Skip to main content
NCBI home page
Animal Nutrition logoLink to Animal Nutrition
. 2022 Aug 8;11:381–390. doi: 10.1016/j.aninu.2022.06.019

Isorhamnetin protects zearalenone-induced damage via the PI3K/Akt signaling pathway in porcine ovarian granulosa cells

Xiaoya Li a, Huali Chen b, Zelin Zhang a, Jiaxin Duan a, Rongmao Hua a, Xiaodi Li c, Li Yang a, Jianyong Cheng a, Qingwang Li a,∗
PMCID: PMC9618982  PMID: 36329687

Abstract

Zearalenone (ZEA) is widely derived from moldy cereal grain, which has adverse effects on animal reproduction. In particular, pigs are more sensitive to ZEA-induced toxicity than other animals. Isorhamnetin has extensive pharmacological activity. However, the role of isorhamnetin in ZEA-induced cytotoxicity remains unclear. This study was designed to investigate the therapeutic effect of isorhamnetin on ZEA-induced damage in porcine ovarian granulosa cells and elucidate its molecular mechanism. Two experiments were conducted, where a minimum of 3 biological replicates were used for each treatment. In Exp. 1, ovarian granulosa cells were treated with different concentrations of isorhamnetin (1, 5, 10, 20 and 30 μmol/L) and ZEA (0, 10, 30, 60, 90 and 120 μmol/L) for 24 h. Our results indicated that 60 μmol/L ZEA (half-maximal inhibitory concentration value) and 20 μmol/L isorhamnetin (the most effective concentration against ZEA-induced cytotoxicity) were optimum concentrations. In Exp. 2, ovarian granulosa cells were treated with isorhamnetin (20 μmol/L) for 2 h, before treatment with ZEA (60 μmol/L) for 24 h. Apoptosis, endoplasmic reticulum stress, oxidative stress, proliferation and hormone secretion of ovarian granulosa cells were detected. Our findings showed that isorhamnetin suppressed (P < 0.05) ZEA-induced apoptosis by altering mitochondrial membrane potential and apoptosis-related proteins (B-cell lymphoma-2 [Bcl-2], Bcl2-associated x [Bax] and cleaved caspase-3 [C-Casp3]). Changes in intracellular Ca2+ levels and C/EBP homologous protein (CHOP), recombinant activating transcription factor 6 (ATF6), glucose regulated protein78 kD (GRP78) indicated that isorhamnetin rescued (P < 0.05) ZEA-induced endoplasmic reticulum stress. Furthermore, isorhamnetin prevented (P < 0.05) ZEA-induced oxidative stress via the mitogen-activated protein kinase (P38) signaling pathway. Mechanistically, isorhamnetin stimulated (P < 0.05) the expression of proliferating cell nuclear antigen (PCNA) and cyclin D, thereby increasing the ratio of S phase cells in response to ZEA-induced apoptosis via phosphatidylinositol 3 kinase/protein kinase B (PI3K/Akt) signaling pathway. Isorhamnetin also recovered (P < 0.05) ZEA-induced steroidogenesis disorder by regulating steroidogenic enzyme gene and proteins (follicle-stimulating hormone receptor [FSHR] and cytochrome P450 family 19 subfamily a member 1 [CYP19A1]). Collectively, these findings show that isorhamnetin protects ovarian granulosa cells from ZEA-induced damage, which promotes proliferation, alleviates apoptosis, endoplasmic reticulum stress, oxidative stress, and steroidogenesis disorder.

Keywords: Zearalenone, Isorhamnetin, Ovarian granulosa cell, Apoptosis, Endoplasmic reticulum stress, Oxidative stress

1. Introduction

Zearalenone (ZEA), a non-steroid mycotoxin, is derived from Fusarium strains (Stanciu et al., 2018). ZEA can contaminate livestock feed and human food worldwide, such as cereals, corn, wheat and their products (Huang et al., 2019; Schatzmayr and Streit, 2013). ZEA is also an airborne mycotoxin (Huang et al., 2019). In general, ZEA is heat stabile and insoluble in water, which may cause ZEA-infected crops and soils to contaminate the aquatic environment through drainage and rainwater (Ryu et al., 2003; Waśkiewicz et al., 2012). In addition, ZEA can induce to irreversible toxic damage to the development of embryos and the reproductive system (Zhang et al., 2018). Specifically, pigs are more sensitive to ZEA-induced damage than other animals (Liu et al., 2018). ZEA may accumulate in the meat products along the food chain, which may cause serious consequences and might be harmful to humans (Yang et al., 2018). Accumulating evidence shows that exposure to ZEA could damage the reproductive ability and interfere with the development of oocytes and sperm in animals and humans (Adibnia et al., 2016; Takagi et al., 2008; Yousef et al., 2017). Thus, it is of great significance to explore effective methods to alleviate the toxicity of ZEA.

In mammalian ovaries, ovarian granulosa cells (GC) play a vital role in follicular growth, oocyte maturation, ovulation and steroidogenesis (Guler and Zik, 2018). Ovarian GC are indispensable for folliculogenesis. A previous report demonstrated that ovarian GC affected follicular development by releasing follicular growth and maturation factors (Lai et al., 2017). Ovarian GC also provides nutrients for oocytes and allows full developmental ability (Jiang et al., 2010; Sugiura et al., 2005). Over 99% of follicles will undergo atresia during follicular development. Most follicular atresia is caused by ovarian GC apoptosis (Inoue et al., 2011). ZEA increases ovarian GC apoptosis in a dose-dependent manner, thereby disrupting follicular development (Li et al., 2020). The potential compounds that can effectively protect against ZEA induced ovarian GC damage require exploration.

Isorhamnetin (a natural flavonoid) is commonly distributed in vegetables and fruits (Gong et al., 2020). Studies have indicated that isorhamnetin possesses a wide range of pharmacological effects, including anti-oxidant, anti-inflammatory, anti-tumor and cardiovascular protection (Gong et al., 2020). Furthermore, our previous results suggested that isorhamnetin promoted estrogen secretion and proliferation in porcine ovarian GC (Li et al., 2021). However, it is unclear whether isorhamnetin can improve the reproductive system of animals, specifically in ZEA-induced ovarian GC damage. Thus, it is necessary to investigate the effects of isorhamnetin on ZEA-induced damage in ovarian GC.

In this study, we hypothesized that isorhamnetin could alleviate the toxic effects of ZEA on ovarian GC. In addition, we attempted to identify the signaling pathways and potential mechanisms responsible for isorhamnetin inhibition of ZEA damage. Our findings suggest that isorhamnetin can be used as a natural flavonoid additive to resist the ZEA-induced toxicity in porcine ovarian GC. Moreover, these findings may also benefit human reproduction and health.

2. Materials and methods

2.1. Animal ethics

All animal care and procedures were performed in accordance with institutional and national guidelines and approved by the Utilization Committee of Northwest A&F University (Yangling, China).

2.2. Chemical reagents

Isorhamnetin (Cat#: N1358) was obtained from APExBIO. ZEA (Cat#: 17924-92-4) was obtained from SIGMA. Phosphatidylinositol 3 kinase (PI3K) antagonist LY294002 (Cat#: S1737) and mitogen-activated protein kinase (P38) antagonist SB203580 (Cat#: S1863) were purchased from Beyotime. Sodium phenylbutyrate (4-PBA) (Cat#: 1716-12-7) is an endoplasmic reticulum inhibitor obtained from Santa Cruz Biotechnology. The antibodies used in this study were as follows: anti-microtubule-associated protein 1 light chain 3 (anti-LC3) (Cat#: 192890) was purchased from ABCAM; anti-β-actin (Cat#: 66009-1-1g) and the sequestosome 1 protein (p62) (Cat#: 18420-1-AP) were purchased from Proteintech; anti-follicle-stimulating hormone receptor (anti-FSHR) (Cat#: WL04496), anti-proliferating cell nuclear antigen (anti-PCNA) (Cat#: WL02208), anti-bHLH transcription factor (anti-C-myc) (Cat#: WL01781), anti-PI3K (Cat#: WL02240), anti-Akt (Cat#: WL0003b), anti-p-Akt (Cat#: WLP001a), anti-B-cell lymphoma-2 (anti-Bcl-2) (Cat#: WL01556), anti-pparγ co-activator-1 (anti-PGC1) (Cat#: WL02123), anti- Bcl2-associated x (anti-Bax) (Cat#: WL01637), anti-C-Casp3 (anti-cleaved caspase-3) (Cat#: WL01992), anti-superoxide dismutase 2 (anti-SOD2) (Cat#: WL02506), anti-glutathione peroxidase 1 (anti-GPx1) (Cat#: WL02497a), anti-SOD1 (Cat#: WL01846), anti-caspase12 (Cat#: WL00735), anti-C/EBP homologous protein (anti-CHOP) (Cat#: WL00880), anti-calcineurin A (Cat#: WL03449), anti-Ca2+/calmodulin-dependent kinase IIα (anti-CaMKIIα) (Cat#:WL03453), anti-recombinant activating transcription factor 6 (anti-ATF6) (Cat#:WL02407), anti-inositol-requiring enzyme-1 (anti-IRE1) (Cat#:WL02562), anti-x-box binding protein 1 (anti-XBP1) (Cat#:WL00708), anti-glucose regulated protein78 kD (anti-GRP78) (Cat#:WL03157), anti-P38 (Cat#: WL00764), anti-P-P38 (Cat#: WLP1576), anti-cyclin A (Cat#: WL01841) and anti-cyclin D (Cat#: WL01435a) were purchased from WanleiBio; anti-cytochrome P450 family 19 subfamily a member 1 (anti-CYP19A1) (Cat#: ET1703-77) was obtained from HUABIO.

2.3. Culture and treatment of ovarian GC

The mature female pigs (Duroc, Landrace and Yorkshire crossbreeds) used in the experiment were 7 months old and weighed 120 ± 1.89 kg. Porcine ovaries were obtained from a local abattoir. Porcine ovaries were transported to the lab within 1 h in 37 °C phosphate buffered solution (PBS) containing penicillin (100 IU/mL) and streptomycin (100 mg/mL). Ovarian GC were separated from follicles using a syringe. Then, the ovarian GC were passed through a 40-μm sieve. Ovarian GC were centrifuged (2,261 × g for 4.5 min at room temperature) and washed twice with cell culture medium. Taiphenol blue staining was used to count ovarian GC. Next, ovarian GC were cultured in 24-well plates (106 in 1 mL). The DMEM/F12 medium was supplemented with 1% streptomycin–penicillin and 8% fetal bovine serum (SERA-PRO, Germany). Ovarian GC were cultured at 37 °C in 5% CO2 for 36 to 44 h. Then, ovarian GC were replaced with isorhamnetin and ZEA, and incubated for 24 h in DMEM/F12 medium containing transferrin (2.5 mg/mL), 0.5% bovine serum albumin (wt/vol), sodium bicarbonate (10 mmol/L), insulin (50 ng/mL), sodium selenite (5 ng/mL), follicle-stimulating hormone (FSH) (0.1 IU/mL), penicillin (100 U/mL), streptomycin (100 mg/mL) and nonessential amino acid mix (1×) (Chen et al., 2019). Following this, ovarian GC were collected for protein and mRNA extraction. The media was harvested for an ELISA assay.

2.4. 5-ethynyl-2’-deoxyuridine (EdU) and cell counting kit (CCK-8) evaluates

The proliferation of ovarian GC was detected by EdU-488 (Beyotime, China). Cells were cultured with EdU 1:1,000 for 5 h incubation. Follow the reagent instructions for the rest of the steps. After EdU incubation, the fluorescence microscopy was used to take images.

CCK-8 (Beyotime, China) was used to test the viability of ovarian GC. The 96-well plate was seeded with ovarian GC. After, ovarian GC were mixed with CCK-8 (10 μL) at 37 °C for 2 h. Then, the optical density was determined using a microplate reader.

2.5. Real-time quantitative PCR (RT-qPCR)

The RNA of ovarian GC was extracted using Trizol reagent (TAKARA, Japan) based on the manufacturer's descriptions. The cDNA was synthesized on ice by cDNA synthesis kit (TAKARA, Japan). RT-qPCR was carried out with master mixes (Vazyme, China) in a 20 μL reaction system. All steps are based on manufacturer's protocol. β-actin was used as the housekeeping gene. Then, the relative normalized expression was calculated by the 2−ΔΔCT. The primer sequence is displayed in Table 1.

Table 1.

Primer sequences used for RT-PCR.

Genes Primer sequences (5'–3') NCBI accession number Product size, bp
Beta-actin Forward: ATCAAGATCATCGCGCCTCC XM-003124280.5 169
Reverse: AATGCAACTAACAGTCCGCCT
CYP19A1 Forward: TCCGCAATGACTTGGGCTAC NM-21449.1 103
Reverse: GCCTTTTCGTCCAGTGGGAT
ER1 Forward: GCTACATCATCTCGCTTCCGT NM-21220.1 115
Reverse: ACTTCAGGGTGCTGGACAGA
ER2 Forward: TCCTTTAGCCATCCATTGCC XM-021081392.1 214
Reverse: TCCTGACGCATAATCACTGCA
FSHR Forward: TTCACAGTCGCCCTCTTTCC XM-021085884.1 152
Reverse: CAGCCACAGATGACCACAAA
Open in a new tab

CYP19A1 = cytochrome P450 family 19 subfamily a member 1; ER1 = estrogen receptor 1; ER2 = estrogen receptor 2; FSHR = follicle-stimulating hormone receptor.

2.6. Western blot analysis

The total protein from ovarian GC was extracted with RIPA lysis buffer (Beyotime, China). BCA kit (Beyotime, China) was used to measure protein concentration. The protein (15 to 20 μg) was separated by 10% to 15% SDS-PAGE gel electrophoresis and transferred to nitrocellulose membrane (Millipore, Billerica, MA, USA). Then, the membrane was sealed with QuickBlock Western (Beyotime). The membrane was incubated with the primary antibodies overnight at 4 °C. Cleaning with TBST, the membrane was sealed with secondary antibodies at room temperature for 1 h. The protein band was detected by X-ray and band intensity was quantified using ImageJ software.

2.7. Flow cytometry assay

For cell cycle distribution, cells were fixed at 4 °C. Then, cells were mixed with propidium iodide (PI) for 30 min at 37 °C. Subsequently, ovarian GC were tested using flow cytometry. The results were analyzed by ModFit software.

2.8. Measurement of mitochondrial membrane potential

Ovarian GC were treated with Mito-Tracker Red CMXRos (200 nmol/L, Beyotime) at 37 °C for 25 min. After washing 2 times with PBS. Fluorescence microscopy was used to take images.

2.9. Detection of reactive oxygen species (ROS) and steroid hormones production

Cells were cultured with fluorescent dye 20, 70-dichlorodihydroflorodihyd-rofluorescein diacetate DCFH-DA (Beyotime, China) at 37 °C for 20 min. Then, ovarian GC were washed 3 times with PBS. ImageJ was used to analyze fluorescence intensity.

The dosage of estrogen in the medium was determined by a competitive ELISA kit (Ruixin Biotech, China). The detection range of the kit was 40 to 2,000 pg/mL. The lowest value detected was 40 pg/mL. In brief, after the reagent and samples were mixed and incubated, data were analyzed via a microplate reader.

2.10. Measurement of Ca2+ level

Fura-2 AM (Beyotime) was used to detect intracellular Ca2+ content. Ovarian GC were mixed with Fura-2 AM (5 μmol/L) for 30 min at 37 °C. Data were analyzed via a microplate reader.

2.11. Measurement of malondialdehyde (MDA) production and antioxidant enzyme activity

Superoxide dismutase assay kit, MDA assay kit and glutathione peroxidase (GSH-PX) assay kit were bought from Nanjing Jiancheng Bioengineering Institute. The GSH-PX, SOD and MDA were performed according to assay kit descriptions. Briefly, ovarian GC lysates were mixed with detection reagent. Data were analyzed via a microplate reader.

2.12. Statistical analysis

Data were processed by SPSS 18.0 and Graphpad Prism 6. ANOVA and Duncan's multiple range test were used for data analysis. All data were depicted as means ± SEM. The P < 0.05 represented statistical significance. All experiments were repeated at least 3 times.

3. Results

3.1. Isorhamnetin suppressed ZEA-induced apoptosis in ovarian GC

To investigate whether ZEA exposure affects ovarian GC growth and apoptosis. Ovarian GC were treated with ZEA (0, 10, 30, 60, 90 and 120 μmol/L) for 24 h. It was found that ZEA significantly decreased ovarian GC viability in a dose-dependent manner and the half maximal inhibitory concentration value of ZEA was 60 μmol/L (P < 0.05; Fig. 1B). Pretreatment with isorhamnetin (Fig. 1A) at dosage of 1, 5, 10, 20 and 30 μmol/L increased the viability of ovarian GC exposed to 60 μmol/L ZEA for 24 h (Fig. 1C). Particularly, the 20 μmol/L isorhamnetin was the most effective in resisting ZEA-induced cytotoxicity (P < 0.05; Fig. 1C). Hence, the dosage of 60 μmol/L ZEA and 20 μmol/L isorhamnetin were used in this study. Subsequently, Western blot analysis indicated that the protein expression of Bax and C-Casp3 were significantly increased in ZEA-treated group (P < 0.05), but the Bcl-2 was significantly decreased compared with the control group (P < 0.01; Fig. 1D, E, F, and G). As expected, isorhamnetin pretreatment could inhibit the changes of pro-apoptotic proteins (Fig. 1D, E, F, and G). Next, the mitochondrial quality was detected. The Mito-Tracker Red CMXRos results showed that ZEA-treated group significantly decreased the fluorescence signal and membrane potential of mitochondrial compared with the control group (Fig. 1H; P < 0.05). These data suggest that ZEA-treated group leads to apoptosis of ovarian GC. Conversely, ZEA-induced mitochondrial impairment was partially recovered by isorhamnetin pretreatment (Fig. 1H; P < 0.05). Similarly, the Western blot analysis revealed a lower protein expression of PGC-1 (regulatory proteins of mitochondrial biogenesis) in ZEA-treated ovarian GC (P < 0.05; Fig. 1I, and J). This effect was restored by isorhamnetin pretreatment (Fig. 1I, and J). To determine whether ZEA is involved in autophagy, autophagy-associated (LC3 and P62) proteins were examined. We observed that ZEA treatment significantly increased the protein expression of LC3 and P62 in ovarian GC, whereas isorhamnetin therapy effectively relieved this ZEA-induced upregulation (P < 0.05; Fig. 1K, L and M). Overall, these findings suggest that isorhamnetin can inhibit ovarian GC apoptosis induced by ZEA.

Fig. 1.

Fig. 1

Open in a new tab

Isorhamnetin suppressed ZEA-induced apoptosis. Ovarian GC were cultured with isorhamnetin (20 μmol/L) for 2 h, before treatment with ZEA (60 μmol/L) for 24 h. (A) Structure of isorhamnetin. (B) The viability of ovarian GC treated with ZEA for 24 h. (C) The effect of pretreatment with different concentrations of isorhamnetin on the viability of ZEA (60 μmol/L)-exposed ovarian GC. (D) Western blot analysis showed Bcl-2, Bax and C-Casp3 expression in ovarian GC treated with ZEA or isorhamnetin. (E to G) Relative quantification (Western blot) of the protein expression of Bcl-2, Bax and C-Casp3 normalized to β-actin expression. (H) Representative images of mitochondrial distribution in ovarian GC treated with ZEA or isorhamnetin. Scale bars: 200 μm. (I) Western blot analysis of PGC-1 in ovarian GC treated with ZEA or isorhamnetin. (J) Relative quantification (Western blot) of the protein expression of PGC-1 normalized to β-actin expression. (K) Western blot analysis of LC3 and P62 in ovarian GC treated with ZEA or isorhamnetin. (L to M) Relative quantification (Western blot) of the protein expression of LC3 and P62 normalized to β-actin expression. Data are expressed as means ± SEM. Different letters mean significant differences (P < 0.05). ZEA = zearalenone; GC = granulosa cell; Bcl-2 = b-cell lymphoma-2; Bax = bcl2-associated x; C-Casp3 = cleaved-caspase-3; PGC-1 = pparγ co-activator-1; LC3 = microtubule-associated protein 1 light chain 3; P62 = the sequestosome 1 protein.

3.2. Isorhamnetin relieved ZEA-induced endoplasmic reticulum stress (ERS)

Given that ERS could induce apoptosis, we next studied the changes of ERS-related apoptotic markers in ovarian GC. We found that the protein expression of Casp12 and CHOP were significantly increased in ZEA-treated ovarian GC (P < 0.05), which was abolished by isorhamnetin treatment (Fig. 2A, B, and C). Additionally, ZEA treatment alone clearly increased the protein expression of ATF6, IRE1, XBP1 and GRP78 (P < 0.05), suggesting that ERS happened in ZEA-exposed ovarian GC (Fig. 2F, G, H, I, and J). But, 4-PBA (an endoplasmic reticulum inhibitor) effectively reduced the protein expression of ATF6, IRE1, XBP1 and GRP78 in ZEA-treated ovarian GC (Fig. 2F and G, H, I, and J). Consistent with the effect of 4-PBA, the changes in ERS proteins could be restored by isorhamnetin treatment (Fig. 2F and G, H, I, and J). Considering that ERS can lead to intracellular calcium imbalance, calcium-associated proteins in ovarian GC were detected. We found that the protein expression of calcineurin A and CaMKIIα were significantly increased in ZEA-treated ovarian GC (P < 0.05), which was then recovered by isorhamnetin treatment (Fig. 2 A, D, and E). Interestingly, pretreatment with isorhamnetin or 4-PBA clearly inhibited the level of Ca2+ in ovarian GC exposed to ZEA (P < 0.01; Fig. 2K). The data show that isorhamnetin can block ZEA-induced ERS and maintain ER homeostasis.

Fig. 2.

Fig. 2

Open in a new tab

Isorhamnetin relieved ZEA-induced ERS. Ovarian GC were cultured with isorhamnetin (20 μmol/L) for 2 h with or without 4-PBA (0.5 mmol/L), before to ZEA treatment (60 μmol/L) for 24 h. (A) Western blot analysis of Casp12, CHOP, calcineurin A and CaMKIIα in ovarian GC treated with ZEA or isorhamnetin. (B to E) Relative quantification (Western blot) of the protein expression of Casp12, CHOP, calcineurin A and CaMKIIα in normalized to β-actin expression. (F) Western blot analysis of ATF6, IRE1, XBP1 and GRP78 in ovarian GC treated with ZEA, isorhamnetin or 4-PBA. (G to J) Relative quantification (Western blot) of the protein expression of ATF6, IRE1, XBP1 and GRP78 normalized to β-actin expression. (K) Microplate reader analysis indicated intracellular Ca2+ levels in ovarian GC treated with ZEA, isorhamnetin or 4-PBA. Data are expressed as means ± SEM. Different letters mean significant differences (P < 0.05). ZEA = zearalenone; ERS = endoplasmic reticulum stress; 4-PBA = 4-phenylbutyric acid; Casp12 = recombinant caspase 12; CHOP = C/EBP homologous protein; CaMKIIα = Ca2+/calmodulin-dependent kinase IIα; ATF6 = recombinant activating transcription factor 6; IRE1 = inositol-requiring enzyme-1; XBP1 = x-box binding protein 1; GRP78 = glucose regulated protein78 kD; GC = granulosa cell.

3.3. Isorhamnetin inhibited oxidative stress caused by ZEA

High levels of ROS also lead to ovarian GC apoptosis. We next measured the P-P38 signal in ZEA-treated ovarian GC, which was believed to be engaged in antioxidative stress. Western blot analysis indicated that an effective activation of P-P38 signaling occurred in the ZEA-treated ovarian GC (P = 0.03; Fig. 3A, and E). Conversely, the protein expression of SOD2, GPX1 and SOD1 were significantly decreased in ZEA-treated ovarian GC, which was partially recovered by isorhamnetin treatment (P < 0.05; Fig. 3A, B, C, and D). In line with this, the content of MDA was significantly increased, whereas the activity of SOD and GSH-PX were significantly decreased in ZEA-treated ovarian GC (P < 0.05; Fig. 3F, G, and H). However, ZEA-induced oxidative stress was relieved by isorhamnetin therapy (P < 0.05; Fig. 3A, B, C, D, E, F, G, and H). SB203580, P38 antagonist, recovered ZEA-inhibited the protein expression of SOD2 and GPX1 in ovarian GC, which was partially mimicked by isorhamnetin (P < 0.05; Fig. 3K, L, and M). Furthermore, ZEA significantly increased the level of ROS in ovarian GC, and isorhamnetin inhibited ROS accumulation via its antioxidant activity (P = 0.003; Fig. 3I, and J). Similarly, the ROS generation induced by ZEA treatment was partially alleviated when the ovarian GC were treated with SB203580 (Fig. 3I, and J). These results reveal that isorhamnetin can inhibit ROS in ovarian GC induced by ZEA via down-regulating P-P38/P38.

Fig. 3.

Fig. 3

Open in a new tab

Isorhamnetin ameliorated ZEA-induced cytotoxicity by attenuating oxidative stress. Ovarian GC were cultured with isorhamnetin (20 μmol/L) for 2 h with or without SB203580 (10 μmol/L), prior to ZEA treatment (60 μmol/L) for 24 h. (A) Western blot analysis of SOD2, GPX1, SOD1, P-P38 and P38 in ovarian GC treated with ZEA or isorhamnetin. (B to E) The average optical density value of SOD2/β-actin, GPX1/β-actin, SOD1/β-actin and P-P38/P38. (F to H) The levels of SOD, MDA and glutathione peroxidase (GSH-PX) were displayed in ovarian GC treated with ZEA or isorhamnetin. (I) The representative images showed the level of ROS in ovarian GC treated with ZEA or isorhamnetin. Scale bars: 200 μm. (J) Fluorescence intensity of ROS in ovarian GC treated with ZEA or isorhamnetin. (K) Western blot analysis showed SOD2 and GPX1 expression in ovarian GC treated with ZEA, isorhamnetin or SB203580. (L to M) The average optical density value of SOD2 and GPX1 normalized to β-actin. Data are expressed as means ± SEM. Different letters mean significant differences (P < 0.05). ZEA = zearalenone; GC = granulosa cell; SOD2 = superoxide dismutase 2; GPX1 = glutathione peroxidase 1; SOD1 = superoxide dismutase 1; p = phosphate; P38 = mitogen-activated protein kinase; ROS = reactive oxygen species.

3.4. Isorhamnetin recovered ovarian GC proliferation caused by ZEA in a PI3K/Akt dependent manner

We further investigated how isorhamnetin alleviated the loss of ovarian GC caused by ZEA. Cell proliferation marker related proteins were detected. Western blot results showed that ZEA treatment significantly decreased the protein expression of PCNA, C-myc, PI3K and P-Akt/Akt in ovarian GC (P < 0.05; Fig. 4A and B, C, D, and E). This action was recovered by isorhamnetin therapy (Fig. 4A, B, C, D, and E). Consistently, the proliferation of ovarian GC treated with ZEA was highly significant inhibited by Edu staining, which was alleviated by isorhamnetin (P = 0.007; Fig. 4F, and G); this beneficial action was abolished by LY294002 (PI3K antagonist) (Fig. 4F, and G). Similarly, we found that a marked decrease in the protein expression of cyclin D and cyclin A in ZEA-treated ovarian GC (P < 0.05; Fig. 4H, I, and J). However, co-treatment with isorhamnetin significantly increased the expression of cycle-related proteins in ovarian GC (Fig. 4H, I, and J). Additionally, flow cytometry data showed that ZEA treatment highly significantly improved the ratio of cells in the G0/G1 phase (P = 0.007; Fig. 4K, and L), whereas the ratio of cells in the S phases were significantly decreased (P = 0.003; Fig. 4K, and M). As expected, the decrease of S phase cells was recovered when ovarian GC were treated with isorhamnetin. Interestingly, isorhamnetin-induced cell division was abolished by LY294002 (Fig. 4K, L, M, and N). These data manifest that isorhamnetin depends on the PI3K/Akt signaling pathway, which recovers ovarian GC proliferation in response to ZEA-stimulated apoptosis.

Fig. 4.

Fig. 4

Open in a new tab

Isorhamnetin recovered ovarian GC proliferation caused by ZEA. Ovarian GC were cultured with isorhamnetin (20 μmol/L) for 2 h with or without LY294002 (20 μmol/L), before treatment with ZEA (60 μmol/L) for 24 h. (A) Western blot analysis of PCNA, C-myc, PI3K, P-Akt and Akt in ovarian GC treated with ZEA or isorhamnetin. (B to E) The average optical density value of PCNA/β-actin, C-myc/β-actin, PI3K/β-actin, P-Akt/Akt, respectively. (F) Representative images stained by EdU in ovarian GC treated with ZEA, isorhamnetin or LY294002. Scale bars: 1,000 μm. (G) The percentage of Edu-positive cell in ovarian GC treated with ZEA, isorhamnetin or LY294002. (H) Western blot analysis of cyclin D and cyclin A in ovarian GC treated with ZEA or isorhamnetin. (I to J) The average optical density value of cyclin D and cyclin A normalized to β-actin. (K) Flow cytometry was detected the cell cycle. (L to N) The proportion of ovarian GC in G1, S, G2 phase. Data are expressed as means ± SEM. Different letters mean significant differences (P < 0.05). GC = granulosa cell; ZEA = zearalenone; PCNA = proliferating cell nuclear antigen; C-myc = bHLH transcription factor; PI3K = phosphatidylinositol 3 kinase; p = phosphate; Akt = protein kinase B.

3.5. Isorhamnetin prevented ZEA-induced steroid secretion disorder in a PI3K/Akt-dependent manner

To explore the effect of isorhamnetin on ovarian GC steroidogenesis in response to ZEA treatment, we next measured the indicators related to hormone secretion. Western blot analysis showed ZEA treatment significantly decreased protein expression of FSHR and CYP19A1 in ovarian GC (P < 0.05; Fig. 5A and B, and C). This action was restored by isorhamnetin pretreatment (Fig. 5A and B, and C). Consequently, ZEA-treated ovarian GC significantly inhibited the mRNA expression of CYP19A1, FSHR, estrogen receptor 2 (ER2) and ER1, which was recovered by isorhamnetin administration (P < 0.05; Fig. 5E and F, G, and H). However, isorhamnetin significantly increased the secretion of estrogen in ovarian GC, which was abolished by LY294002 (P = 0.007; Fig. 5D). The secretion of estrogen in ovarian GC was consistent with the expression trend of estrogen-synthesized mRNA (Fig. 5D and E, F, G, and H). Based on these results, we can speculate that isorhamnetin alleviates ZEA-induced steroid secretion disorder through the PI3K/Akt.

Fig. 5.

Fig. 5

Open in a new tab

Isorhamnetin prevented ZEA-induced steroid secretion disorder in a PI3K/Akt-dependent manner. Ovarian GC were cultured with isorhamnetin (20 μmol/L) for 2 h with or without LY294002 (20 μmol/L), before treatment with ZEA (60 μmol/L) for 24 h. (A) Western blot analysis of FSHR and CYP19A1 in ovarian GC treated with ZEA or isorhamnetin. (B to C) The average optical density value of FSHR and CYP19A1 normalized to β-actin. (D) The content of estrogen (E2) in ovarian GC treated with ZEA, isorhamnetin or LY294002. (E to H) The mRNA expression of FSHR, ER2, CYP19A1 and ER1 were tested by an RT-PCR assay. Data are expressed as means ± SEM. Different letters mean significant differences (P < 0.05). ZEA = zearalenone; PI3K = phosphatidylinositol 3 kinase; Akt = protein kinase B; GC = granulosa cell; FSHR = follicle-stimulating hormone receptor; CYP19A1 = cytochrome P450 family 19 subfamily a member 1.

4. Discussion

ZEA is widely found in moldy cereal grain, which is harmful to the growth of gametogenesis and embryo in animals and humans (Yang et al., 2018). ZEA can cause poisoning to animals and damage the reproductive system of animals (Zhao et al., 2013). In particular, pigs are more sensitive to ZEA-induced toxicity than other animals (Liu et al., 2018). Thus, it is of great significance to explore effective methods to alleviate the damage of ZEA to porcine ovarian GC. Isorhamnetin, a flavonoid compound, has a wide range of pharmacological effects, including anti-oxidation, anti-inflammation, anti-bacterial, anti-virus and anti-tumor (Teng and Luan, 2016). However, it's still uncertain whether isorhamnetin attenuates ZEA-induced damage in ovarian GC. Here, we provided direct evidence that isorhamnetin inhibited the damage of ovarian GC caused by ZEA.

To elucidate the beneficial mechanism of isorhamnetin on ZEA-induced apoptosis, ovarian GC were utilized. The Bcl-2 family regulates the cytochrome c release and thereby starts the caspase cascade, a well-known apoptotic pathway (Woo et al., 2018). Published data have suggested that 60 μmol/L ZEA could significantly reduce the cells viability of mouse ovarian GC and induce apoptosis (Yi et al., 2020). Consistently, we found that ZEA (60 μmol/L) activated the protein expression of Bax and C-Casp3 in ovarian GC. However, isorhamnetin could rescue the mitochondrial apoptosis pathway induced by ZEA. Strong evidence indicated that isorhamnetin could alleviate the apoptosis of H2O2-treated PC12 cells by inhibiting caspase-3 protein expression (Hwang et al., 2009). Likewise, isorhamnetin has a protective effect on endothelial cell apoptosis caused by oxidized low-density lipoprotein by inhibiting the up-regulated expression of caspase-3 mRNA (Bao et al., 2010). Mitochondrial dysfunction has been considered as a major factor inducing cell death (Marra and Svegliati-Baroni, 2018). A published study has indicated that ZEA could damage mitochondrial functions (Adibnia et al., 2016). Zhu et al. (2012) reported that ZEA caused the loss of mitochondrial transmembrane potential in porcine ovarian GC. Consistently, we found that ZEA-treated group significantly decreased mitochondrial membrane potential and PGC-1 protein expression. However, isorhamnetin could recover the expression of PGC-1 to alleviate the mitochondrial dysfunction caused by ZEA. Similar to our studies, Bao et al. (2010) demonstrated that isorhamnetin could significantly inhibit mitochondrial membrane potential alteration in endothelial cells induced by oxidized low-density lipoprotein. Furthermore, isorhamnetin prevented obesity-associated mitochondrial dysfunction in 3T3-L1 cells by promoting the expression of PGC-1 mitochondrial biosynthesis gene (Mak-Soon and Yangha, 2018). It is considered that autophagy and apoptosis can regulate each other. We further studied that isorhamnetin alleviated the autophagy of ovarian GC in the presence of ZEA. Indeed, isorhamnetin can directly inhibit autophagy and protect acute fulminant hepatitis caused by concanavalin A in mice (Lu et al., 2018). Thus, it is conceivable that isorhamnetin rescues the ZEA-induced apoptosis by regulating apoptosis-related proteins, mitochondrial function and autophagy of ovarian GC.

When the ER function is badly impaired, the expression of ERS related markers and the organelles changes, which leads to apoptosis (Li et al., 2014). Our results showed that isorhamnetin decreased the protein expression of Casp12 and CHOP, which was associated with ERS. Subsequently, the changes of ER membrane sensors-related proteins ATF6, IRE1, XBP1 and GRP78 showed that isorhamnetin relieved ZEA-induced ERS. Consistently, previous study confirmed that isorhamnetin could inhibit ERS-induced apoptosis in N2a cells (Qiu et al., 2017). ERS can stimulate intracellular calcium overload (Qiu et al., 2017). Conversely, the published data have shown that isorhamnetin inhibited Ca2+ overload in N2a cells (Qiu et al., 2017). In addition, pretreatment with isorhamnetin could directly decrease the level of Ca2+ in H2O2-treated PC12 cells (Hwang et al., 2009). Consistent with previous results, we found that isorhamnetin alleviated the increase of Ca2+ in ZEA-induced ovarian GC by reducing the protein expression of calcineurin A and CaMKIIα. Our data show that isorhamnetin may alleviate ZEA-induced ovarian GC toxicity by inhibiting ERS.

Data from the present study indicated that oxidative stress and ERS, as closely related events, played a vital role in cellular apoptosis (Xu et al., 2020). A previous study showed that ZEA-induced ROS-mediated cell cycle arrest and apoptosis in mouse sertoli cells (Tatay et al., 2017). Likewise, Pan et al. (2020) reported that ZEA impaired the placental function of rats by stimulating MDA level and inhibiting the expression of Sod2, Sod1, Cat and Gpx1 proteins. Consistently, we found that ZEA stimulated MDA level and decreased the protein expression of SOD2, GPX1 and SOD1 by activating the P-P38 pathway. Fortunately, isorhamnetin played a protective role in response to ZEA-induced oxidative stress through P-P38 inactivation. Indeed, previous research shown that isorhamnetin inhibited the content of MDA and increased the activity of SOD and GSH-Px in APAP-induced injured L02 cells (Jiang et al., 2018). Additionally, published data indicated that isorhamnetin suppressed P-P38 to against oxidative stress in PC12 cells (Hwang et al., 2009). Furthermore, isorhamnetin could inhibit ConA-induced autophagy and apoptosis via the P38/peroxisome proliferators-activated receptor α (PPAR-α) pathway in mice (Lu et al., 2018). These results suggest that isorhamnetin can against ZEA-induced oxidative stress through the P-P38 signaling pathways.

Cell cycle progression is a vital physiological process in cell life activities, and interference to cell cycle often leads to aging, degeneration or apoptosis (Pack et al., 2019). The changes of cell cycle related proteins are crucial in regulating cell cycle progression (Lim and Kaldis, 2013). Strong evidence indicated that ZEA regulated the expression of cyclin B and cyclin D proteins, leading disruption of the cell cycle and reducing cell viability of sow ovarian GC (Zhang et al., 2018). A recent study found that the cell cycle of ZEA-treated porcine ovarian GC was arrested in the G2/M phase (Li et al., 2020). Interestingly, we found that the S phase of DNA synthesis was decreased in ZEA-treated ovarian GC. Furthermore, ZEA inhibited the protein expression of cyclin A and cyclin D in ovarian GC, which was consistent with the results of flow cytometry analysis. On the contrary, isorhamnetin stimulated the protein expression of cyclin D and PCNA, and the proportion of EdU positive cells, which recovered ovarian GC proliferation in response to ZEA-induced damage. Subsequently, isorhamnetin increased the S phase of DNA synthesis in ovarian GC, which was suppressed by the PI3K/Akt inhibitor. Consistent with our previous studies, isorhamnetin can increased the proliferation of porcine ovarian GC via the PI3K/Akt dependent manner (Li et al., 2021). Similarly, Jiang et al., (2012) found that isorhamnetin blocked cells from entering S phase of DNA synthesis, and finally inhibited the proliferation of HepG-2 cells. These findings demonstrate that isorhamnetin restores ovarian GC proliferation against ZEA-induced damage via the PI3K/Akt signaling pathway.

Healthy follicles have higher concentrations of estrogen (Chen et al., 2019; He et al., 2016). Thus, the steroidogenesis of ovarian GC is essential for atresia and follicular development. Studies have shown that estrogen synthesis was controlled by steroidogenic enzymes, including CYP19A1 and hormone receptor (Xu et al., 2018; Wang et al., 2020). Growing evidence has revealed that ZEA altered the production of steroid hormones in porcine ovarian GC (Zhu et al., 2012; Zhang et al., 2017). In vitro results suggested that ZEA (20 mg/kg) reduced the concentration of estrogen in serum of pregnant rats (Gao et al., 2017). Likewise, diets with ZEA (2 mg/kg) reduced serum estrogen level in female pigs (Wang et al., 2010). Consistently, our data demonstrated that ZEA suppressed estrogen secretion of ovarian GC. Strikingly, isorhamnetin can regulate the expression of steroid-related genes and proteins to alleviate the hormone balance disturbed by ZEA-treated ovarian GC. Subsequent experiments confirmed that the protective actions of isorhamnetin on ZEA-induced hormonal disorders was abolished by PI3K inactivation. Indeed, isorhamnetin increased estrogen secretion in porcine ovarian GC via the PI3K/Akt signaling pathway (Li et al., 2021). Additionally, isorhamnetin has a possible protective action inhibiting oxidative stress in human RPE cells by activating the PI3K/Akt signaling pathway (Wang et al., 2018). In brief, isorhamnetin recovers ZEA-induced steroid secretion disorder through PI3K/Akt activation.

5. Conclusion

In conclusion, we found that a novel role of isorhamnetin in alleviating the damage caused by ZEA in ovarian GC. We first demonstrated that isorhamnetin protected ovarian GC from ZEA-induced damage by reducing apoptosis, ERS and oxidative stress. Additionally, isorhamnetin recovered the proliferation and estrogen secretion of ovarian GC disturbed by ZEA in a PI3K/Akt dependent manner. These results suggest that isorhamnetin can effectively reduce the damage caused by ZEA in porcine ovarian GC, which shows great promise for applications of isorhamnetin in alleviating ZEA-associated reproductive toxicity; allowing humans and animals to be healthier, and protection for food and feed products.

Author contributions

Xiaoya Li: conceptualization; methodology; data curation; writing-Original draft preparation. Huali Chen, Zelin Zhang and Jiaxin Duan: sample collection; software. Rongmao Hua, Li Yang and Jianyong Cheng: visualization and investigation. Xiaodi Li: writing-review and editing. Qingwang Li: supervision; writing-reviewing and editing; project administration; funding acquisition.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

This study was financially supported by Ministry of Agriculture Transgenic Major Projects (2018ZX0801013B) and Key Industry Innovation Chain of Shaanxi Province (2018ZDCXL-NY-02-06).

Footnotes

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.

References

  1. Adibnia E., Razi M., Malekinejad H. Zearalenone and 17 β-estradiol induced damages in male rats reproduction potential; evidence for ERα and ERβ receptors expression and steroidogenesis. Toxicon. 2016;120:133–146. doi: 10.1016/j.toxicon.2016.08.009. [DOI] [PubMed] [Google Scholar]
  2. Bao M., Xiao Y., Leng Y., Xiao H., Fang A. Effects of isorhamnetin on oxidized low density lipoprotein induced endothelial cell apoptosis. Chin J Atherbladder. 2010;18:445–448. [Google Scholar]
  3. Chen H., Yang Y., Wang Y., Li Y., He Y., Duan J., et al. Phospholipase c inhibits apoptosis of porcine primary granulosa cells cultured in vitro. J Ovarian Res. 2019;12:90. doi: 10.1186/s13048-019-0567-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Guler S., Zik B. Effects of capsaicin on ovarian granulosa cell proliferation and apoptosis. Cell Tissue Res. 2018;372:603–609. doi: 10.1007/s00441-018-2803-4. [DOI] [PubMed] [Google Scholar]
  5. Gong G., Guan Y., Zhang Z., Rahman K., Wang S., Zhou S., et al. Isorhamnetin: a review of pharmacological effects. Biomed Pharmacother. 2020;128:110301. doi: 10.1016/j.biopha.2020.110301. [DOI] [PubMed] [Google Scholar]
  6. Gao X., Sun L., Zhang N., Li C., Zhang J., Xiao Z., et al. Gestational zearalenone exposure causes reproductive and developmental toxicity in pregnant rats and female offspring. Toxins. 2017;9:21. doi: 10.3390/toxins9010021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Huang D., Cui L., Sajid A., Zainab F., Wu Q., Wang X., et al. The epigenetic mechanisms in Fusarium mycotoxins induced toxicities. Food Chem Toxicol. 2019;123:595–601. doi: 10.1016/j.fct.2018.10.059. [DOI] [PubMed] [Google Scholar]
  8. Hwang S., Yen G. Modulation of Akt, JNK, and p38 activation is involved in citrus flavonoid-mediated cytoprotection of PC12 cells challenged by hydrogen peroxide. J Agric Food Chem. 2009;57:2576–2582. doi: 10.1021/jf8033607. [DOI] [PubMed] [Google Scholar]
  9. He Y., Deng H., Jiang Z., Li Q., Shi M., Chen H., et al. Effects of melatonin on follicular atresia and granulosa cell apoptosis in the porcine. Mol Reprod Dev. 2016;83:692–700. doi: 10.1002/mrd.22676. [DOI] [PubMed] [Google Scholar]
  10. Inoue N., Matsuda F., Goto Y., Manabe N. Role of cell-death ligand-receptor system of granulosa cells in selective follicular atresia in porcine ovary. J Reprod Develop. 2011;57:169–175. doi: 10.1262/jrd.10-198e. [DOI] [PubMed] [Google Scholar]
  11. Jiang J., Xiong H., Cao M., Xia X., Sirard M., Tsang B. Mural granulosa cell gene expression associated with oocyte developmental competence. J Ovarian Res. 2010;3:1–12. doi: 10.1186/1757-2215-3-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jiang Z., Wang X., Wang J., Chen X., Wang J., Pan J. Effect of sediherba total flavanones and isorhamnetin on APAP-induced injured l02 cells. Chin J Exp Tradit Med. 2018;24:121–125. [Google Scholar]
  13. Jiang C., Xiang Y., Zhong Y. Effects of isorhamnetin on the proliferous cycle and apoptosis of human hepatoma HepG-2 cells: an experimental study. J Milit Surg. 2012;14:432–435. [Google Scholar]
  14. Liu X., Wu R., Sun X., Cheng S., Zhang R., Zhang T., et al. Mycotoxin zearalenone exposure impairs genomic stability of swine follicular granulosa cells in vitro. Int J Biosci. 2018;14:294–305. doi: 10.7150/ijbs.23898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lai F., Liu J., Li L., Ma J., Liu X., Liu Y., et al. Di (2-ethylhexyl) phthalate impairs steroidogenesis in ovarian follicular cells of prepuberal mice. Arch Toxicol. 2017;91:1279–1292. doi: 10.1007/s00204-016-1790-z. [DOI] [PubMed] [Google Scholar]
  16. Li N., Liu X., Zhang F., Tian Y., Zhu M., Meng L., et al. Whole-transcriptome analysis of the toxic effects of zearalenone exposure on ceRNA networks in porcine granulosa cells. Environ Pollut. 2020;261:114007. doi: 10.1016/j.envpol.2020.114007. [DOI] [PubMed] [Google Scholar]
  17. Li X., Chen H., Zhang Z., Xu D., Duan J., Li X., et al. Isorhamnetin promotes estrogen biosynthesis and proliferation in porcine granulosa cells via the PI3K/Akt signaling pathway. J Agric Food Chem. 2021;69:6535–6542. doi: 10.1021/acs.jafc.1c01543. [DOI] [PubMed] [Google Scholar]
  18. Lu X., Liu T., Chen K., Xia Y., Dai W., Xu S., et al. Isorhamnetin: a hepatoprotective flavonoid inhibits apoptosis and autophagy via P38/PPAR-α pathway in mice. Biomed Pharmacother. 2018;103:800–811. doi: 10.1016/j.biopha.2018.04.016. [DOI] [PubMed] [Google Scholar]
  19. Li Y., Guo Y., Tang J., Jiang J., Chen Z. New insights into the roles of CHOP-induced apoptosis in ER stress. Acta Biochim Biophys. 2014;46:629–640. doi: 10.1093/abbs/gmu048. [DOI] [PubMed] [Google Scholar]
  20. Lim S., Kaldis P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development. 2013;140:3079–3093. doi: 10.1242/dev.091744. [DOI] [PubMed] [Google Scholar]
  21. Marra F., Svegliati-Baroni G. Lipotoxicity and the gut-liver axis in NASH pathogenesis. J Hepatol. 2018;68:280–295. doi: 10.1016/j.jhep.2017.11.014. [DOI] [PubMed] [Google Scholar]
  22. Mak-Soon L., Yangha K. Effects of isorhamnetin on adipocyte mitochondrial biogenesis and AMPK activation. Molecules. 2018;23:1853. doi: 10.3390/molecules23081853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pan P., Ying Y., Ma F., Zou C., Yu Y., Li Y., et al. Zearalenone disrupts the placental function of rats: a possible mechanism causing intrauterine growth restriction. Food Chem Toxicol. 2020;145:111698. doi: 10.1016/j.fct.2020.111698. [DOI] [PubMed] [Google Scholar]
  24. Pack L., Daigh L., Meyer T. Putting the brakes on the cell cycle: mechanisms of cellular growth arrest. Curr Opin Cell Biol. 2019;60:106–113. doi: 10.1016/j.ceb.2019.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Qiu L., Ma Y., Luo Y., Cao Z., Lu H. Protective effects of isorhamnetin on N2a cell against endoplasmic reticulum stress-induced injury is mediated by PKCε. Biomed Pharmacother. 2017;93:830–836. doi: 10.1016/j.biopha.2017.06.062. [DOI] [PubMed] [Google Scholar]
  26. Ryu D., Hanna M.A., Eskridge K.M., Bullerman L.B. Heat stability of zearalenone in an aqueous buffered model system. J Agric Food Chem. 2003;51:1746–1748. doi: 10.1021/jf0210021. [DOI] [PubMed] [Google Scholar]
  27. Stanciu O., Juan C., Miere D., Berrada H., Loghin F., Manes J. First study on trichothecene and zearalenone exposure of the Romanian population through wheat-based products consumption. Food Chem Toxicol. 2018;121:336–342. doi: 10.1016/j.fct.2018.09.014. [DOI] [PubMed] [Google Scholar]
  28. Schatzmayr G., Streit E. Global occurrence of mycotoxins in the food and feed chain: facts and figures. World Mycotoxin J. 2013;6:213–222. [Google Scholar]
  29. Sugiura K., Pendola F., Eppig J. Oocyte control of metabolic cooperativity between oocytes and companion granulosa cells: energy metabolism. Dev Biol. 2005;279:20–30. doi: 10.1016/j.ydbio.2004.11.027. [DOI] [PubMed] [Google Scholar]
  30. Takagi M., Mukai S., Kuriyagawa T., Takagaki K., Uno S., Kokushi E., et al. Detection of zearalenone and its metabolites in naturally contaminated follicular fluids by using LC/MS/MS and in vitro effects of zearalenone on oocyte maturation in cattle. Reprod Toxicol. 2008;26:164–169. doi: 10.1016/j.reprotox.2008.08.006. [DOI] [PubMed] [Google Scholar]
  31. Teng D., Luan X. Research progress of isorhamnetin in pharmacodynamics. Clin J Tradit Chin Med. 2016;28:593–596. [Google Scholar]
  32. Tatay E., Espín S., García-Fernández A., Ruiz M. Oxidative damage and disturbance of antioxidant capacity by zearalenone and its metabolites in human cells. Toxiclol In Vitro. 2017;45:334–339. doi: 10.1016/j.tiv.2017.04.026. [DOI] [PubMed] [Google Scholar]
  33. Waśkiewicz A., Gromadzka K., Bocianowski J., Pluta P., Goliński P. Zearalenone contamination of the aquatic environment as a result of its presence in crops. Arh Hig Rada Toksikol. 2012;63:429–435. doi: 10.2478/10004-1254-63-2012-2229. [DOI] [PubMed] [Google Scholar]
  34. Woo M., Noh J., Cho E., Song Y. Bioactive compounds of Kimchi inhibit apoptosis by attenuating endoplasmic reticulum stress in the brain of amyloid β-injected mice. J Agric Food Chem. 2018;66:4883–4890. doi: 10.1021/acs.jafc.8b01686. [DOI] [PubMed] [Google Scholar]
  35. Wang P., Liu S., Zhu C., Duan Q., Jiang Y., Gao K., et al. MiR-29 regulates the function of goat granulosa cell by targeting PTX3 via the PI3K/Akt/mTOR and Erk1/2 signaling pathways. J Steroid Biochem. 2020;202:105722. doi: 10.1016/j.jsbmb.2020.105722. [DOI] [PubMed] [Google Scholar]
  36. Wang D., Zhang N., Peng Y., Qi D. Interaction of zearalenone and soybean isoflavone on the development of reproductive organs, reproductive hormones and estrogen receptor expression in prepubertal gilts. Anim Reprod Sci. 2010;122:317–323. doi: 10.1016/j.anireprosci.2010.10.002. [DOI] [PubMed] [Google Scholar]
  37. Wang J., Gong H., Zou H., Wu X. Isorhamnetin prevents H2O2-induced oxidative stress in human retinal pigment epithelial cells. Mol Med Rep. 2018;17:648–652. doi: 10.3892/mmr.2017.7916. [DOI] [PubMed] [Google Scholar]
  38. Xu D., Liu L., Zhao Y., Yang L., Cheng J., Hua R., et al. Melatonin protects mouse testes from palmitic acid-induced lipotoxicity by attenuating oxidative stress and DNA damage in a SIRT1-dependent manner. J Pineal Res. 2020;69:12690. doi: 10.1111/jpi.12690. [DOI] [PubMed] [Google Scholar]
  39. Xu D., He H., Jiang X., Hua R., Chen H., Yang L., et al. Sirt2 plays a novel role on progesterone, estradiol and testosterone synthesis via PPARs/LXRα pathway in bovine ovarian granular cells. J Steroid Biochem. 2018;185:27–28. doi: 10.1016/j.jsbmb.2018.07.005. [DOI] [PubMed] [Google Scholar]
  40. Yang D., Jiang X., Sun J., Li X., Li X., Jiao R., et al. Toxic effects of zearalenone on gametogenesis and embryonic development: a molecular point of review. Food Chem Toxicol. 2018;119:24–30. doi: 10.1016/j.fct.2018.06.003. [DOI] [PubMed] [Google Scholar]
  41. Yousef S., Takagi M., Talukder K., Marey A., Kowsar R., Abdel-Razek A., et al. Zearalenone (ZEN) disrupts the anti-inflammatory response of bovine oviductal epithelial cells to sperm in vitro. Reprod Toxicol. 2017;74:158–163. doi: 10.1016/j.reprotox.2017.09.012. [DOI] [PubMed] [Google Scholar]
  42. Yi Y., Wan S., Hou Y., Cheng J., Guo J., Wang S., et al. Chlorogenic acid rescues zearalenone induced injury to mouse ovarian granulosa cells. Ecotoxicol Environ Saf. 2020;194:110401. doi: 10.1016/j.ecoenv.2020.110401. [DOI] [PubMed] [Google Scholar]
  43. Zhang R., Sun X., Wu R., Cheng S., Zhang G., Zhai Q., et al. Zearalenone exposure elevated the expression of tumorigenesis genes in mouse ovarian granulosa cells. Tpxicol Appl Pharmacol. 2018;356:191–203. doi: 10.1016/j.taap.2018.08.013. [DOI] [PubMed] [Google Scholar]
  44. Zhao F., Li R., Xiao S., Diao H., Viveiros M., Song X., et al. Postweaning exposure to dietary zearalenone, a mycotoxin, promotes premature onset of puberty and disrupts early pregnancy events in female mice. Toxicol Sci. 2013;132:431–442. doi: 10.1093/toxsci/kfs343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhu L., Yuan H., Guo C., Lu Y., Deng S., Yang Y., et al. Zearalenone induces apoptosis and necrosis in porcine granulosa cells via a caspase-3- and caspase-9-dependent mitochondrial signaling pathway. J Cell Physiol. 2012;227:1814–1820. doi: 10.1002/jcp.22906. [DOI] [PubMed] [Google Scholar]
  46. Zhang G., Song J., Zhou Y., Zhang R., Cheng S., Sun X., et al. Differentiation of sow and mouse ovarian granulosa cells exposed to zearalenone in vitro using RNA-seq gene expression. Toxicol Appl Pharmacol. 2018;350:78–90. doi: 10.1016/j.taap.2018.05.003. [DOI] [PubMed] [Google Scholar]
  47. Zhang G., Zhang R., Sun X., Cheng S., Wang Y., Ji C., et al. RNA-seq based gene expression analysis of ovarian granulosa cells exposed to zearalenone in vitro: significance to steroidogenesis. Oncotarget. 2017;8:64001–64014. doi: 10.18632/oncotarget.19699. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Animal Nutrition are provided here courtesy of KeAi Publishing

RESOURCES