malignancies.35 Increased expression of Toll-like receptor 2 (TLR2) and its functional binding partners, TLR1 and TLR6, is found in patients with myelodysplastic syndromes.36 Recent studies showed that overall survival of AML patients with higher TLR2 expression was significantly shorter than that of patients with lower expression.37 To investigate the functional relevance of these TREM1-inflammation signatures in the expansion of Fanca-/- and MA9 leukemic cells, we performed blockade experiments using the CCR1 antagonist, BX471,38 the IL-1R antagonist, AF12198,39 the covalent inhibitor for NLRP3,40 or the neutralizing antibody against TLR2.41 LSK cells of pre-leukemic Fanca-/- mice and 5-month-old MA9 mice were cultured in growth factor-supplemented medium in the presence of neutralizing antibodies for 5 days, followed by CFU and BMT assays. We found that blockade of CCR1, the NLPR3 inflammasome, or TLR2 significantly reduced myeloid colony formation of both Fanca-/- and MA9 leukemic cells (Figure 6B), indicating that these Trem1 inflammation signatures promote the proliferation of Fanca-/- and MA9 leukemic cells.
Figure 6.
Trem1 expression in pre-leukemic hematopoietic stem cells and leukemic stem cells is associated with enhanced inflammation. (A) Inflammatory gene expression (by NanoString analysis) in LSK cells of pre-leukemic Fanca-/-;Trem1fl/fl (Trem1-WT) mice compared with those of Fanca-/-;Trem1fl/flVav1Cre (Trem1-KO) mice (n=3 assays; left) and LSK cells of MA9;Trem1fl/fl (Trem1-WT) mice compared with those of MA9;Trem1fl/flVav1Cre (Trem1-KO) mice (n=3 assays; right). Heatmap of inflammatory genes (log2 fold change; FC) differentially expressed among Fanca-/-;Trem1fl/fl and Fanca-/-;Trem1fl/flVav1Cre cells or MA9;Trem1fl/fl and MA9;Trem1fl/flVav1Cre cells. (B) Blockade of CCR1, IL1R1, NLPR3, or TLR2 reduces colony formation of Fanca-/- and MA9 leukemic cells. LSK cells from Fanca-/- pre-leukemic mice or 5-month-old MA9 mice were cultured in the presence of BX471, AF12198, oridonin, or anti-TLR2 antibodies for 5 days after which colony-froming unit-cell (CFU-C) assays were performed (n=6 assays). (C) Blockade of CCR1, IL1R1, NLPR3, or TLR2 suppresses the expansion of Fanca-/- and MA9 leukemic stem cells (LSC). The cultured cells described in (B) were transplanted, along with 2x105 protector cells from congenic mice, into lethally irradiated recipients. Donor-derived CD45.2+LSK cells from the recipient mice were analyzed 4 months after bone marrow transplantation (BMT) by flow cytometry (n=10 mice). (D) Blockade of CCR1, IL1R1, NLPR3, or TLR2 inhibited the proliferation of Fanca-/- and MA9 LSC. The recipient mice described in (C) were analyzed for Ki67+ CD45.2+LSK cells 4 months after BMT by flow cytometry (n=10 mice).
To substantiate these findings, we transplanted the cultured cells, along with 2x105 protector cells from congenic mice, into lethally irradiated recipients. We observed significant reduction of LSC-enriched donor cells in the recipient mice transplanted with Fanca-/- and MA9 leukemic cells cultured in the presence of neutralizing antibodies, compared to those cultured in the absence of neutralizing antibodies (Figure 6C). Furthermore, there were significantly fewer proliferating (Ki67-positive) donor-derived LSC-enriched CD45.2+LSK cells in the recipient mice transplanted with Fanca-/- and MA9 leukemic cells treated with neutralizing antibodies compared to the untreated control cells (Figure 6D). These data suggest that targeting Trem1 inflammation signatures could suppress the expansion of Fanca-/- and MA9 LSC.
Discussion
The immune system, consisting of immune cells, immune factors, and the immune microenvironment, plays essential roles in tumorigenesis.42 The multifaceted effects of tumor-related immunity include destroying genome stability, generating genetic modification, promoting the proliferation of cancer cells, stimulating angiogenesis, and shaping the tumor microenvironment.43 In this study, we showed that one such immune factor, Trem1, is induced by persistent DNA damage and oncogenic stress and promotes leukemo-genesis. Using our established Fanca-/- pre-leukemic model and the MLL-AF9 AML model, we demonstrated that Trem1 is highly expressed in pre-leukemic HSC and LSC. Moreover, we generated an innovative conditional Trem1 knockout mouse model to show that selective ablation of Trem1 in the hematopoietic compartment significantly extended leukemic latency in mice, and that Trem1 was required for the proliferation of the pre-leukemic HSC and LSC. Our study thus provides new insights into the role of TREM1 in leukemogenesis.
TREM1 is constitutively expressed on a select group of myeloid cells including macrophages, monocytes and neutrophils in peripheral blood.44,45 It has also been identified on airway epithelial cells, hepatic endothelial cells and liver résident macrophages, natural killer cells, dendritic cells, as well as B and T cells.5,45-47 TREM1 belongs to the immunoglobulin superfamily and is engaged in amplifying inflammatory cascades.48,49 It can be induced at high levels on neutrophils and monocytes and further amplifies TLR-initiated responses against microbial challenges, potentiating the secretion of pro-inflammatory cytokines with the help of DAP12 adaptor protein in response to bacterial and fungal infections.50-52 Although high-mobility group box 1 (HMGB1) and peptidoglycan recognition protein 1 (PGLYRP1) were shown to associate with TREM1, the ligand for TREM1 remains to be characterized.53,54 A growing body of evidence suggests that TREM1 plays critical pathological roles in chronic inflammatory disorders including cancer.2 In fact, novel TREM1 inhibitors are being shown to attenuate tumor growth and prolong survival in experimental cancer models.8 By employing three leukemogenic mouse models (a DNA damage-induced Fanca-/- pre-leukemic model, an oncogenic MLL-AF9 transgenic model, and a KrasG12DCreER model) we showed that Trem1 was highly expressed in preleukemic HSC and LSC, and dysregulated expression of Trem1 in these malignant stem cells, enhancing their leukemogenic potential. Conversely, deletion of Trem1 in these pre-leukemic HSC and LSC compromised proliferation and delayed leukemia development in vivo. It is in this context that our study provides new insights into the current understanding of a pathological role for TREM1 in cancer. One intriguing finding of our current study is the observation that Trem1 expression is induced both by persistent DDR and oncogenic stress. Genomic instability, found in most cancers, is considered one of the hallmark characteristics of cancer cells. It is regarded as a major driver of tumorigenicity.55 The FA DNA repair pathway consists of a protein core complex that recognizes damage caused by inter-strand crosslinks, and a multi-subunit ubiquitin ligase that monoubiquitinates downstream DNA repair factors.56 Our previous studies showed that chronic DNA damage stress could transform Fanca-/- HSC into pre-leukemic stem cells possessing leukemogenic activity in transplanted recipients.14 Oncogene-induced replication stress and its role in cancer development have been studied comprehensively. Oncogene activation is an endogenous source of replication stress, disrupting replication regulation and inducing DNA damage.55 Our current study shows that both could induce the expression of Trem1, which is required for maintaining the leukemogenic activity of the pre-leukemic HSC and LSC. Although further mechanistic investigation remains needed, it is in this context that our study unveils for the first time an immune receptor linking leukemogenesis to multiple detrimental cellular stresses; that is, persistent DNA damage, prolonged oncogenic stress and an aberrant immune response.
Another notable finding of the present study is that the upregulated Trem1 expression in pre-leukemic HSC and LSC is associated with enhanced inflammation. Certain chronic inflammatory conditions have long been known to be linked to cancer.32,33 Mounting evidence supports that chronic inflammation increases the risk of various human cancers.57-61 In these pathological conditions, unresolved inflammation provokes cell turnover coupled with the generation of reactive oxygen species at the sites of inflammation, leading to chromosomal DNA mutations and malignant transformation.62, 63 Our current studies established a link between persistent DNA damage, prolonged oncogenic stress and enhanced inflammation. While awaiting further mechanistic insights, our finding that upregulated Trem1 expression enhances inflammation in pre-leukemic HSC and LSC, highlights the crucial role of inflammation in leukemia development.
Supplementary Material
Acknowledgments
We thank Dr. Madeleine Carreau (Laval University) for the Fanca+/- mice, and the Transgenic core facility at Cincinnati Children’s Hospital Medical Center for generating the Trem1fl/fl mice. We thank Fabliha Chowdhury for technical support for some supplementary figures.
Funding Statement
Funding: This work was supported by an NIH/National Heart, Lung, and Blood Institute grant (R01HL151390 to WD). This project used the Hillman Animal Facility that is supported in part by award P30CA047904. WD is a 2021-2022 Hillman Senior Fellow for Innovative Cancer Research at the University of Pittsburgh.
References
- 1.Roe K, Gibot S, Verma S. Triggering receptor expressed on myeloid cells-1 (TREM-1): a new player in antiviral immunity? Front Microbiol. 2014;5:627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Yuan Z, Mehta HJ, Mohammed K, et al. TREM-1 is induced in tumor associated macrophages by cyclo-oxygenase pathway in human non-small cell lung cancer. PLoS One. 2014;9(5):e94241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Zou W. Immunosuppressive networks in the tumour environment and their therapeutic relevance. Nat Rev Cancer. 2005;5(4):263-274. [DOI] [PubMed] [Google Scholar]
- 4.Saurer L, Zysset D, Rihs S, et al. TREM1 promotes intestinal tumorigenesis. Sci Rep. 2017;7(1):14870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wu J, Li J, Salcedo R, Mivechi NF, Trinchieri G, Horuzsko A. The proinflammatory myeloid cell receptor TREM-1 controls Kupffer cell activation and development of hepatocellular carcinoma. Cancer Res. 2012;72(16):3977-3986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ho CC, Liao WY, Wang CY, et al. TREM-1 expression in tumor-associated macrophages and clinical outcome in lung cancer. Am J Respir Crit Care Med. 2008;177(7):763-770. [DOI] [PubMed] [Google Scholar]
- 7.Cioni B, Zaalberg A, van Beijnum JR, et al. Androgen receptor signalling in macrophages promotes TREM-1-mediated prostate cancer cell line migration and invasion. Nat Commun. 2020;11(1):4498. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Shen ZT, Sigalov AB. Novel TREM-1 inhibitors attenuate tumor growth and prolong survival in experimental pancreatic cancer. Mol Pharm. 2017;14(12):4572-4582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Sigalov AB. A novel ligand-independent peptide inhibitor of TREM-1 suppresses tumor growth in human lung cancer xenografts and prolongs survival of mice with lipopolysaccharide-induced septic shock. Int Immunopharmacol. 2014;21(1):208-219. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chandrashekar DS, Bashel B, Balasubramanya SAH, et al. UALCAN: a portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia. 2017;19(8):649-658. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ciccia A, Elledge SJ. The DNA damage response: making it safe to play with knives. Mol Cell. 2010;40(2):179-204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pan MR, Li K, Lin SY, Hung WC. Connecting the dots: from DNA damage and repair to aging. Int Mol Sci. 2016;17(5):685. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Biechonski S, Yassin M, Milyavsky M. DNA-damage response in hematopoietic stem cells: an evolutionary trade-off between blood regeneration and leukemia suppression. Carcinogenesis. 2017;38(4):367-377. [DOI] [PubMed] [Google Scholar]
- 14.Du W, Amarachintha S, Wilson A, Pang Q. The immune receptor Trem1 cooperates with diminished DNA damage response to induce preleukemic stem cell expansion. Leukemia. 2017;31(2):423-433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Blasco RB, Francoz S, Santamaría D, et al. c-Raf, but not B-Raf, is essential for development of K-Ras oncogene-driven non-small cell lung carcinoma. Cancer Cell. 2011;19(5):652-663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Braig M, Pällmann N, Preukschas M, et al. A ‘telomere-associated secretory phenotype’ cooperates with BCR-ABL to drive malignant proliferation of leukemic cells. Leukemia. 2014;28(10):2028-2039. [DOI] [PubMed] [Google Scholar]
- 17.Halazonetis TD, Gorgoulis VG, Bartek J. An oncogene-induced DNA damage model for cancer development. Science. 2008;319(5868):1352-1355. [DOI] [PubMed] [Google Scholar]
- 18.Strasser A, Harris AW, Bath ML, Cory S. Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature. 1990;348(6299):331-333. [DOI] [PubMed] [Google Scholar]
- 19.Prange KHM, Mandoli A, Kuznetsova T, et al. MLL-AF9 and MLL-AF4 oncofusion proteins bind a distinct enhancer repertoire and target the RUNX1 program in 11q23 acute myeloid leukemia. Oncogene. 2017;36(23):3346-3356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Corral J, Lavenir I, Impey H, et al. An Mll-AF9 fusion gene made by homologous recombination causes acute leukemia in chimeric mice: a method to create fusion oncogenes. Cell. 1996;85(6):853-861. [DOI] [PubMed] [Google Scholar]
- 21.Hamarsheh S, Osswald L, Saller BS, et al. Oncogenic KrasG12D causes myeloproliferation via NLRP3 inflammasome activation. Nat Comm. 2020;11(1):1659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Neubauer A, Dodge RK, George SL, et al. Prognostic importance of mutations in the ras proto-oncogenes in de novo acute myeloid leukemia. Blood. 1994;83(6):1603-1611. [PubMed] [Google Scholar]
- 23.Merlevede J, Droin N, Qin T, et al. Mutation allele burden remains unchanged in chronic myelomonocytic leukaemia responding to hypomethylating agents. Nat Commun. 2016;24:10767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Farr C, Gill R, Katz F, Gibbons B, Marshall CJ. Analysis of ras gene mutations in childhood myeloid leukaemia. Br J Haematol. 1991;77(3):323-332. [DOI] [PubMed] [Google Scholar]
- 25.Wong JC, Alon N, Mckerlie C, Huang JR, Meyn MS, Buchwald M. Targeted disruption of exons 1 to 6 of the Fanconi anemia group A gene leads to growth retardation, strain-specific microphthalmia, meiotic defects and primordial germ cell hypoplasia. Hum Mol Genet. 2003;12(16):2063-2076. [DOI] [PubMed] [Google Scholar]
- 26.Johnson L, Mercer K, Greenbaum D, et al. Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature. 2001;410(6832):1111-1116. [DOI] [PubMed] [Google Scholar]
- 27.Ventura A, Kirsch DG, McLaughlin ME, et al. Restoration of p53 function leads to tumour regression in vivo. Nature. 2007;445(7128):661-665. [DOI] [PubMed] [Google Scholar]
- 28.Madisen L, Zwingman TA, Sunkin SM, et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci. 2010;13(1):133-140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Somervaille TCP, Cleary ML. Identification and characterization of leukemia stem cells in murine MLL-AF9 acute myeloid leukemia. Cancer Cell. 2006;10(4):257-268. [DOI] [PubMed] [Google Scholar]
- 30.Ma Z, Xu J, Wu L, et al. Hes1 deficiency causes hematopoietic stem cell exhaustion. Stem Cells. 2020;38(6):756-768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Li X, Sipple J, Pang Q, Du W. Salidroside stimulates DNA repair enzyme Parp-1 activity in mouse HSC maintenance. Blood. 2012;119(18):4162-4173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Craver BM, Alaoui KE, Scherber RM, Fleischman AG. The critical role of inflammation in the pathogenesis and progression of myeloid malignancies. Cancers (Basel). 2018;10(4):104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Vilchis-Ordonez A, Ramirez-Ramirez D, Pelayo R. The triad inflammation-microenvironment-tumor initiating cells in leukemia progression. Curr Opin Physiol. 2021;19:211-218. [Google Scholar]
- 34.Baba T, Naka K, Morishita S, Komatsu N, Hirao A, Mukaida N. MIP-1α/CCL3-mediated maintenance of leukemia-initiating cells in the initiation process of chronic myeloid leukemia. J Exp Med. 2013;210(12):2661-2673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zhong C, Wang R, Hua M, et al. NLRP3 inflammasome promotes the progression of acute myeloid leukemia via IL-1β pathway. Front Immunol. 2021;12:661939. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wei Y, Dimicoli S, Bueso-Ramos C, et al. Toll-like receptor alterations in myelodysplastic syndrome. Leukemia. 2013;27(9):1832-1840. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Rybka J, Butrym A, Wróbel T, et al. The expression of toll-like receptors in patients with acute myeloid leukemia treated with induction chemotherapy. Leuk Res. 2015;39(3):318-322. [DOI] [PubMed] [Google Scholar]
- 38.Strasly M, Doronzo G, Cappello P, et al. CCL16 activates an angiogenic program in vascular endothelial cells. Blood. 2004;103(1):40-49. [DOI] [PubMed] [Google Scholar]
- 39.Li S, Kang P, Zhang W, et al. Activated NLR family pyrin domain containing 3 (NLRP3) inflammasome in keratinocytes promotes cutaneous T-cell response in patients with vitiligo. J Allergy Clin Immunol. 2020;145(2):632-645. [DOI] [PubMed] [Google Scholar]
- 40.He H, Jiang H, Chen Y, et al. Oridonin is a covalent NLRP3 inhibitor with strong anti-inflammasome activity. Nat Commun. 2018;9(1):2250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Komai-Koma M, Li D, Wang E, Vaughan D, Xu D. Anti-Toll-like receptor 2 and 4 antibodies suppress inflammatory response in mice. Immunology. 2014;143(3):354-362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sima P, Vannucci L, Vetvicka V. Immunity in cancer and atherosclerosis. Ann Transl Med. 2019;7(9):204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Gonzalez H, Hagerling C, Werb Z. Roles of the immune system in cancer: from tumor initiation to metastatic progression. Genes Dev. 2018;32(19-20):1267-1284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Bouchon A, Facchetti F, Weigand MA, Colonna M. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature. 2001;410(6832):1103-1107. [DOI] [PubMed] [Google Scholar]
- 45.Matesanz-Isabel J, Sintes J, Llinas L, de Salort J, Lazaro A, Engel P. New B-cell CD molecules. Immunol Lett. 2011;134(2):104-112. [DOI] [PubMed] [Google Scholar]
- 46.Chen CH, Liao H, Chen HA, Liang TH, Wang CT. Soluble triggering receptor expressed on myeloid cell-1 (sTREM-1): a new mediator involved in early ankylosing spondylitis. J Rheumatol. 2008;35(9):1846-1848. [PubMed] [Google Scholar]
- 47.Rigo I, McMahon L, Dhawan P, et al. Induction of triggering receptor expressed on myeloid cells (TREM-1) in airway epithelial cells by 1,25(OH)2 vitamin D3 Innate Immun. 2012;18(2):250-257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Bouchon A, Dietrich J, Colonna M. Cutting edge: inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J Immunol. 2000;164(10):4991-4995. [DOI] [PubMed] [Google Scholar]
- 49.Fu L, Han L, Xie C, et al. Identification of extracellular actin as a ligand for triggering receptor expressed on myeloid cells-1 signaling. Front Immunol. 2017;8:917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Bouchon A, Facchetti F, Weigand MA, Colonna M. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature. 2001;410(6832):1103-1107. [DOI] [PubMed] [Google Scholar]
- 51.Colonna M, Facchetti F. TREM-1 (triggering receptor expressed on myeloid cells): a new player in acute inflammatory responses. J Infect Dis. 2003;187(Suppl 2):S397-401. [DOI] [PubMed] [Google Scholar]
- 52.Dower K, Ellis DK, Saraf K, Jelinsky SA, Lin LL. Innate immune responses to TREM-1 activation: overlap, divergence, and positive and negative crosstalk with bacterial lipopolysaccharide. J Immunol. 2008;180(5):3520-3534. [DOI] [PubMed] [Google Scholar]
- 53.Wu J, Li J, Salcedo R, et al. The proinflammatory myeloid cell receptor TREM-1 controls Kupffer cell activation and development of hepatocellular carcinoma. Cancer Res. 2012;72(16):3977-3986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Read CB, Kuijper JL, Hjorth SA, et al. Cutting edge: identification of neutrophil PGLYRP1 as a ligand for TREM-1. J Immunol. 2015;194(4):1417-1421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Sarni D, Kerem B. Oncogene-induced replication stress drives genome instability and tumorigenesis. Int J Mol Sci. 2017;18(7):1339. [Google Scholar]
- 56.Walden H, Deans AJ. The Fanconi anemia DNA repair pathway: structural and functional insights into a complex disorder. Annu Rev Biophys. 2014;43:257-278. [DOI] [PubMed] [Google Scholar]
- 57.Kuper H, Adami HO, Trichopoulos D. Infections as a major preventable cause of human cancer. J Intern Med. 2000;248(3):171-183. [DOI] [PubMed] [Google Scholar]
- 58.Mackay IR, Rose NR. Autoimmunity and lymphoma: tribulations of B cells. Nat Immunol. 2001;2(9):793-795. [DOI] [PubMed] [Google Scholar]
- 59.Suematsu N, Tsutsui H, Wen J, et al. Oxidative stress mediates tumor necrosis factor-alpha-induced mitochondrial DNA damage and dysfunction in cardiac myocytes. Circulation. 2003;18;107(10):1418-1423. [DOI] [PubMed] [Google Scholar]
- 60.Umeda T, Hino O. Molecular aspects of human hepatocarcinogenesis mediated by inflammation: from hypercarcinogenic state to normo- or hypocarcinogenic state. Oncology. 2002;62 (Suppl 1):38-42. [DOI] [PubMed] [Google Scholar]
- 61.Ekbom A, Helmick C, Zack M, Adami HO. Ulcerative colitis and colorectal cancer. A population-based study. N Engl J Med. 1990;323(18):1228-1233. [DOI] [PubMed] [Google Scholar]
- 62.Ames BN, Gold LS, Willett WC. The causes and prevention of cancer. Proc Natl Acad Sci U S A. 1995;92(12):5258-5265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002;420(6917):860-867. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






