Imaging Inflammasome Activation in Microglia

Abstract

Inflammasomes are multiprotein complexes that play key roles in the host innate immune response to insult. The assembly of an inflammatory complex is initiated with the oligomerization of the upstream inflammasome-forming sensor, and then follows a well-orchestrated multi-step process leading to downstream effector functions that are critical in the innate immune response. The final assembly of these steps provides a detectable read-out of inflammasome complex activation in the form of an apoptosis-associated speck-like protein containing a CARD (ASC) speck. Inflammasome activation, and the release of IL-1β and ASC specks from the microglia, the brain resident immune cell have been implicated in various neurological and neurodegenerative disorders. Protocols exists for the generation of fluorescent inflammasome indicator peripheral macrophages. Building upon these protocols, we describe here a protocol that details the generation of fluorescent inflammasome indicator microglia cells using recombinant retroviruses to transduce murine BV-2 cells. In this protocol, the cells are established in a manner to allow for experimental control of the initial priming step of the inflammasome activation process. We then provide a series of steps for using these reporter cells within an inflammasome activation assay, and use real-time imaging of ASC-speck formation as an indicator of inflammasome activation. In addition, we describe strategies for using these cells for examining the effects of a test substance on inflammasome activation. This protocol offers an effective approach conducive to screening for and examine modifications of microglia inflammasome activation due to exposure to chemicals or pharmacological agents.

Basic Protocol 1: Production of retroviruses to express inflammasome indicator

Basic Protocol 2: Generation of inflammasome indicator BV-2 cells

Basic Protocol 3. Priming and activation of BV-2-ASC-cerulean cells for inflammasome activation assay.

Basic Protocol 4. Examining modifications to inflammasome activation by test substances

Basic Protocol 5. Imaging and analysis of ASC speck formation

INTRODUCTION

Inflammasomes play a pivotal role in inflammation. These multiprotein complexes are comprised of receptor or sensor molecules, including members of the nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) family, absent in melanoma 2 (IM2)-like receptors, adaptor protein apoptosis-associated speck-like protein containing a CARD (ASC), and pro-caspase-1. Inflammasome complexes form in the cytosol of immune cells in response to pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs) that are released upon tissue injury. In this manner, the inflammasome serves as a key sensor and effector of inflammation (Franchi et al., 2009; Ghiringhelli et al., 2009; Gross et al., 2011). Activated inflammasomes induce caspase-1-dependent processing of the pro-inflammatory cytokines interleukin (IL)-1β and IL-18 to a mature state (Broz & Dixit, 2016; Ghiringhelli et al., 2009), which play critical roles in host defense actions against invading factors and in coordinating the inflammatory response (Dinarello, 2009; Sims & Smith, 2010). The non-conventional secretion of IL-1β and IL-18 is primarily due to the formation of Gasdermin-D pores at the cell surface. Pyroptotic inflammatory cell death due to inflammasome activation also serves to regulate inflammation (Lamkanfi & Dixit, 2014). Inflammasome activation plays a critical role in protecting the host from pathogen infection and in initiating a wound healing response. An excessive level of inflammasome activation, however, can lead to augmented inflammatory responses as well as promote a chronic inflammatory state (Guo et al., 2015). Thus, regulation of inflammasome activation is critical, and a disruption in such processes can have adverse effects upon the nervous system.

A well-characterized inflammasome in the nervous system is the NLRP3 inflammasome (Broz & Dixit, 2016; Heneka et al., 2018; Piancone et al., 2021). The NLRP3 inflammasome is broadly sensitive to exogenous and endogenous activators (Nakahira et al., 2011; Shimada et al., 2012; Tschopp & Schroder, 2010; Zhou et al., 2011). Activation of the NLRP3 inflammasome generally requires prior transcriptional priming of the cell by an activating ligand such as Toll-like receptor (TLR) ligands (TLR4 - lipopolysaccharide (LPS); TLR3 – polyinosine-polycytidylic acid). Once primed, NLRP3 activation can be induced by a variety of extracellular, sterile (non-pathogenic) triggers (Cassel et al., 2009; Dostert et al., 2008; Hughes & O’Neill, 2018; Strowig et al., 2012). These wide range of activators are structurally and chemically unrelated, and include self-origin and non-self-origin signals. Self-origin signals include extracellular adenosine triphosphate (ATP) (Mariathasan et al, 2006; Muñoz-Planillo et al., 2013), cholesterol and uric acid crystals (Duewell et al., 2010; Martinon et al., 2006), and aggregated proteins and lipids (Ralston et al., 2017; Sheedy et al., 2013). Non-self-origin signals include silica and asbestos (Dostert et al., 2008), aluminum salt adjuvant (Eisenbarth et al., 2008), polystyrene nanoparticles (Lunov et al., 2011), microbial toxins (pore-forming toxins, activators of ion channels, e.g. Nigericin (Mariathasan et al., 2006), certain compounds such as flame retardants (Bowen et al., 2020), and organometals (Childers et al., 2021). It is considered that NLRP3 does not bind directly to these molecules but, instead, senses cytosolic stress signals, such as potassium efflux, cardiolipin, and oxidized mitochondrial DNA (Elliott et al, 2018; Swanson et al., 2019; Zhong et al, 2018).

Inflammasome activation results in the formation of a large intracellular protein scaffold. The sensor molecule of NLRP recruits the adaptor protein, apoptosis-associated speck-like protein containing a CARD (ASC) and the cysteine protease caspase-1. The resulting protein aggregate, termed “ASC speck”, is a large singular structure that promotes the activation of caspase-1 and initiates cleavage of inactive precursor molecules of the IL-1β cytokine family. There are various methods that have been used to detect inflammasome activation, including immunocytochemistry for ASC, ELISAs for IL-1β, western blots to distinguish pro (31kDa) and mature (17kDa) IL-1β within the cell and as released protein, and the use of peripheral macrophage reporter cell lines for IL-1 or IL-18 receptor activation (Guo & Ting, 2020; Zito et al., 2020). While representative of different levels of sensitivity, these methods have limitations with regards to the level of throughput and with regards to real-time examination of the cell response. Immunocytochemistry for ASC specks in cultured cells is limited to detection of ASC specks contained within the cell membrane and would not capture the ASC specks released into the medium. Use of an IL-1β ELISA will detect both the pro and mature forms of the protein, both of which are released by the cell upon activation. Determination of the two forms of IL-1β protein (pro and mature) requires the use of western blot analysis for molecular weight identification. These restrictions ultimately led to the generation of ASC fluorescent macrophage reporter cells for real-time image analysis (Stutz et al., 2013). The large size of the ASC specks allows for its visualization by microscopy, allowing for ASC speck formation to be effectively used as a hallmark or readout for inflammasome activation (Stutz et al., 2013). The utility of the ASC fluorescent reporter cell is of additional importance for examining the brain resident immune cell, the microglia. In general, the production of inflammatory factors such as IL-1β is lower in microglia compared to peripheral macrophages. Due to this, analysis of protein changes by ELISA or western blot requires a large number of cells and a medium concentration to assess released protein. The use of live-cell image analysis now allows for real-time examination of ASC speck formation in fluorescent reporter cells and the quantitation of inflammasome activation using relatively small cell populations. This method is easily adaptable for screening of test substances for effects on inflammasome activation. This imaging approach also allows for a real time determination of both exposure concentration and time for the refinement of any subsequent detailed analyses.

Here, we describe a workflow for creating a fluorescent ASC microglia reporter-cell line using recombinant retroviruses to transduce murine BV-2 cells (Fig. 1) and then applying real-time image analysis of these cells to monitor inflammasome activation. In Basic Protocol 1, we describe the steps for the production of retroviruses to express the inflammasome indicator. Basic Protocol 2 describes the steps for transfecting BV-2 murine microglia cells. Basic Protocol 3 the describes steps for priming and triggering inflammasome activation. Basic Protocol 4 outlines the steps for examining chemical or drug modification to inflammasome activation. Lastly, Basic Protocol 5 outlines the steps for conducting image analysis of ASC speck formation and data analysis.

Figure 1. Outline of the critical steps involved in generating the BV-2 ASC Cerulean cells and in using these cells in an inflammasome activation assay.

The top panel summarizes to produce retroviruses to express the inflammasome indicator. The middle panel summarizes the steps to generate BV-2 reporter cells using recombinant retroviruses. The lower panel summarizes the steps involved in the use of BV-2 reporter cells for an inflammasome assay.

CAUTION: Recombinant retroviruses have biosafety level 2 (BSL-2) designation. Sterilize all surfaces with 70% v/v ethanol before and after working with virions. Decontaminate all material and liquids that come in contact with retroviruses with 10% v/v bleach prior to disposal. In addition, follow your institutional guidelines and obtain all necessary ethical permissions for working with retroviruses.

CAUTION: All materials and reagents for cell culture should be prepared, stored, and used with sterile techniques.

CAUTION: Store reagents as instructed by supplier. As needed, store reagents and cells in single-use aliquots and minimize freeze-thaw cycles.

STRATEGIC PLANNING

The specific aspect of inflammasome activation of interest to the investigator will drive several experimental design elements of the imaging assay for assessing ASC speck formation described here. The goal of the experiment, for instance, may be to determine if a test substance can serve as an inflammasome activating agent. Alternatively, the goal may be to identify test substances that block inflammasome activation. As an evaluation of neurotoxicity, the goal may be, instead, to determine if a test substance would alter the normal process of inflammasome activation.

An additional consideration of the use of the evaluation of ASC speck formation as an indicator of inflammasome activation is related to whether or not additional experiments are planned to delve into the underlying mechanisms associated with the disruption. As a screening tool, the protocol and assay should be used to detect a functional alteration in microglia. However, this use should be focused to dose levels for which confounding factors such as cell death and/or inflammatory protein production are not observed. Microglia, like macrophages, are reactive cells and respond to changes in their environment. As such, consideration is required for determining if the test substance can directly serve to prime or activate an inflammatory response, or if the response observed is secondary and related to a change in surrounding cells. The proposed experimental approaches in Basic Protocol 4 are outlined with the goal of examining the effect of a test substance on two functions, namely, the ability to serve as a secondary trigger or if exposure alters the performance of microglia in their normal inflammasome activation response. The basic set of criteria for cell health and inflammatory induction are provided to help to experimentally control for these secondary modifiers.

The outlined procedures can be conducted in stages, with the generation of the fluorescent reporter BV-2 cells, as outlined in Basic Protocols 1 and 2, in one, and the inflammasome assays of Basic Protocols 3 and 4, in another. Basic Protocol 4 outlines steps to examine if a test substance has the ability to modify the normal process of inflammasome activation or if the test substance can act as an inflammasome activator. In addition, the different well conditions are outlined and how the data should be presented. Many of the details of such experiments are dependent upon the specific research questions and characteristics of the test substance under study. These details are outside the scope of this specific protocol and as with any experiment, the actual details of the experimental design and the comparisons that are to be made are required to be established prior to the assay.

An additional feature of the protocol described here for generating the reporter cells, is that the cells can be generated and the virus titered within two weeks. The cells can be maintained frozen for an extended period of time.

BASIC PROTOCOL 1: PRODUCTION OF RETROVIRUSES TO EXPRESS INFLAMMASOME INDICATOR

Retroviruses are members of the Retroviridae family of viruses. Recombinant gamma-retroviruses (referred to as retroviruses in this manuscript) are highly efficient vehicles for delivering genes into cells. They are a powerful research tool that can be used to effectively generate stable cell lines for biochemical assays. Most recombinant retroviruses are derived from MoMLV (Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) and target specific immune or stem cells. Pseudo-typed retroviral vectors bear envelope glycoproteins that are derived from other enveloped viruses. Vesicular stomatitis virus glycoprotein (VSV-G) is often used to expand retroviral tropism to include all mammalian cells. Once retroviruses enter their host cells, their single stranded RNA genome is reverse transcribed to DNA and forms a nucleoprotein complex. Unlike lentiviruses, retroviruses cannot infect non-dividing cells such as neurons. During mitosis, when the nuclear envelope is temporarily disassembled, the retroviral nucleocomplex gains access and incorporates its genome into its host chromosomal DNA. Once incorporated, the retroviral genome is propagated as part of its host genome, for lasting expression of a recombinant protein. ASC-Cerulean viral particles described in this protocol can be used to transduce dividing mammalian cells and to create other mammalian stable immune cell lines.

In this protocol, we describe the production of retroviruses to express the inflammasome indicator apoptosis-associated speck-like protein containing CARD (ASC), C-terminal tagged with fluorescent moiety cerulean (ASC-Cerulean). The retroviral transfer vector pRP_ASC-LmCerulean has been described previously (Stutz et al., 2013). All retroviruses are produced and titered in HEK293T/17 cells using 2^nd generation retroviral packaging systems (Chen et al., 2019). Transfer vector ASC-Cerulean, and envelope (MD2.G) and helper (pUMVC) plasmids are transfected into HEK293Ts using Lipofectamine 2000. pUMVC plasmid delivers the necessary packaging components for producing MuLV retroviral particles. The MD2.G plasmid expresses vesicular stomatitis virus glycoprotein (VSV-G) in the packaging cell line for pseudotyping retroviral particles. VSV-G expands the retroviral particle tropism to include all mammalian cells. Supernatant collected after 48 h is spun to pellet and concentrate the virus. All titers are determined by performing quantitative PCR to measure the number of retroviral particles that integrated into the host genome. Endogenous actin gene copy numbers are used as a reference to calculate the number of incorporated retroviral particles per cell and transducing units. The produced retroviral samples by this method are infectious but non-propagating. The resulting retroviruses are then used in Basic Protocol 2 for the generation of inflammasome-indicator BV-2 cells.

Materials

HEK293T/17 cells (ATCC # CRL-11268, RRID: CVCL_1926; RRID: CVCL_1926) (store in vapor zone of liquid nitrogen cryofreezer)

Dulbecco’s Modified Eagle Medium (DMEM) high glucose, pyruvate, phenol red (#11995–065 Gibco, ThermoFisher) (store 4°C)

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 11965–118 Gibco, containing 25mM glucose, 4 mM L-glutamine, phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C).

Penicillin/streptomycin 10,000 units penicillin and 10 mg streptomycin/ml (#P0781, Sigma-Aldrich, Millipore Sigma) (store at −20°C for long term; 4°C for several months)

Fetal bovine serum (FBS, Avantor Seradigm Premium Grade Fetal Bovine Serum (Seradigm # 1500-500; VWR catalog # 97068-085; heat-inactivated; Seradigm # 1500-500H; VWR catalog # 97068-091) Endotoxin ≤ 20 EU/mL; hemoglobin ≤ 25 mg/dL. (store at −20°C)

HEK293T Cell DMEM growth medium (see Reagents and Solutions)

D-(+)-Glucose (Dextrose) (CAS#50-99-7; D9434, Millipore Sigma) (store at 4°C)

L-Glutamine (#25030081 Thermo Fisher Scientific) (store at −20°C)

Sodium Pyruvate (#11360070 Thermo Fisher Scientific) (store 4°C)

Phosphate buffered saline (PBS-CMF), no calcium, no magnesium 1x (#14190144 Gibco, ThermoFisher) (store at room temperature) (alternatively, it can be made from individual reagents - see Reagents and Solutions)

Opti-MEM (#31985-070 Gibco)

Tris hydrochloride (CAS #1185-53-1, #1081284600 Roche; Millipore Sigma) (store at room temperature)

Ethylenediaminetetraacetic acid tetrasodium salt dihydrate (EDTA) (CAS #:10378-23-1; E6511, Millipore Sigma) (store power at room temperature; solution at 4°C)

Sterile water (room temperature)

Nuclease-free water (CAS # 7732-18-5; #W4502-1L; Millipore Sigma) (store at room temperature)

Trypan blue (CAS # 72-57-1; #T8154, Millipore Sigma) (store at room temperature)

Trypsin-EDTA (0.25%) (stock stored at −20°C; diluted stored at 4°C for 2 weeks, Gibco 25200056)

Lipofectamine 2000 (#11668019, ThermoFisher Scientific)

TNE buffer (see Reagents and Solutions)

20% sucrose/TNE buffer solution (See Reagents and Solutions)

Dimethyl sulfoxide (Sigma, catalog # C6164-6X50M) (room temperature)

Blood and Cell Culture DNA Kit (# 13323 Qiagen or equivalent).

Ethanol (70% v/v)

Bleach

pRP_ASC-LmCerulean – retroviral transfer vector (#41840 Addgene; RRID:Addgene_41840) (store at −20°C)

pUMVC – retroviral helper plasmid (#8449 Addgene; RRID:Addgene_8449) (store at −20°C)

pMD2G – VSV-G envelope gene (#12259 Addgene; RRID:Addgene_12259) (store at −20°C)

Human actin primers, 3μM in nuclease-free water (IDT or similar):

Forward 5’ – TCCGTGTGGATCGGCGGCTCCA – 3’ (store at −20°C)

Reverse 5’ – CTGCTTGCTGATCCACATCTG – 3’ (store at −20°C)

Psi (ψ) primers, 3μM in nuclease-free water

Forward 5’ – GCAGCATCGTTCTGTGTTGT – 3’ (store at −20°C)

Reverse 5’ – GCTCGACATCTTTCCAGTGA – 3’ (store at −20°C)

For additional details regarding selection of primers, see Tokheim et al. (2014)

Human genomic DNA (#G304A Promega) (store at −20°C)

Power SYBR™ Green PCR Master Mix (#4368702, ThermoFisher Scientific)

LightCycler® 480 Multiwell Plate 96, white with foils (#04729692001, Roche)

Human Genomic DNA, 100 ug (#G3041 Promega)

Dry Ice

15-mL screw top conical centrifuge tubes (Falcon or equivalent)

50-mL screw top conical centrifuge tubes (Falcon or equivalent)

31.5 mL, Open-Top Thinwall Polypropylene Konical Tube, 25 x 89mm (Beckman Coulter, catalog # 358126) or equivalent

1.5-mL conical screw top centrifuge tubes with O-rings (Sarstedt, catalog # 72.692.005)

1.5-mL microcentrifuge tubes (#02-681-320, Fisher Scientific)

Cell scrapers

Sterile cotton tip applicators

Sterile T-75 tissue culture flasks

Sterile 10-cm tissue culture dishes

0.45-μm Durapore Steriflip-GP PVDF filter (#SE1M003M00 EMD Millipore) or equivalent

0.22-μm pore size filter

10-mL serological pipettes

5-mL serological pipettes

Sterile filter micropipette tips (10 μL, 100 μL, 1 mL)

Pipette (100 μL and 1 mL capacity)

pH instrument (or pH paper for pH 7.4)

Inverted binocular tissue-culture microscope

Epifluorescent microscope with filters for CFP and 10x and 20x objectives

−80 ultra freezer

Vortex mixer

Nutating shaker

Centrifuge (Beckman Coulter Allegra X-22R and SX4250 rotor, max speed 4,500 rpm, or equivalent)

Ultracentrifuge (Beckman Coulter and SW32Ti rotor, capable of 50,000 x g speed for centrifugation of 35 mL samples, max speed 32,000 rpm, or equivalent)

Water bath (37°C)

Tissue culture incubator (37°C, 90% humidity, ~15% O₂)

Laminar flow hood

Hemocytometer, Nexcelom automated cell counter, or equivalent

Liquid nitrogen cryofreezer for cell storage

PCR machine LightCycler® 480 (or equivalent)

Protocol Steps

Thawing and culturing HEK293T cells

1. Prepare a T-75 flask containing 15 mL of HEK293T Cell DMEM growth medium (without antibiotics, see Reagents and Solutions) and allow to come to temperature (~37°C) in tissue culture incubator.

2. Remove HEK293T cells in a cryotube from liquid nitrogen cell storage cryofreezer and thaw quickly in a 37°C water bath.

3. Add the content of the cryotube to 9 mL of growth media in a 15-mL Falcon tube.

4. Centrifuge at 300 x g for 5 min at room temperature.

5. Discard supernatant, ensuring that you do not disturb the cell pellet.

6. Remove the T-75 flask containing warm HEK293T DMEM growth medium without antibiotics (Step 1) and remove 1 mL to resuspend the pellet using gentle pipetting up and down with a 1-mL pipette.

7. Add the resuspended cells to the T-75 flask containing the remaining 14 mL warm HEK293T DMEM from Step 1.

8. Return the flask with cells to the incubator.

9. Monitor cell growth, with fresh medium changes every 2–3 days.

10. Allow cells to reach ~80% confluency.

Passage and culture of HEK293T cells for transduction

11. Add 14 mL of HEK293T DMEM growth medium to each of eight new T-75 flasks and allow to equilibrate to temperature in a 37°C tissue culture incubator.

The HEK293T cells should be in a low passage number and maintained below 80% confluency for transduction.

12. Take the T-75 flask containing the HEK293T cells (from Step 10) out of the incubator, remove medium with a pipette, and wash cells with 5 mL of sterile PBS-CMF at room temperature. Remove the PBS-CMF.

13. Add 2 mL of 0.25% trypsin/EDTA and allow 2–5 min for cells to detach.

14. Add 6 mL of HEK293T DMEM growth medium to the T-75 flask to dilute and deactivate trypsin.

15. Gently agitate the cell suspension.

16. Use 1 mL of the 8-mL cell suspension to seed each new T-75 flask containing warm HEK293T DMEM medium from Step 11 (representing a splitting of 1:8).

17. Place cells in 37°C tissue culture incubator and allow the cells to expand to 80% confluency.

For the next steps, do not use cells after 10 passages (splits).

One of these flasks will be used to determine titer, in Step 50.

18. Take each T-75 flask containing the HEK293T cells (from Step 17) out of the incubator, remove medium with a pipette, and wash cells with 5 mL of sterile PBS-CMF at room temperature. Remove the PBS-CMF.

19. Add 2 mL of 0.25% trypsin/EDTA and allow 2–5 min for cells to detach.

20. Add 6 mL of HEK293T DMEM growth medium to the T-75 flask to dilute and deactivate trypsin.

21. Gently agitate the cell suspension.

22. Aliquot 20 μL of the cell suspension into a 1.5-mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells using a hemocytometer or automated cell counter.

23. Seed 10-cm plates with 6–7 x 10⁶ cells in 10 mL of HEK293T DMEM growth media per plate and incubate overnight at 37°C in tissue culture incubator.

To produce 10 mL of not-concentrated retroviral, you will need one 10-cm plate. In order to prepare 300 ul of concentrated virus, prepare three 10-cm plates.

24. On the day of transfection, remove medium and replace with 6 mL of freshly prepared HEK293T DMEM growth medium without antibiotics.

The presence of antibiotics can hinder the transfection.

Transfection of HEK293T cells and retrovirus collection

25. Prepare enough transfection mixture for three 10-cm plates. In a 15-mL conical tube, prepare 4.5 ml of Opti-MEM containing the following amount of DNA, and mix:

• 36 μg retroviral transfer vector

• 32.4 μg pUMVC

• 3.6 μg pMD2G

This will be enough for three 10-cm tissue culture plates.

Use 1/3 of the above reagents for 1 x10 cm plate to prepare not-concentrated virus.

26. Prepare a second 15-mL conical tube containing 216 μL of Lipofectamine 2000 in 4.5 mL of Opti-MEM. Allow to stand at room temperature for 5 min.

To accommodate multiple plates, a larger volume of each solution (vector and lipofectamine) can be made, maintaining the same relative ratios. Use 1/3 of the above reagents for 1 x10 cm plate to prepare not-concentrated virus.

27. Add the contents of the 15-mL tube from Step 25 (vector and helper plasmids) to the contents of the 15 mL tube in Step 26 (Lipofectamine) for a total of 9 mL of transfection mixture. Gently mix and keep at room temperature for 20–30 min.

28. Add transfection mixture (9 mL) from Step 27 in a dropwise manner to cover the full plate area of seeded plates from Step 23 (3 mL/10-cm plate).

29. Place plates in a tissue culture incubator. Maintain at 37°C overnight.

30. The next morning, slowly warm HEK293T DMEM growth media (without antibiotics) to 37°C and use to replace the medium in each plate. Return cells to the 37°C tissue culture incubator.

31. At 48 h post transfection, collect medium from each plate to obtain the retroviral particles.

32. Place collected medium in a sterile 50-mL polypropylene centrifuge tube and centrifuge at 2000 x g for 10 min at 4°C, to remove debris.

33. Recover the supernatant and filter through a 0.45-micron low-protein binding filter to clear supernatant of large protein aggregates and small cell debris. Collect the filtered supernatant in a sterile 50-mL polypropylene centrifuge tube.

Do not use 0.22 μm filters, as this will block many virus particles, resulting in lower virus titers.

34. Aliquot 1 mL of the collected supernatant into 1.5-mL cryotubes and freeze at −70–80°C for storage, or proceed to the next step.

Non-concentrated retroviral samples have a typical titer of 1e5 – 1e6 TU/mL and can be stored at −70 to −80°C for years with preserved integrity. Freeze-thawing samples drastically reduces titer.

Retrovirus purification and concentration

35. Use 70% v/v ethanol and sterile cotton-tip applicators (or equivalent) to rinse and sterilize three 1.5-mL Konical ultracentrifuge tubes. Allow tubes to dry under sterile conditions (e.g., tissue culture hood).

36. Pipette 2.5 mL of filtered supernatant (from Step 34) into each of the three 30-mL ultracentrifuge tubes.

37. Using a 10-mL sterile pipette, carefully underlay the supernatant with 4 mL of 20% sucrose/TNE buffer to provide a centrifuge cushion.

38. Add sterile PBS-CMF to fill each tube up to 2 mm from the rim, to prevent the tube from collapsing during centrifugation.

39. Balance tubes for ultracentrifugation.

40. Centrifuge samples for 2 h under 50,000 x g at 4°C (20,000 rpm in a Beckman Coulter ultracentrifuge and SW32Ti rotor).

41. After centrifugation, transfer rotor buckets to the tissue culture hood to open and remove tubes.

42. Discard each supernatant into 10% v/v bleach. Then, carefully wipe the inside of each tube with a sterile cotton-tip applicator (or equivalent) to remove remaining traces of liquid. Do not touch the pellet.

43. Allow each tube to drain onto a sterile plate in an inverted position for few minutes. Do not allow virus to dry. Again, carefully wipe the inside of each tube with a sterile cotton-tip applicator (or equivalent) to remove remaining traces of liquid.

44. In the ultracentrifuge tubes, resuspend the pellet in 300 μL of sterile phosphate buffered saline (PBS-CMF), transfer to a 50-mL conical tube with a cap, close cap securely, and subject to gentle rotation (20 rpm) in a nutator overnight at 4°C.

The resulting small pellet will not be visible to naked eye.

45. The following morning, remove the tubes from the nutator and gently pipette samples up and down ~50 times using a 1-mL pipette. Avoid creating bubbles.

46. Aliquot samples (25–30 μL/tube) into 1.5-mL sterile cryotubes with screw caps and O-ring seals.

47. Store samples at −70 to −80°C

Do not use liquid nitrogen to quick freeze.

Concentrated retroviral samples have a typical titer of 1e7 – 1e8 TU/mL and can be stored for months with preserved integrity.

Freeze-thawing drastically reduces titer.

Determining virus titer by qPCR

Additional details are available in (Chen et al., 2019).

48. Take one T-75 flask containing the HEK293T cells (from Step 17) out of the incubator, remove medium with a pipette, and wash cells with 5 mL of sterile PBS-CMF at room temperature. Remove the PBS-CMF.

49. Add 2 mL of 0.25% trypsin/EDTA and allow 2–5 min for cells to detach.

50. Add 6 mL of HEK293T DMEM growth medium (without antibiotics) to the T-75 flask to dilute and deactivate trypsin.

51. Gently agitate the cell suspension.

52. Aliquot 20 μL of the cell suspension into 1.5-mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells using a hemocytometer or automated cell counter.

53. Adjust concentration of cells in suspension from step 51 to obtain 25,000 cells per ml of solution. Seed 6-well plates with 2 mL of suspension containing 50,000 HEK293T cells per well and incubate overnight.

54. Infect HEK293T cells from Step 53. For the non-concentrated virus, add 10 μL of viral sample to each well. For the concentrated virus, add a 10 μL of a 1:100 diluted viral sample (diluted in HEK293T growth media (without antibiotics)

With the concentrated viral sample. a dilution of 1:100 results in adding 0.1 μL of the original concentrated viral sample.

55. Return cells to tissue culture incubator for 24 h.

56. Replace medium with fresh HEK293T DMEM growth medium (without antibiotics) (2 mL/well) and incubate at 37°C for 4 days.

57. Remove medium, add 400 μL sterile PBS-CMF per well, and harvest HEK293T cells using a 1-mL pipette.

The cells should easily detach.

58. Transfer cell/PBS-CMF solution from each well to a separate 1.5-mL Eppendorf tube and spin at 300 x g for 5 min at 4°C to pellet the cells.

59. Pipette off the PBS-CMF and discard. Either freeze the pellets at −70°C (for storage of only a few days) or proceed to the next step.

60. Isolate chromosomal DNA from cells using a commercial kit (e.g. Blood and Cell Culture DNA Kit from Qiagen or equivalent).

61. Add 5 μL of each DNA preparation to 195 μL of nuclease-free water. Use 5 μL of diluted DNA for qPCR.

62. Use actin and psi oligo primers to perform quantitative PCR (qPCR). Generate a standard curve for each (see next steps), which will then be used to determine the amount of incorporated retrovirus per cell (psi copy number divided by ½ of actin copy number). ½ actin copy number is equivalent to number of cells in the sample.

Thermocyclers generate automatic standard curves and report unknown values extrapolated from the standard curve. The Roche LightCycler96 system protocol was used for determining psi and actin copy numbers in the chromosomal DNA preparation. If a different system for qPCR is used, follow the manufacturer’s recommended reagents and protocol.

63. Dilute human genomic DNA in water to prepare six actin standards, containing 1e5, 2e4, 4e3, 8e2, 1.6e2, and 3.2 copies of actin per 5 ul. To do this, add 15.1 μL of Promega human genomic DNA (catalog #G3041) to 184.9 μL of nuclease-free water to obtain 2e4 actin copies per 5 μL. Use 1:5 serial dilutions to generate the remaining actin standards.

64. Use pRPASC-LmCerulean plasmid to generate psi standard curve. Dilute plasmid in nuclease-free water to prepare six psi standards, containing 1e5, 2e4, 4e3, 8e2, 1.6e2, and 3.2 copies of psi per 5 μL.

This plasmid has a molecular weight of 2440544.60 Da or 4.05e-18 grams. Therefore, a 1 μg/ μL plasmid stock will have 2.47e11 copies of plasmid (1 copy of psi per plasmid).

65. Prepare two set of samples in a Roche 96-well plate:

Set 1: Add 12.5 μL of Power SYBR™ Green PCR Master Mix, 5 μL nuclease-free water, 2.5 μL of actin primer (3 μM), and 5 μL of DNA (actin standards from Step 63 and unknown samples from Step 61) to each well

Set 2: Add 12.5 μL of Power SYBR™ Green PCR Master Mix, 5 μL nuclease-free water, 2.5 μL of psi primer (3 μM), and 5 μL of DNA (psi standards from Step 64 and unknown samples from Step 61) to each well.

66. Cover 96-well plate with sealing foil. Proceed to next step immediately or, if needed, store at 4°C for several hours before proceeding to next step.

67. Run qPCR:

• Insert sample plate (Step 66) into PCR machine.

• Set up and name new experiment based on PCR machine template Select “New”.

• For measurements, select SYBR green.

• Reaction volume, 25 μL

• Start program

• At end of program transfer data to flash-drive for transfer of data to computer with analysis software.

• Select your experiments file.

• Label samples and set reaction properties.

• Select absolute quantification.

68. Use the absolute quantification values of actin and psi for your unknown sample to calculate titer.

69. Estimate cell number based upon original plating cell number and the proliferating rate of HEK293T cells.

HEK293T cell number doubles every 18–30 hrs. If 24 hours has passed from the time that the cells were seeded, then cell number should have doubled to 100,000.

70. Calculate titer with the following formula: (Transducing units/ml) = (cell number) X (# retroviral copies /cells)/sample volume.

Basic Protocol 2: GENERATION OF INFLAMMASOME INDICATOR BV-2 CELLS

To facilitate the ability to image inflammasome activation via ASC speck formation, a fluorescent reporter cell line is required. To generate a microglia cell line that can serve as a fluorescent reporter cell for inflammasome activation, we utilized the murine BV-2 cell line. The BV-2 murine cell line has been used extensively in research to examine microglia responses in culture and shows functional features comparable with those observed in primary murine microglia (Henn et al, 2009; Stansley et al, 2012). The following protocol outlines the steps for generating reporter BV-2 cells by transfecting with the retrovirus generated in Basic Protocol 1. The protocol describes the thawing and culturing of BV-2 cells, the transduction of BV-2 cells with the ASC Cerulean retroviruses (from Basic Protocol 1) to generate the BV-2-ASC-Cerulean cells, and the freezing of these reporter cells for storage.

Materials

BV-2 mouse microglia cell line (ABC-TC212S; Accegen Biotechnologies, or equivalent) (as frozen held in vapor zone of liquid nitrogen cryofreezer).

ASC-Cerulean retroviral samples (from Basic Protocol 1)

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 11965–118 Gibco, containing 25mM glucose, 4 mM L-glutamine, phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C).

BV-2 DMEM growth medium (see Reagents and Solutions). Glutamine can be replaced with Glutamax^TM in DMEM for BV-2 cells.

Dimethyl sulfoxide (Sigma, catalog # C6164-6X50M) (room temperature)

PBS-CMF wash fluid and add 2 mL of 0.25% trypsin/EDTA

Penicillin/streptomycin 10,000 units penicillin and 10 mg streptomycin/ml (#P0781, Sigma-Aldrich, Millipore Sigma) (store at −20°C for long term; 4°C for several months)

Fetal bovine serum (FBS, Avantor Seradigm Premium Grade Fetal Bovine Serum (Seradigm # 1500-500; VWR catalog # 97068-085; heat-inactivated; Seradigm # 1500-500H; VWR catalog # 97068-091) Endotoxin ≤ 20 EU/mL; hemoglobin ≤ 25 mg/dL. (store at −20°C)

Phosphate buffered saline (PBS-CMF), no calcium, no magnesium 1x (#14190144 Gibco, ThermoFisher) (store at room temperature)

Poly-L-lysine (CAS # 25988-63-0; P4707-50ML; Sigma-Aldrich; Millipore Sigma)

Trypan blue (CAS # 72-57-1; #T8154, Millipore Sigma) (store at room temperature)

Trypsin-EDTA (0.25%) (stock stored at −20°C; diluted stored at 4°C for 2 weeks, Gibco 25200056)

Sterile nuclease-free water (room temperature)

Ethanol (70% v/v)

Bleach

Sterile T-75 tissue culture flasks

15-mL screw top conical centrifuge tubes (Falcon or equivalent)

1.5-mL conical screw top centrifuge tubes with O-rings (Sarstedt, catalog # 72.692.005)

1.5-mL microcentrifuge tubes (#02-681-320, Fisher Scientific)

0.22-micron pore size filter

10-mL serological pipettes

5-mL serological pipettes

100 mL beaker (or equivalent)

Sterile filter micropipette tips (10 μL, 100 μL, 1 mL)

Pipette (100 μL and 1 mL capacity)

pH meter or pH paper (pH 7.4)

Inverted binocular tissue-culture microscope

Epifluorescent microscope with filters for CFP and 10x and 20x objectives

−80 ultra freezer

Water bath (37°C)

Tissue culture incubator (37°C, 90% humidity, ~15% O₂)

Laminar flow hood

Hemocytometer, Nexcelom automated cell counter, or equivalent

Liquid nitrogen cryofreezer for cell storage

Protocol Steps

Thawing and culturing BV-2 cells

1. Warm BV-2 DMEM growth medium to 37°C.

2. Fill a 50- or 100-mL beaker with ~30 – 40 mL of sterile water and place in 37°C water bath.

3. Add 10 mL of warm BV-2 DMEM growth medium (Step 1) to 15-mL conical Falcon tube.

4. Add 10 mL of warm BV-2 DMEM growth medium to a T-75 flask and place in the tissue culture incubator.

Ensure that media is at 37°C and equilibrated to oxygen conditions prior to placing cells into flask.

The volume of media in a T-75 flask needs to be sufficient to properly cover the cells to allow for nutrients, but not to enter the neck of the flask.

5. Remove BV-2 cells from the liquid nitrogen cell storage cryofreezer and place in the beaker containing the warm sterile water from Step 2. Swirl gently until cells start to unfreeze.

Do not give cells an extended period to thaw or to remain unfrozen.

6. As soon as the BV-2 cells thaw, transfer cells by pipette to the 15-mL conical Falcon tube containing warm BV-2 DMEM growth medium from Step 3.

7. Centrifuge at 1200 rpm for 5 min at room temperature.

8. Pipette off the supernatant ensuring that you do not disturb the cell pellet.

9. Re-suspend pellet in 1 mL of fresh warm BV-2 DMEM growth medium using gentle up and down pipetting.

10. Aliquot 20 μL of the BV-2 cell suspension into a 1.5-mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells (excluding trypan blue) using a hemocytometer or automated cell counter.

12. Remove the T-75 flask containing the warm growth medium from Step 4 from the incubator and add the remaining cells from Step 9 (~1 mL, between 500,000 and 800,000 cells) then gently agitate flask side to side to distribute cells. Rinse tube with 500 μL of BV-2 DMEM growth medium to capture all cells.

13. Place BV-2 cells in the tissue culture incubator and monitor growth, with fresh BV-2 DMEM growth medium changes every 3 days.

14. Allow cells to reach ~80% confluency.

15. Take the T-75 flask containing the BV-2 cells (from Step 14) out of the incubator, remove medium with a pipette, and wash cells with 5 mL of sterile PBS-CMF at room temperature.

16. Remove the PBS-CMF wash fluid and add 2 mL of 0.25% trypsin/EDTA. Allow 2–5 min for cells to detach.

17. Add 6 mL of BV-2 DMEM growth medium to the T-75 flask to dilute and deactivate trypsin.

18. Gently agitate the cell suspension.

19. Add 50 mL of warm BV-2 DMEM growth medium to the T-75 flask containing the BV-2 cells and gently agitate.

20. Distribute the BV-2 cell suspension equally across four T-75 flasks (~15 mL each flask).

21. Place flasks into tissue culture incubator and allow cells to reach 80% confluency.

22. Repeat Steps 15 through 21 one additional time if cells are needed for experiments.

Cells can be used for transduction after the first expansion to 80% confluency or for up to 2 additional passages.

Transduction of BV-2 cells with inflammasome indicator retroviruses

23. One day before transduction, take the calculated number of T-75 flasks containing BV-2 cells from Step 21 or after a repeat splitting (Step 22) out of the tissue culture incubator.

24. Remove medium with a pipette and wash cells with 5 mL of sterile PBS-CMF at room temperature.

25. Remove the PBS-CMF wash fluid and add 2 mL of 0.25% trypsin/EDTA. Allow 2–5 min for cells to detach.

26. Add 6 mL of BV-2 DMEM medium to the T-75 flask to dilute and deactivate trypsin.

27. Gently agitate the cell suspension.

28. Aliquot 20 μL of the cell suspension into 1.5 mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells (trypan blue excluding) using a hemocytometer or automated cell counter.

29. Coat the bottom of each well of a 6-well tissue culture plates with 500 μL of poly-L-lysine (0.1 mg/mL) for 30 min at 37°C. After incubation, aspirate and wash wells with sterile water. Allow the wells to dry before plating of the BV-2 cells.

If using poly-D-lysine, the concentration, volume, and incubation conditions are the same as for poly-L-lysine; however, ensure that the plates remain wet to prevent drying of the substance on the well, thus allowing for release into medium.

30. Based on cell counts (Step 28), add BV-2 DMEM growth medium (without antibiotics) to obtain a cell suspension to plate 3 mL of BV-2 cells at a density of 50,000 cells/well in the coated 6-well tissue culture plates. Allow cells to adhere to plate for ~18 h in a tissue culture incubator.

This will generate approximately three to four 6-well plates. Any excess can be used for other studies or frozen for storage in the cryofreezer. It is critical to have medium without antibiotics at this step.

31. Calculate the amount of virus to use for a multiplicity of infection (MOI) of 5 (MOI=5). To do this, use the following formula:

(Cell number at the time of transduction) x (MOI=5) / (sample titer in TU/mL) = volume of virus

32. Place ASC-Cerulean retroviral aliquots (from Basic Protocol 1) on ice to defrost.

33. Add the calculated amount of virus to each well.

It is recommended to transduce BV-2 cells seeded in the 6-well plate (Step 30) using a MOI of 5 and 10. Transfected BV-2 cells lose their inflammasome indicators within 1–2 weeks following transduction. Infect multiple 6-wells if large number of cells are needed for the specific experimental design.

34. At 24 h after transduction, confirm the diffuse fluorescence of ASC-Cerulean in the BV-2 cells using an inverted fluorescent microscopy equipped with the appropriate filter for Cerulean.

While not as sensitive, FITC filters will also detect the Cerulean signal.

35. In wells showing fluorescence, replace medium with 2 mL of fresh BV-2 DMEM growth medium.

36. Replace BV-2-ASC-Cerulean cells into tissue culture incubator and allow cells to grow to 80% confluency in the 6-well plates.

37. Identify wells of BV-2-ASC-Cerulean cells that show similar MOIs.

38. Gently add 1 mL of PBS-CMF to wash the wells of BV-2-ASC-Cerulean positive cells identified in Step 37. Remove PBS-CMF and add 250 μL 2.5% trypsin/EDTA for 2–3 min.

39. Terminate the trypsinization with the addition of 1 mL BV-2 DMEM growth medium.

40. Pools cell suspension from the positive wells and transfer to a T-75 flask with sufficient BV-2 DMEM growth medium for a final volume of 15 mL. Do not pool cells from wells with different MOIs.

41. Place the BV-2-ASC-Cerulean cells in the tissue culture incubator and allow them to propagate as polyclonal cell lines reaching 80% confluency in the T-75 flask

Freezing of BV-2 -ASC-Cerulean cells

42. Remove medium from the T-75 flask of BV-2-ASC-Cerulean cells .

43. Wash BV-2-ASC-Cerulean cells with 10 mL PBS-CMF.

44. Remove the PBS-CMF and add 2 mL of trypsin-EDTA (0.25%) and allow cells to detach over 2–5 min at 37°C.

45. Add 8 mL of BV-2 DMEM growth medium to the flask to neutralize the trypsin/EDTA.

46. Remove cell suspension and place into a 15-mL conical Falcon tube.

47. Triturate cells to disperse to single cells by pipetting up and down multiple times with a 10-mL pipette.

48. Aliquot 20 μL of the cell suspension into a 1.5 mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells (excluding trypan blue) using a hemocytometer or automated cell counter.

49. Centrifuge cells at 100 x g for 5 min at room temperature.

50. Resuspend cells in a volume of DMEM medium supplemented with 20%FBS, 5%DMSO, 1% penicillin/streptomycin to get 500,000 live cells/mL in DMEM medium

51. Aliquot 1 mL of cell suspension into 1.5-mL cryovials (screw cap and O-ring). Prepare 5–10 vials of cells for cryo-storage.

52. Store samples overnight at −80°C inside a Styrofoam container to achieve a slow freezing rate.

53. Transfer vials to liquid nitrogen cryofreezer for long term storage.

Basic Protocol 3. PRIMING AND ACTIVATION OF BV-2-ASC-CERULEAN CELLS FOR INFLAMMASOME ACTIVATION ASSAY

Once the BV-2-ASC-Cerulean cells are generated (Basic Protocol 2), they can be used to assess a functional neuroinflammatory-related response of inflammasome activation. Activation of the inflammasome is a two-step signaling process that requires the cells to receive a signal that shifts the baseline status of the cells and is, thus, labelled “priming” (Broz & Dixit, 2016). The priming step typically involves an NF-κB-dependent upregulation of cellular NLRP3, pro-IL-1β transcription, and de novo protein synthesis upon recognition of pro-inflammatory stimuli and Toll like Receptor (TLR) activation (Bauernfeind et al. 2009; Franchi et al., 2009; Groslambert & Py, 2018). This step elevates the expression levels of the inflammasome component with a tight regulation of the protein modification. The priming step is considered as a form of necessary regulation that serves to prevent unwanted activation. Once primed, the cell remains in an auto-repressed but signal-sensitive state. The second signal serves to trigger the activation of the inflammasome. NLRP3 inflammasome can sense a variety of exogenous PAMPs and endogenous DAMPs (Swanson et al., 2019). The activation step induces post-translational modifications of the primed sensor that allows for a de-repressed conformational change allowing for inflammasome aggregation. This protocol describes the two-step activation process. For the first step, we use lipopolysaccharide (LPS) for priming, the BV-2-ASC-Cerulean cells, and for the second step of triggering inflammasome activation, we use ATP. The protocol also details the functional readout of this activation with the formation of ASC protein aggregates, the ASC specks. In naive cells, ASC remains localized to the cytoplasm and nucleus of cells. With inflammasome activation, one large ASC speck (~1–2 μm in diameter) assembles in the paranuclear area of the cell. The presence of only one large ASC speck generated within any one cell serves as an effective readout of inflammasome activation upstream of caspase 1 and secretion of IL-1β (Stutz et al., 2013). In this protocol, we describe the generation and use of BV-2-ASC-Cerulean cells in an inflammasome activation assay to generate ASC speck formation for real-time imaging quantitation.

Materials

BV-2-ASC-Cerulean cells from Basic Protocol 2 (store in vapor zone of liquid nitrogen cryofreezer).

Virus obtained in Basic Protocol 1.

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 11965–118 Gibco, containing 25mM glucose, 4 mM L-glutamine, phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C).

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 31053028 Gibco, containing 25mM glucose, no L-glutamine, no phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C).

BV-2 DMEM growth medium (see Reagents and Solutions)

BV-2 DMEM growth medium, no phenol red (see Reagents and Solutions)

L-Glutamine (#25030081 Thermo Fisher Scientific) (store at −20°C)

Ethanol (70% v/v)

Fetal Bovine Serum (FBS; #100–106 0.5 endotoxin units (EU)/mL; Gemini Bio-Products, Sacramento, CA). (store at −20°C)

Penicillin/streptomycin 10,000 units penicillin and 10 mg streptomycin/ml (#P0781, Sigma-Aldrich, Millipore Sigma) (store at −20°C for long term; 4°C for several months).

Adenosine 5’-triphosphate (ATP) disodium salt hydrate (CAS# 34369-07-8; #A1852, SigmaAldrich)

Store at either −20°C or −80°C in aqueous solution - freeze quickly in liquid nitrogen to avoid transition temperature.

Lipopolysaccharide (LPS) Escherichia coli O111:B4 (Standard Catalog # 201; Ultrapure Catalog # 421; List Biological Laboratories, INC) (See Commentary – Critical parameters for note regarding purity of LPS). (store at −20°C for long-term)

Phosphate buffered saline (PBS-CMF), no calcium, no magnesium 1x (#14190144 Gibco, ThermoFisher) (store at room temperature)

Trypan blue (CAS # 72-57-1; #T8154, Millipore Sigma) (store at room temperature)

96-well flat-bottom, black-walled optical tissue culture plates (#165305 Thermo-Fisher)

15-mL screw top conical centrifuge tubes (Falcon or equivalent)

0.22-μm pore size filter

10-mL serological pipettes

Sterile filter micropipette tips (10 μL, 100 μL, 1 mL)

Pipette (20 μL,100 μL and 1 mL capacity)

pH instrument (or pH paper for pH 7.4)

Inverted binocular tissue-culture microscope

Fluorescent inverted microscope with filters for CFP (Cerulean ) or FITC and 10x and 20x objectives

−20°C freezer

4°C refrigerator

Centrifuge with rotor for 15-ml Falcon tubes at a speed of 1200 rpm

Water bath (37°C)

Tissue culture incubator (37°C, 90% humidity, 5% CO₂ preferred)

Laminar flow hood

Hemocytometer, Nexcelom automated cell counter, or equivalent

Liquid nitrogen cryofreezer for cell storage

In all cases, store frozen reagents and cells in single use aliquots and minimize freeze-thaw cycles.

Protocol Steps

Thawing and Culturing BV-2-ASC-Cerulean cells

1. Warm BV-2 DMEM growth medium to 37°C

2. Fill a 50-100-mL beaker with ~40 – 50 mL of sterile distilled water and place in 37°C water bath or temperature regulated oven.

3. Add 10 mL of warm BV-2 DMEM growth medium to 15-ml conical Falcon tube.

Ensure that medium is at 37°C and equilibrated to oxygen conditions prior to placing cells into flask.

The medium volume in a T-75 flask needs to be sufficient to properly cover the cells to allow for nutrients, but not to enter the neck of the flask.

For cost considerations, FBS at endotoxin levels < 20 EU can be used for cell expansion. Glutamax^TM can be substituted for glutamine.

5. Remove the vial of BV-2-ASC-Cerulean cells from the liquid nitrogen cyrofreezer and place in the 50-100-mL beaker with warm sterile water from Step 1. Swirl gently until cells start to unfreeze.

Do not allow cells an extended period to thaw or to remain unfrozen.

6. As soon as cells thaw, transfer cells by pipette to the 15-mL conical Falcon tube containing the warm BV-2 DMEM growth medium from Step 3.

7. Centrifuge at 1200 rpm for 5 min at room temperature.

8. Pipette off the supernatant ensuring that you do not disturb the cell pellet.

9. Re-suspend pellet in 1 mL of fresh warm BV-2 DMEM growth medium (without phenol red) using gentle up and down pipetting.

10. Aliquot 20 μL of the resuspended cells into a 1.5-mL microcentrifuge tube and add 5 μL of trypan blue. Count the number of live cells (cells excluding trypan blue stain) using a hemocytometer or automated cell counter.

12. Calculate the volume of warm BV-2 DMEM growth medium (without phenol red and without antibiotics) to add to allow for plating of cells at a concentration of ~10,000 cells per 100 μL.

Phenol Red is a pH indicator, and it can be excited at 440 nM. It is thus excluded as it can generate significant background with imaging in the FITC channel for fluorescein and compromise the imaging.

13. Gently agitate the 15-mL conical tube containing the BV-2-ASC-Cerulean cells to maintain a uniform distribution of cells.

14. Plate the BV-2-ASC-Cerulean cell suspension into individual wells of a 96-well flat-bottom, black-walled tissue culture plate at a plating density of ~10,000 cells per well (~32,500 cells/cm2) in a volume of 100 μL BV-2 DMEM growth medium (phenol red free) per well.

15. Place plates of BV-2-ASC-Cerulean cells into the tissue culture incubator at 37°C, 5% CO₂, 90% humidity (preferably a tri-gas incubator).

16. Allow BV-2-ASC-Cerulean cells a minimum of 12 h but no more than 24 h to adhere to plate.

This interval allows cells to recover from cell suspension manipulation and acclimate to plating conditions. Minimize opening of the incubator, to maintain oxygen level. The well surface area of a 96-well plate is 0.32cm².

17. Remove plate of BV-2-ASC-Cerulean cells from the tissue culture incubator and quickly confirm the presence of a diffuse fluorescent staining in cells under a tissue culture appropriate inverted fluorescent microscope using filters for FITC or Cerulean.

The naïve cells should display a pattern similar to that observed with LPS alone (Fig. 2A).

Figure 2. Representative images of ASC expression in BV-2-ASC-Cerulean cells.

A. Representative image of the diffuse fluorescent Cerulean signal that is observed with LPS priming alone. Note the presence of a few specks (arrow). B. Image of ASC pecks (arrow) in BV-2-ASC-Cerulean cells primed with LPS and activated with ATP. ASC specks display as fluorescent dense, collapsed aggregates. Images were captures using an IncuCyte S3 live-cell imaging system. Quantitation of ASC specks is inserted at the top of each representation image (mean +/− SEM).

18. If the BV-2-ASC-Cerulean cells do not show a diffuse fluorescence staining, repeat transfection of cells as described in Basic Protocol 2 Steps 31–34 at a multiplicity of infection of 5 .

19. Confirm diffuse fluorescent signal in cells as per Step 17.

Priming of BV-2-ASC-Cerulean cells

20. Dilute ultra-pure LPS stock in PBS-CMF (vol of PBS-CMF determined for final dosing concentration of 33 ng/mL per well with the addition of 10 μL of the working concentration of LPS) and vortex for at least 2 min immediately prior to dosing. DO NOT dilute in medium.

Preparation and dilution of LPS should be done using PBS-CMF rather than with medium containing serum to minimize the potential binding to medium/serum proteins.

The low concentration of LPS used as a priming signal is intended to induce an elevation in TNFα mRNA but not result in the formation and release of TNFα protein. This maintains the nature of the priming signal.

21. Add 10 μL PBS-CMF to generate wells of non-primed cells.

22. Add 10 μL of the working concentration of ultra-pure LPS to generate wells of primed cells.

The generation and distribution of primed versus non-primed cells is dependent upon the specific experimental design but normally follows an equal distribution across the plate.

23. Return cells to tissue culture incubator for 3h.

Inflammasome activation by ATP

24. After the BV-2-ASC-Cerulean cells have been exposed to LPS for 3 h in the tissue culture incubator (Step 23), remove cells from the incubator and quickly confirm general cell density by visual inspection under a microscope.

The confluency of the cells is an important factor for accurate assessment of induced ASC speck formation. ASC speck formation in the cells is influenced by cell-cell contact and, thus, the plating density of the BV-2-ASC-Cerulean cells has been empirically determined for imaging of ASC speck formation. An overgrowth of the cells observed as crowding on top of each other or clumping can induce ASC speck formation The recommended plating density should be optimized for this; however, if for any reason the cells show a >80% confluency or <50% confluency, additional optimization may be required.

25. As the secondary step in the activation process (“triggering”), add 5 μL of ATP (5 mM) for activation or 5 μL PBS-CMF as non-activation to BV-2-ASC-Cerulean cells. Equally distribute this to the non-primed and the primed BV-2-ASC-Cerulean cells.

The ATP exposure serves as a positive control for the activation and generation of ASP specks and confirms the responsivity of the cells and the priming by LPS. The distribution of dose conditions across wells is dependent upon the experimental design but, as a general rule, there is an equal distribution of the conditions. This represents an experimental design with factors of primed (LPS) vs non primed and triggered (ATP) vs non triggered.

See Understanding Results for a discussion of sample data.

Basic Protocol 4: EXAMINING MODIFICATIONS TO INFLAMMASOME ACTIVATION BY TEST SUBSTANCES

The inflammasome serves as a key sensor and effector of inflammation, representing a mechanism by which the organism can mount rapid and strong immune defenses (Franchi et al., 2009; Ghiringhelli et al., 2009; Gross et al., 2011). With activation, inflammasomes function to facilitate a host response to infiltrating factors and contribute to cellular processes associated with wound healing. This occurs through the release of inflammatory cytokines and the induction of pyroptotic cell death. It is critical that these events remain within the realm of injury while allowing for robust immune responses. This requires a system that is tightly regulated to allow for activation but also to ensure a limited amount of collateral damage. Dysregulation of the inflammasome can result in aberrant or excessive stimulation, contributing to pathologies related to auto-inflammatory conditions, cancer, cardiometabolic disorders, and neurodegenerative diseases (Anderson et al., 2022; Blevins et al., 2022; Boxberger et al., 2019; Holbrook et al., 2021). Thus, genetic or environmental conditions that stimulate, alter, or disrupt inflammasome activation can have significant effects upon the organism.

In this protocol, we outline steps to use the BV-2 ASC-Cerulean cells to examine how exposures might influence inflammasome activation. The protocol follows the steps of the prior protocol (Basic Protocol 3) outlining the plating, priming, and activating BV2 ASC-Cerulean cells. Additions or modifications are described and cited to the specific step of the Basic Protocol 3 to perform two types of experiments, to examine 1) the effect of an exposure on the normal inflammasome priming/activation process; or 2) the ability of an exposure to serve as an activating signal. As with any assay, the investigator should have a level of expertise with the basic cell line and the test agent prior to assessing inflammasome activation using the current protocol. Thus, the stated criteria of cell plating density and cell viability for this protocol is required to be maintained for any experimental manipulation. That means that the experimental exposure is at a dose level that does not induce BV-2 cell death during the exposure time of the assay.

Materials

BV-2-ASC-Cerulean cells from Basic Protocol 2

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 11965–118 Gibco, containing 25mM glucose, 4 mM L-glutamine, phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C)

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (#31053028 Gibco, containing 25 mM glucose, no L-glutamine, no phenol red, no HEPES and no sodium pyruvate; Thermo Fisher Scientific) (store at 4°C)

L-Glutamine (#25030081 Thermo Fisher Scientific) (store at −20°C)

Fetal Bovine Serum (FBS; #100–106 0.5 endotoxin units (EU)/mL; Gemini Bio-Products, Sacramento, CA). (store at −20°C)

Penicillin/streptomycin 10,000 units penicillin and 10 mg streptomycin/ml (#P0781, Sigma-Aldrich, Millipore Sigma) (store at −20°C for long term; 4°C for several months)

Test substance – filtered through 0.22 μM filter for sterilization. (Stored as recommended by supplier)

Test substance vehicle - filtered through 0.22 μM filter for sterilization

Adenosine 5’-triphosphate (ATP) disodium salt hydrate (CAS# 34369-07-8; #A1852, SigmaAldrich) (Store at either −20°C or −80°C in aqueous solution - freeze quickly in liquid nitrogen to avoid transition temperature)

Apyrase (recombinant, E. coli, #M0398, New England, BioLabs (store powder or resuspension at −20°C; resuspended for short term use 4°C)

Lipopolysaccharide (LPS) Escherichia coli O111:B4 (Standard Catalog # 201; Ultrapure Catalog # 421; List Biological Laboratories, INC) (See Commentary – Critical Parameters for note regarding purity of LPS). (store at −20°C for long-term)

Phosphate buffered saline (PBS-CMF), no calcium, no magnesium 1x (#14190144 Gibco, ThermoFisher) (store at room temperature) (see Reagents and Solutions)

0.22-μm pore size filter

Sterile filter micropipette tips (10 μL)

Pipette (20 μL capacity)

pH instrument (or pH paper for pH 7.4)

Inverted binocular tissue-culture microscope

Epi-fluorescent inverted microscope with filters for CFP or FITC and 10x and 20x objectives

−20°C freezer

4°C refrigerator

Tissue culture incubator (37°C, 90% humidity, 5% CO₂)

Laminar flow hood

In all cases, store frozen reagents and cells in single use aliquots and minimize freeze-thaw cycles.

All reagents and solutions used to generate and culture the cells are sterile.

Protocol Steps

Experimental compound as an activating signal

1. Design the plate map and assign experimental conditions of LPS primed and non-primed for wells.

2. Follow steps 1 through 23 of Basic Protocol 3 for plating and priming the BV2-ASC-Cerulean cells with LPS.

3. After the BV-2-ASC-Cerulean cells have been exposed to LPS for 3 h in the tissue culture incubator, remove cells from the incubator and quickly confirm general cell density by visual inspection under a microscope.

4. Dose each well, primed and non-primed, with 10 μL of either PBS-CMF or apyrase (5 U/mL).

Standard design would be an equal number of wells [primed vs non primed] per condition [apyrase vs PBS-CMF].

5. Return cells to incubator for 1 h

Apyrase is an enzyme that converts ATP to ADP and will serve to eliminate extracellular ATP and purinergic receptor activation, thus, experimentally controlling for the influence of ATP released by dying cells.

The comparison of ASC speck data obtained from the cells with and without apyrase allows for the identification of direct inflammasome activation rather than secondary due to cell death and the release of ATP.

6. Into individual pre-determined wells, add 5 μL ATP (5 mM) as positive control for inflammasome activation, 5 μL PBS-CMF as non-activation, 5 μL of test substance (one or multiple doses per experimental design), or 5 μL of test substance vehicle if it is other than PBS-CMF or BV-2 DMEM growth medium, to BV-2-ASC-Cerulean cells. Equally distribute this to the non-primed and the primed BV-2-ASC-Cerulean cells.

Standard practice would be to equally distribute the wells for vehicle and chemical including multiple dose levels.

ATP servs as an assay positive control for activation and the data is not included in the statistical analysis. The number of sample wells ATP can be limited to 3.

7. Proceed according to Basic Protocol 5 for image capture over the next 12–16 h.

Experimental compound as a modifier of inflammasome activation

8. Follow Steps 1 through 19 of Basic Protocol 3 for plating of BV2 ASC-Cerulean cells.

2. Remove BV-2-ASC-Cerulean cells from the incubator

3. Add 10 μL test substance vehicle to individual wells.

4. Add 10 μL test substance at pre-determined dose levels to individual wells.

If the vehicle for the test substance is not PBS-CMF or BV2 DMEM growth medium, assign additional wells and add 10 ul of BV2 DMEM growth medium to serve as a control to determine if the test substance vehicle has an effect on the cell response.

The generation and distribution of primed versus non-primed cells is dependent upon the specific experimental design but normally follows an equal distribution of test substance (and dose levels) and vehicle across the plate. Once it is confirmed that the test substance vehicle does not alter the cellular response, future experiments can decrease the number of wells required for controls.

5. Return the BV-2-ASC-Cerulean cells to tissue culture incubator for 18 h.

6. Proceed with Steps 20–25 of Basic Protocol 3 for priming and activation of cells for inflammasome activation with ATP.

7. Proceed according to Basic Protocol 5 for image capture over the next 3 h.

Basic Protocol 5: IMAGING AND ANALYSIS OF ASC SPECK FORMATION

Upon aggregation of the inflammasome complex, the fluorescent signal shifts from a diffuse cytoplasmic signal to a coalesced dense single aggregate. The large size of the ASC speck allows for its visualization by fluorescent microscopy, allowing for ASC speck formation to be effectively used as a hallmark or readout for inflammasome activation (Stutz et al., 2013). In the BV-2-ASC-Cerulean cells, the fluorescent signal shifts upon inflammasome activation from a weak diffuse signal that is present throughout the cytoplasm to one small bright spot that can be observed within an intact cell, attached to the cell membrane or released into the medium. The fluorescent specks can be visualized microscopically and quantified by image analysis with the use of thresholding algorithms (Stutz et al., 2013; Tweedell et al., 2020). This protocol outlines the steps for imaging and analyzing ASC speck formation using the inflammasome assay (Basic Protocols 3 and 4) in the BV-2-ASC-Cerulean cells generated in Basic Protocol 2.

Materials

Plates of BV-2-ASC-Cerulean cells obtained from Basic Protocol 3 or Basic Protocol 4

Live cell imaging system with fluorescent capabilities (IncucyteZOOM system, Essen Bioscience; or equivalent)

ImageJ/Fiji, freeware program available at https://imagej.net/Fiji (or equivalent)

Protocol Steps

1. Immediately following the addition of the activating agent (ATP or experimental test substance), place the cells obtained from Basic Protocol 3 or 4 in an IncuCyte S3 live-cell analysis system (10x or 20x objective) housed within a tissue culture incubator at 37°C.

This image capture system allows for examining the wells at multiple times. The 20x objective decreases field size but provides the image resolution suited for analysis of ASC specks using IncuCyte ZOOM analysis software. A 10x objective can be used for wider field of view, however, this wider field objective is not suitable for quantitation by the IncuCyte ZOOM analysis software and requires analysis of the tiff images using a secondary image analysis software such as Fuji Image J.

2. Set the software for fluorescence excitation: 441-481 nM/Emission 503-544 nM.

The FITC wave band available on the IncuCyte S3 system is excitation 441-481 nM/Emission 503-544 nM. For Cerulean, this is normally at a peak between Excitation 420 and 450 nM and Emission 460 and 520 nM. While one can detect a Cerulean signal using the FITC wave band, subtle quantitative differences may be missed. For this reason, one needs to consider that the assay is designed to determine the relative level of activation and not to quantitate a small % difference in the number of ASC specks formed. Alternatively, if needed, one could take the plate to a fluorescent microscope with the appropriate wavelength filter for image capture.

3. Capture images from each well every 15 min for up to 60 min followed by image capture every hour for 12 h using IncuCyte ZOOM capture software.

With a 96-well plate, the IncuCyte S3 system allows capture of the center of each well.

The capture of images at shorter intervals for a 96-well plate and over a 12 h period can lead to an overheating of the instrument and a shut-down of the program.

4. Transfer the tiff images captured at 30 min, 1h, and 3h following ATP to an image analysis software program (e.g., Fiji Image J or Incucyte Cell-by-Cell Analysis software module).

As an activating agent to primed cells, ATP (5 mM) will normally induce ASC speck formation within the first 30 – 60 min (Fig. 2B but may require up to 2 h). ATP induces a strong inflammasome-dependent pyroptosis (a form of programmed cell death primarily observed in inflammatory cells such as microglia, that is triggered by proinflammatory signals associated with inflammation). In non-primed cells, with and without an ATP activating trigger, ASC fluorescent signal is diffuse throughout the cell. It is expected that >20% of the cells will show ASC speck formation within primed/activated cells. An absence of ASC speck formation in the LPS primed and ATP triggered cells suggests that fresh solutions of LPS and ATP are required or that an earlier passage of the cells are required.

5. Visually examine the images captured for cells that did not receive ATP at 30 min, 1 h, 6 h, 12 h.

6. Transfer the tiff images of cells that did not receive ATP captured at 6 h and 12 h for software analysis.

7. Correct images for background illumination and threshold based on contrast or apply segmentation mask as required by software (Fiji Image J or Cell-by-Cell analysis of the IncuCyte analysis software).

8. Determine the number of fluorescent ASC specks present within the image for each well.

In LPS primed and ATP activated cells, dense fluorescent aggregates are observed within the BV-2-ASC-Cerulean cell, attached to a cell membrane and within the extracellular space (see Fig. 2B)

Depending on the software used, one may be required to identify a specific region of interest (ROI) for analysis. It is recommended that at least one ROI is in the center of the well. This serves to minimize the background fluorescent signal that can be observed need the walls of the well.

9. Use the Cell-by-Cell analysis of the IncuCyte analysis software to calculate cell number using phase-image segmentation and calculate fragment number (ASC specks) by fluorescent fragments as described by the software program.

A “blended” phase contrast/fluorescent image analysis can identify the number of ASC specks within the cells, allowing for a comparison of internal versus released. In addition, segmentation masks can be used to determine size of item and fluorescent intensity to estimate if examining multiple cells.

10. Record any wells that show a visible difference in confluency (<50 or >80% confluency).

Greater than 80% confluency in the area of image analysis may result in clustering of cells and grouping of ASC specks. Less than 50% confluency in the area of image analysis may result in sparce numbers of ASC specks. If the individual wells vary greatly, this could influence the variance across conditions for ASC specks counts.

11. Use the number of ASC specks as the endpoint for statistical analysis.

The presence of ASC specks is recorded as an indicator of inflammasome activation.

In experimental conditions testing the effects of a test substance (Basic Protocol 4) and where LPS or ATP serve as an assay positive control, this data is not included in the overall statistical analysis examining the effects of the test substance.

In experimental conditions examining the effects of a test substance (Basic Protocol 4), the first comparison is to determine if the test substance vehicle alone produced an effect on the response measured. The overall statistical analysis would include data from the test substance vehicle and the test substance.

See Understanding Results for a discussion.

REAGENTS AND SOLUTIONS

All solutions should be sterile for use with cells. All solution should be warmed to ~37°C prior to use on cells.

Phosphate buffered saline - calcium, magnesium free (PBS-CMF) (1X) (alternative to purchase)

0.2g potassium chloride (KCl) (CAS #7747-40-7, #P3911 or #P5404 Sigma-Aldrich, Millipore Sigma)

8 gm sodium chloride (NaCl) (CAS #7647-14-5; 5988 Sigma-Aldrich; Sigma-Aldrich)

0.24g potassium phosphate monobasic (KH2PO4) (CAS #778-77-0, MWt 136.086; #P0662 or P5655; Sigma-Aldrich, Millipore Sigma)

1.44 g sodium phosphate dibasic (Na2HPO4) (CAS #7558-79-4, MWt 141.96; #424375000, ThermoFisher Scientific)

800 mL dH2O

Adjust pH to 7.4 with HCL

add dH2O to 1 L

Aliquot into working volumes

Sterilize with autoclaving for 20 min at 15 psi (1.05 kg/cm²) or by filter.

Store at room temperature

HEK293T DMEM growth medium

Dulbecco’s Modified Eagle Medium (DMEM) high glucose, pyruvate (#11995-065 Gibco,

25mM glucose

4 mM L-glutamine

1 mM sodium pyruvate,

phenol red

10% heat inactivated fetal bovine serum (FBS, Avantor Seradigm)

(store at 4°C)

BV-2 DMEM growth medium

Dulbecco’s Modified Eagle Medium (DMEM), high glucose (# 11965–118 Gibco containing 25mM glucose, 4 mM L-glutamine, phenol red, no HEPES, no sodium pyruvate)

10% low endotoxin Fetal Bovine Serum (FBS; #100–106 0.25 endotoxin units (EU)/mL; Gemini Bio-Products)

1% penicillin/streptomycin

(store at 4°C)

BV-2 DMEM growth medium (no phenol red)

Dulbecco’s Modified Eagle Medium (DMEM) containing high glucose (25mM) no L-glutamine, no phenol red, no HEPES, no sodium pyruvate) (# 31053028; Gibco, ThermoFisher)

10% low endotoxin Fetal Bovine Serum (FBS; #100–106 0.25 endotoxin units (EU)/mL; Gemini Bio-Products)

4 mM L-glutamine (or GlutaMax™)

1% penicillin/streptomycin (with or without penicillin as per protocol)

(store at 4°C)

TNE buffer

50mM Tris-HCL pH 7.4

100 mM NaCl

5 nM EDTA (ethylenediaminetraacetic acid in sterile water)

Filter through a 0.22 μm pore size filter

20% sucrose /TNE buffer solution (w/v)

20 grams of dextrose (tissue culture grade)

Add 100 mL TNE buffer

Filter through a 0.22 μm pore size filter

COMMENTARY

Background Information

The interest in inflammasome activation has expanded over the last few years, as evidenced by the increase in the number of publications examining the role in inflammatory related diseases (Man & Kanneganti, 2015; Yang et al., 2019). There are various ways to examine the response, including assessment of the released IL-1 family of proteins and evaluation of the increase in the expression of ASC. There are multiple inflammasome related “families” that are segregated based upon the priming and activating stimuli, and the methods used for assessing each of these have been recently provided in a protocol publication by Guo and Ting (2020). This protocol focuses primarily on non-neural cells but provides a solid framework for translation to other cell types and for the various inflammasomes. In 2013, Stutz et al (2013) provided a protocol for the generation of a clonal inflammasome reporter macrophage cell line that overexpressed the fluorescently tagged ASC. Within this protocol, the cells are also modified to be somewhat “self-primed”, to allow for examination of the induction of the inflammasome activation. In the current protocol, we modified the Stutz et al (2013) protocol to generate an inflammasome reporter microglia cell line that was not “self-primed”. Using this cell line, we can examine modifications to the normal response at all stages, priming and activation. The current protocol reflects the modifications we made to the existing protocols for peripheral macrophages to facilitate the generation and imaging of microglia for ASC speck formation. While examining inflammasome activation is well established in the basic biology literature, the inclusion of such examination within the neurotoxicology research arena is relatively recent and, with a few exceptions, has not relied on real-time image analysis. This protocol provides the reader with the methods to generate and maintain a reporter cell line for a well-established murine microglia cell and the details of how to examine, in real-time, the aggregation of ASC specks. It utilizes retroviruses as robust vectors for gene delivery and integration of genetic material into the host chromosomes, with cell division creating stable cell lines. It includes consideration of extracellular released ATP and the treatment with apyrase to address this issue. In addition, the protocol outlines two different approaches for examining the effects of a test substance, modifying a normal NLRP3 inflammasome activation or serving as an activating agent. It also allows for additional experimental designs to examine the ability of a test substance to serve as a priming agent or potentially to block ATP induced activation.

The imaging of ASC specks offers a way to identify the relevant cellular responses. If one wishes to expand the assessment to include biochemical or immunocytochemical analysis, the following points should be considered. For the protein analysis of IL-1β or IL-18, standard ELISAs can detect protein levels from cell lysate or medium but cannot distinguish between the pro and mature forms of IL-1 β or IL-18. This distinction between the protein forms of different molecular weights requires western blot analysis. Both forms of the proteins are released by the cells and, thus, examination of protein in the cell lysate and the medium are recommended. The comparison of the two forms of the protein relative to the total allows for quantitation of the molecular weight bands within each individual well. Western blots require the absence of FBS in the assay medium. For BV-2 cells, the small amount of protein released requires efforts to concentrate the protein in the medium during collection and the use of a sensitive IRDye® detected using a Li-Cor Odyssey Imaging system (Li-Cor, Lincoln, NE) for accurate detection. Another method that has been used, is immunocytochemistry for the ASC specks. With this procedure, however, ASC specks that are released into the medium will not be captured. While each of these methods offer a level of confirmation of the real-time imaging, they are not conducive to a screening approach. Using the real-time imaging of ASC speck formation, one can identify relevant exposure level and time as well as effects within the stages of inflammasome activation that can then be used as the base to explore the underlying mechanism of the inflammasome activation (Yang et al., 2019; Zheng et al., 2020).

Critical Parameters

There are specific steps where the growth medium cannot contain antibiotics. Those specific culture conditions are indicated in the protocol.

Cells transduced with inflammasome indicator ASC-Cerulean lose expression or stop responding to stimuli after several passages. For this reason, it is important to expand and freeze several aliquots immediately after transduction and discard defrosted cells after ~3 passages. If the schedule permits, use of the cells immediately after transduction is the most reliable method. If cells are thawed for expansion and plating, one may consider directly plating these cells in the assay plate rather than undergoing an expansion and passage. If the naive cells display a reproducible diffuse labelling of cells, then the cells are suitable for the inflammasome activation assay. If this fluorescent signal is not present, the protocol includes a step for a 2^nd booster transfection that should result in the diffuse signal in naïve cells.

Selection of BV-2-ASC-Cerulean cells can be based on levels of fluorescence. Cells that express a high level of fluorescence can self-induce an ASC speck formation. Cells that express a weak level of fluorescence form very small sized ASC specks that can be difficult to detect in automated systems but can be identified manually. The preferred level of fluorescence is in the medium/high level, to provide the optimal signal-to-noise ratio.

In Basic Protocol 2, the low endotoxin level (<20EU) for the FBS is required to ensure that the endotoxin levels do not interfere with the transfection.

In Basic Protocol 3, the low endotoxin level (optimal ~0.5 EU) of the FBS is critical for culturing quiescent cells. This ensures low-to-non-detectable mRNA levels for TNFα, minimizing any contribution to the actions of the priming stimulus.

The expression of ASC mCerulean in the BV-2 cells and the induction of ASC speck formation can result in fragile cells. This fact needs to be taken into consideration if any additional sampling is to be taken from the cells (e.g., fixation and staining, harvesting for biochemical analysis). It should also be considered with any medium changes or washes during the culturing and assay.

If BV-2 cells or BV-2-ASC-Cerulean cells begin to display a shift in morphology that is characterized by very small, rounded cells, discard and defrost an earlier passage. This requires knowledge of the BV-2 cell morphology in general.

It is recommended that the exposure concentration of the chemical is one that does not result in the production of TNFα by BV-2 cells, as recombinant TNFα (100 ng/mL for 6 h) can serve as a priming agent.

The use of LPS as a priming signal requires consideration of the purity of the compound (Parusel et al., 2017). Different species express different LPS with different bioactivity, and the various commercial sources for LPS differ in purity. Standard or crude LPS contains other components of Gram-negative bacteria, such as peptidoglycans or lipopeptides, that can initiate a mixed and non-standardized immune response via activation of both TLR2- and TLR4-dependent signaling. Ultrapure LPS is essentially free from contaminants such as components of the gram-negative cell wall other than LPS, and activates TLR4-dependent signaling (Parusel et al., 2017). Activity of standard LPS can vary across sources and lots. Thus, any dosing concentrations should be based on endotoxin units rather than weight. For ultrapure LPS, dosing concentrations can be calculated based on weight.

For experiments to examine specificity of response in BV-2-ASC-Cerulean cells, the cells can be primed using different pattern recognition receptors (Swanson et al., 2019) and ASC speck formation examined.

The released ASC specks can float in the medium. The volume of 100 μL of medium in each well should be sufficient to allow for detection; however, additional optimization may be required to decrease the medium volume at the start of the experiment to facilitate location of specks within the plane of focus given that the IncuCyte does not collect z-stack images.

Troubleshooting

Please see Table 1 for a list of common problems with the protocols, their causes, and potential solutions. Many of these issues will resolve as the investigator becomes more familiar with the cells, the experimental manipulation, and the readout.

Table 1:

Troubleshooting

Problem	Possible Cause	Solution
low number of fluorescent cells after transduction	the amount of virus was too low	Check your calculation for accuracy
	retrovirus had low titer	see below
low titer for the retrovirus	plasmid concentrations/integrity	Check for accuracy of plasmid concentrations; Plasmid integrity can be tested by restriction enzyme digestion and fragment sizes by agarose gel electrophoresis
	lost/damaged pellet	Handle ultracentrifuge tubes gently to avoid dislodging the pellet; avoid drying the retroviral pellet
	Excess freeze/thaw cycles	avoid freeze-thawing retroviral aliquots
Cells form specks (>50 per well) without manipulation.	The endotoxin level in the FBS may be too high The medium conditions are not sterile The cells may be dying and, in the process, they prime the surrounding microglia which respond with the ATP release or other DAMPs	Confirm a low endotoxin level of the FBS from the lot number and quantitated data provided in the material data sheet. Ensure sterile techniques and sterile reagents and solutions. If driven by over-grown cell density, use a lower initial cell plating density.
Cells form specks with only LPS	Endotoxin level of LPS may be too high A low-level contamination occurred that resulted in an additional stimulus to the cells.	Confirm dose of LPS. If using standard LPS, confirm the dose used by endotoxin units and not weight. Confirm sterility of the culture and reagents
Bright diffuse fluorescent signal across plate	Fluorescent signal pollution in wells Possible use of incorrect cell culture plates	Use recommended black walled optical plates to minimize signal across wells Focus analysis to the center of the well to minimize influence of fluorescence feed-back from well wall.
No response in LPS-primed cells with ATP	ATP integrity compromised LPS integrity compromised Dosing concentrations incorrect	Confirm appropriate protocol for making up each solution, storage of each solution, freeze, thaw cycle, expiration date. Replace with fresh solutions

Prior to the start of any defined experiment, preliminary steps should be conducted to confirm the responsiveness of the specific naïve BV-2 cells to LPS and to confirm the recommended priming dose listed in the protocol. We have identified the dose level of LPS (33ng/mL) as the priming stimulus dose for BV-2 cells. This dose is lower than what is often used in peripheral macrophages. In our preliminary experiments, we confirmed that the dose level of LPS is effective in a low-level elevation in TNFα mRNA within 3 h (possibly by 2.5-fold) but does not result in a release of TNFα protein over the full 12 h of the assay. This response is normally evaluated in normal BV-2 cells and does not require the use of BV-2-Cerulean cells. If the specific lot of cells is highly stimulated with the priming dose of LPS sufficient to induce the release of TNFα protein, then a lower dose of LPS should be confirmed to maintain the criteria set for priming.

The LPS and ATP solutions can degrade over time in storage. It is advised to ensure that the solutions are aliquoted into single experiment/use size tubes and maintained in a laboratory appropriate freezer (this would be a freezer that is not self-defrosting). If the cells do not show a response to LPS priming followed by ATP activation, new solutions are required. It is very important that the steps taken for making the LPS solution are followed, including the vortex steps. These are normally provided by the commercial supplier but, in general, they require that the vehicle for the stock solution and the dosing solution is sterile PBS-CMF and not the medium or any high protein level solution. LPS can rapidly bind to proteins in the dose level concentrations and thus remove it from availability to the cells.

The culture conditions stated in this protocol, while restrictive, generally ensure that the culture of cells represents relatively quiescent cells. This is accomplished by two features. The first is the endotoxin level of the FBS. In our hands, microglia do not survive in a medium with a complete endotoxin free FBS. Rather, they appear to require some endotoxin stimulation for survival. The level of 0.5 EU was found to be optimal for BV-2 cells (and for primary rodent microglia) to provide a level of growth/survival stimulation yet to allow the cells to remain in a relatively quiescent state with undetectable levels of TNFα mRNA. The next culture condition of importance is maintaining the 5% CO₂ level within the incubator. To maintain the set level of CO₂, we recommend the use of a tri-gas tissue culture incubator (Triaud et al., 2003). This type of incubator will maintain a more constant CO₂ level, given the rapid recovery after each door opening. Microglia are reactive cells, and the fluctuation with door opening and recovery may lead to a more reactive phenotype. If a tri-gas incubator is not available, then ensuring that the cells are placed in a dedicated incubator with limited door opening is an option.

The IncuCyte imaging system allows for capture of phase contrast images as well as the fluorescent images. Even with the use of dark plates, however, a diffuse non-specific fluorescence can be observed around the perimeter of the well, which may compromise the image analysis. For this reason, it is recommended to focus the examination on the center of the well for analysis, and to apply a correction for background illumination and threshold the image based on contrast or apply segmentation mask as per the image analysis software used. Such adjustments may allow for the identification of the fluorescent ASC specks even within the diffuse background fluorescence.

As with any fluorescent signal dependent assay, it is critical to set criteria to distinguish ASC specks from artifactual fluorescent signal. This can be accomplished by empirically determining the size of the ASC speck and setting that as a criterion in sampling.

Understanding Results

Cells transduced with inflammasome indicators are identified under the microscope by their fluorescent moieties (Fig. 2). Prior to activation, fluorescence is diffused throughout naïve cells or cells primed with LPS, showing very few specks (<25 per well; Fig. 2A). With ATP as an activation stimulus, ASC specks will be observed within ~15 min, and the response can be robust, with evidence of specks within cells, attached to cell membrane, and released by cells (>500 per well; Fig. 2B). Activation with a sterile activation such as a test substance will be less that that seen with ATP and will likely take over 6 h (Guo & Ting, 2020). We have extended the image capture time to 12 – 16 h in the protocol to capture any response that may require a longer exposure period. We have found that extending past 12 h can become confounded due to either the expansion of these proliferative cells or the spontaneous cell death that can occur with extended time in culture. With an overgrowth of cell population, the ability to detect individual ASC specks becomes compromised and the overgrowth alone can induce spontaneous ASC specks. With prolonged exposure, if there is cell death, the release of factors can serve to stimulate speck formation.

Presentation of the results obtained in BV-2-ASC-Cerulean cells should include representative images of the ASC speck formation in 1) PBS-CMF or BV-2 DMEM growth medium controls that would be representative of any endogenous stimulation of ASC speck formation, 2) Cells that receive LPS as a priming factor with no other exposures should be included to show the baseline level of ASC speck formation that may occur with only the priming agent, 3) LPS primed cells activated with ATP. Presentation of results of test substance manipulation of inflammasome activation in BV-2 ASC should also include representative images of ASC speck formation in cells that received 1) test substance vehicle, 2) test substance, 3) apyrase pretreatment. For examples, see Fig. 2 and Fig. 3.

Figure 3. Representative example of quantitation of ASC Speck formation.

Data is shown at 6 and 16 hr in vehicle control cells and in cells exposed to LPS, or in non-LPS primed or LPS-primed cells exposed to each of the example chemicals (termed A, B, C) with and without the addition of apyrase to block the triggering effect of cell released ATP. Speck formation was not altered over the time interval 6 to 16 hr in cells exposed to vehicle. With only LPS exposure, there was a slight elevation at 16 hr that was marginally blocked by apyrase, suggesting a release of ATP from the cells with the extended LPS exposure. In non-LPS primed cells, exposure to each of the example chemicals did not result in ASC Speck formation. In LPS-primed cells: Chemical A - ASC Speck formation was induced and was not blocked by apyrase, suggesting an inflammasome activation in the absence of cell ATP release at 6 hr; however, the increase seen at 16 hr was blocked by apyrase, suggesting the later involvement of ATP release. The similar level seen with the apyrase treatment at 6 and 16 hr likely represents the inflammasome activation. For Chemical B, ASC Speck formation was induced and was substantially blocked by apyrase at 6 hr and this relative blockage was diminished at 16 hr, suggesting that the inflammasome activation required a longer time interval than 6 hrs but also that the cells released ATP. Chemical C showed no formation of ASC Specks in LPS-primed cells, suggesting the absence of inflammasome activation.

* - significant relative to Chemical alone. # significant relative to LPS+Chemical

When examining the effect of a test substance as outlined in Basic Protocol 4, the inclusion of either LPS as a positive priming control or ATP as a positive activator control serves to demonstrate the responsiveness of the cells. In these cases, these data serve as an assay control and are not included in the overall statistical analysis of the effects of a test substance. The data may help in understanding the level of induction within the framework of a positive biological response.

Data typically included in supplementary materials when publishing these assays include captured phase contrast images of cells prior to initiating the inflammasome assay and at the end of the assay, and supporting data to demonstrate that the dose level of a test substance did not initiate a direct pro-inflammatory response. The image should be matched to the wells that are presented in the representative images for the main text of the manuscript.

The statistical analysis of the data is dependent upon the experimental design and the research question. The first step is to graph the data on ASC speck number and query for homogeneity of variance using a statistical test e.g., Bartlett’s test for homogeneity. If the data does not meet criteria for use of a parametric test, then consider using a non-parametric test as appropriate to the experimental design or using transformed data (log or square-root) to meet criteria for use of a parametric test (e.g., Student’s t-test if comparing two groups, one way ANOVA if comparing multiple groups, multi-factor ANOVA is examining potential interactions between 2 or more conditions). If the ANOVA indicates a significant effect, then follow with an independent group means post-hoc test. Report the test used, the t or f value, the degrees of freedom, and the p value.

Time Considerations

Basic Protocol 1

Retroviral Production

Day 1. Split cells for transfection.

Day 2. Transfect cells.

Day3 . Change medium on transfected cells.

Day 4. Collect 48-h supernatant containing retroviruses and concentrate virus.

Day 5. Aliquot and freeze virus.

Titering retroviruses. Allow one week for completion and analysis of virus titer.

Basic Protocol 2

Within 24–48 h post infection, host cells will express the delivered genes.

Basic Protocol 3

Day 1. Thaw and plate BV2-ASC-Cerulean cells

Day 2. Prime BV2-ASC-Cerulean cells with LPS and activate inflammasome with ATP

Basic Protocol 4

Day 1. Expose BV2-ASC-Cerulean cells for 18 h prior to initiating day 2 of Basic Protocol 3

Basic Protocol 5

Day 1. Image the formation of ASC specks (up to 12 h)

Day 2–3. Image analysis of ASC speck number

DATA AVAILABILITY STATEMENT

The data that support the method are available from the corresponding author upon reasonable request.