Abstract
Neisseria meningitidis isolates are conventionally classified by serosubtyping, which characterizes the reactivities of the PorA outer membrane protein variable-region (VR) epitopes with monoclonal antibodies (MAbs). A newer method (PorA VR typing) uses predicted amino acid sequences derived from DNA sequence analysis. The resulting classification schemes are not standardized, offering conflicting and sometimes irreconcilable data from the two methods. In this paper, we propose a standardization of the PorA VR typing nomenclature that incorporates serologic information from traditional PorA serosubtyping with molecular data from predicted VR sequences. We performed a comprehensive literature and database search, generating a collection of strains and DNA sequences that reflects the diversity within PorA that exists to date. We have arranged this information in a comprehensive logical model that includes both serosubtype and PorA VR type assignments. Our data demonstrate that the current panel of serosubtype-defining MAbs underestimates PorA VR variability by at least 50%. Our proposal for VR typing is informative because amino acid sequence and serologic information, when serosubtype-defining MAbs are available, can be deduced simultaneously from the PorA VR designation. This scheme will be useful in future classification and applied epidemiologic studies of N. meningitidis, being a systematic way of selecting PorA vaccine candidates and analyzing vaccine coverage and failure.
Epidemiologic investigators of meningococcal disease use classification schemes based on antigenic diversity among Neisseria meningitidis cell envelope antigens. All meningococci express either a class 2 or a class 3 outer membrane protein (OMP), and most strains also express a class 1 OMP (P1 protein) (14, 30, 31). The class 1 OMP has been named PorA, and its gene has been designated porA (16). Similarly, the class 2 and class 3 OMPs have been named PorB and their gene has been designated porB (5, 9, 16). The amino acid sequences of PorB and PorA do not vary within an isolate, but sequence differences may be used to differentiate strains. The antigenic variety of meningococcal PorB and PorA proteins forms the basis of serotyping and serosubtyping, respectively (1, 2, 14).
Serosubtyping is especially important for group B strains, in which immunity may be serosubtype specific. PorA-specific monoclonal antibodies (MAbs) used for serosubtyping of meningococci are highly bactericidal in vitro, and animals challenged with virulent bacteria were protected when they were first passively immunized with those MAbs (25). In addition, strains devoid of PorA poorly induced bactericidal antibodies in mice. Transfer of one porA gene to and its expression in a heterologous strain induced a full bactericidal response in the recipient strains against the donor serosubtype (32). Considered together, these results make the PorA protein an attractive vaccine candidate.
The composition of such a vaccine depends on accurate estimates of PorA serosubtype distribution and prevalence within a given geographic region. This information is also used to determine or predict meningococcal vaccine efficacy and analyze the mechanisms for vaccine failure (6, 20–22). A comprehensive and reproducible determination of PorA sequence and topology is needed as a scientific basis for these studies. A two-dimensional secondary structure containing eight exposed surface loops (loops I to VIII) has been predicted for PorA and PorB proteins (12, 17, 31). Most variability between PorA proteins resides in two variable regions (VRs), VR1 and VR2, which correspond to loops I and IV, respectively. Serosubtype-defining MAbs react with peptide epitopes located in these loops (17–19, 31). Two additional regions of more limited variability in loops V and VI are referred to as semivariable regions 1 and 2 (SVR1 and SVR2). The application of molecular techniques, such as direct porA nucleotide sequence determination, permits characterization of meningococcal PorA VR sequences by their predicted amino acid sequences (PorA VR typing).
The choice of PorA epitopes to be included in an OMP vaccine has, therefore, depended largely on MAb serosubtyping data. However, the lack of MAbs that recognize particular sequences has increased the importance of PorA VR typing in meningococcal characterization (8, 19, 28, 35). PorA VR typing allows more detailed analysis of potentially protective epitopes and thus allows estimations of vaccine efficacy as well as accurate strain identification for epidemiologic investigations.
Several investigators have either classified PorA VR types (7, 19, 28, 29) or proposed models for PorA VR nomenclature (13, 28). However, the system of designations for PorA VR types is not standardized and identical VR sequences have been named differently by different authors. Furthermore, there is no consensus about whether a PorA VR type designation should also carry information describing antibody reactivity; serosubtypes and PorA VR types are also sometimes misinterpreted as each other.
The goal of this study was to combine serologic data from traditional PorA serosubtyping with molecular data from predicted PorA VR amino acid sequences in order to propose a standardized PorA VR typing nomenclature. These data (i) establish the nucleotide sequences of the porA genes present in representative strains, (ii) estimate the degree of sequence variation present in each predicted PorA VR family, (iii) assign or predict the reactivities of all available serosubtype-defining MAbs with all PorA VR types described, and (iv) provide the framework for our proposal of a unified nomenclature for PorA VR typing.
MATERIALS AND METHODS
Bacterial strains and serotyping.
Seventy-nine N. meningitidis strains, including serotype and serosubtype reference strains (n = 27) and additional strains (n = 52), were obtained from M. Achtman, Max-Planck-Institut für Molekulare Genetik, Berlin, Germany; O. L. Frøholm, National Institute of Public Health (Folkehelsa), Oslo, Norway; P. Kriz, National Institute of Public Health, Prague, Czech Republic; F. E. Ashton, Laboratory Center for Disease Control, Tunney’s Pasture, Ottawa, Canada; and the Adolfo Lutz Institute, São Paulo, Brazil (Table 1). All strains were serosubtyped by dot blotting of whole-cell suspensions (33) with the MAbs listed in Table 2.
TABLE 1.
Serotype, serosubtype, and PorA VR type characteristics of N. meningitidis strains analyzed
| Strain | Source or referencea | Serogroup | MAb characterizationb
|
Proposed PorA VR type designation | GenBank accession no.d | |
|---|---|---|---|---|---|---|
| Serotype | Serosubtype | |||||
| Prototype strains (n = 27) | ||||||
| B16B6 | FDA | B | 2a | P1.5,2 | P1.5,2 | X57182 |
| 2996 | FDA | B | 2b | P1.5,2 | P1.5a,2a | X57180 |
| M136 | SIFF | B | 16,11 | P1− | P1.5a,2c | U92941 |
| 2396 | SIFF | B | 2c | P1.5,2 | P1.5a,2c | U92944 |
| 126E | SIFF | C | 19,10 | P1.5,2 | P1.5a,2c | U92927 |
| H-276(870227) | MPIG | B | 4,7 | P1.10 | P1.5b,10 | U92931 |
| M1027 | FDA | A | 4,21 | P1− | P1.5b,10 | U92917 |
| 503/93 | NIPH | B | NS | NST | P1.5b,C | U92922 |
| H.44/76 | SIFF | B | 15 | P1.7,16 | P1.7,16 | X52995 |
| M1080 | FDA | B | 19,7,1 | P1.7,1 | P1.7d,1 | X57184 |
| M978 | FDA | B | 19,10 | P1.7,1 | P1.7d,1 | U92938 |
| M992 | FDA | B | 5 | P1.7,1 | P1.7d,1 | U92920 |
| 60E | FDA | C | 16,2b | P1.7,1 | P1.7d,1 | U92921 |
| BB393 | FDA | B | 15 | P1.3 | P1.7b,3 | U92929 |
| N.34/94 | ALI | B | 19,10 | P1.4 | P1.7b,4 | U92925 |
| Z-4008 (882066) | MPIG | B | 4,7 | P1.4 | P1.7b,4 | U92916 |
| S3032 | SIFF | B | 19,7 | P1.12,16 | P1.12,16 | X57178 |
| 51/90 | SIFF, 35 | B | 15 | P1.12,13 | P1.12a,13a | AF051542 |
| M982 | FDA | B | NS | P1.(22),9 | P1.22,9 | X57181 |
| S3446 | SIFF | B | 19,14 | P1.23,14 | P1.23,14 | U92919 |
| 6557 | FDA | B | 17,7 | P1.23,14 | P1.23,14 | U92926 |
| H355 | FDA | B | 15 | P1.19,15 | P1.19,15 | X57177 |
| 35E | SIFF | C | 2c | P1.1 | P1.B,1 | X57179 |
| M981 | FDA | B | 4,7 | P1− | P1.C,1 | U92947 |
| 190I | FDA | B | 19,10 | NST | P1.E,A | U92928 |
| 6940 | FDA | B | 19,10 | NST | P1.E,A | U92915 |
| M990 | FDA | B | 16,6 | NST | P1.E,A | X57183 |
| Additional strains (n = 52) | ||||||
| 94010 | LCDCTP | C | 2a | P1.5,2 | P1.5,2 | U92943 |
| M986 | FDA | B | 2a | P1.5,2 | P1.5,2 | U92942 |
| N.1302/95 | ALI | B | 2b | P1.5,10 | P1.5a,10a | U92939 |
| N.446/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92918 |
| N.781/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92946 |
| N.862/95 | ALI | C | 2b | P1.10 | P1.5b,10b | U92496 |
| N.1342/96 | ALI | B | 17,7 | P1.7,16 | P1.7,16 | U97260 |
| N.1329/96 | ALI | B | 17,7 | P1.7,16 | P1.7,16 | U97259 |
| N.57/97 | ALI | B | NS | P1.1 | P1.7b,1 | AF042541 |
| N.19/93 | ALI | B | 7 | NST | P1.7b,13e | U92923 |
| NZ.3968 | CDC | B | 4,7 | P1.4 | P1.7b,4 | AF051539 |
| NZ.3966 | CDC | B | 4,7 | P1.4 | P1.7b,4 | AF051538 |
| N.459/93 | ALI | B | 4,7 | P1.7,1 | P1.7d,1 | U92934 |
| N.238/91 | ALI | B | 4,7 | P1.7,1 | P1.7d,1 | AF029088 |
| N.585/94 | ALI | B | 4,7 | P1.13 | P1.7b,13a | U92933 |
| N.1434/96 | ALI | B | 19,14 | P1.23,3 | P1.23,3 | U97263 |
| N.1450/96 | ALI | B | 19,14 | P1.23,3 | P1.23,3 | U97261 |
| N.1454/96 | ALI | B | 19,14 | P1.23,3 | P1.23,3 | U97262 |
| N.610/93 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | U92945 |
| N.1/97 | ALI | B | 4,7 | P1.19,1 | P1.19,1 | AF042540 |
| CU385 | FDA | B | 4,7 | P1.19,15 | P1.19,15 | U92935 |
| N.150/88 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | U92936 |
| N.44/89 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | U92924 |
| N.1291/90 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | AF029086 |
| N.543/90 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | AF020983 |
| N.155/94 | ALI | B | 4,7 | P1.19,15 | P1.19,15 | U94958 |
| N.23/97 | ALI | B | 4,10 | P1.19,15 | P1.19,15 | U97258 |
| N.163/94 | ALI | B | 19,10 | NST | P1.E,A | U92940 |
| N.1237/90 | ALI | B | 4,7 | NST | P1.E,A | AF029084 |
| N.105/93 | ALI | B | 17,7 | NST | P1.E,16a | U92930 |
| N.405/94 | ALI | B | 19,7,1 | NST | P1.E,4a | U94959 |
| N.257/93 | ALI | B | NS | NST | P1.E,4a | U92948 |
| N.2/90 | ALI | B | 4,7 | P1.3 | P1.Ea,3 | AF016863 |
| N.74/90 | ALI | B | 4,7 | P1.9 | P1.Eb,9 | AF029089 |
| N.300/94 | ALI | B | 4,7 | P1.9 | P1.Eb,9 | U92937 |
| N.116/90 | ALI | B | 4,10 | P1.9 | P1.Eb,9 | AF029087 |
| N.109/93 | ALI | B | 4,10 | P1.9 | P1.Eb,9 | U92932 |
| N.1296/90 | ALI | B | 4,10 | P1.9 | P1.Eb,9 | AF029090 |
| N.285/91 | ALI | B | 4,10 | P1.16 | P1.F,16 | AF029085 |
| N.230/97 | ALI | B | NS | P1.1 | P1.7a,1 | AF051540 |
| CH539 | CDC | B | 15 | P1.3 | P1.7b,3 | AF051536 |
| N.499/92 | ALI | B | 4,7 | P1.7,1 | P1.7d,1 | AF052743 |
| N.424/97 | ALI | B | NS | P1.3 | P1.Ea,3 | AF054269 |
| N.1060/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92495 |
| N.926/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92497 |
| N.592/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92498 |
| N.564/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92499 |
| N.430/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92500 |
| N.571/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92501 |
| N.855/95 | ALI | C | 2b | P1.10 | P1.5b,10b | U92502 |
| N.428/95 | ALI | C | 2b | P1.10 | P1.5b,10 | U92503 |
| N.361/97 | ALI | B | 15 | P1.(22) | P1.22,14a | AF051541 |
| GenBank sequences (n = 82)e | ||||||
| MC50 | 5 | C | NS | P1.16 | P1.F,16 | X12899 |
| MC133 | 8 | C | 2b | P1.2 | P1.D,2d | Z48493 |
| MC135 | 8 | B | 2b | P1.2 | P1.D,2 | Z48489 |
| MC125 | 8 | C | 2a | P1.2 | P1.D,2d | Z48485 |
| MC119 | 8 | Y | 14 | P1.2 | P1.19c,2c | Z48494 |
| MC127 | 8 | B | 2b | P1.10 | P1.D,10f | Z48487 |
| MC117 | 8 | B | 2b | P1.10 | P1.A,10e | Z48488 |
| MC123 | 8 | B | 2b | P1.10 | P1.A,10g | Z48495 |
| MC129 | 8 | B | 2b | P1.10 | P1.A,10 | Z48490 |
| MC121 | 8 | B | NS | P1.[19],15 | P1.19,15 | Z48486 |
| MC139 | 8 | C | 4,21 | P1.[19],15 | P1.19,15 | Z48491 |
| MC130 | 8 | B | 4 | P1.[19],15 | P1.19,15 | Z48492 |
| 2155 | 11 | B | 4 | P1.[19],15 | P1.19,15 | X66478 |
| 2133 | 11 | B | 15 | P1.16 | P1.7b,16 | X66479 |
| 2153 | 11 | B | 15 | P1.7,16 | P1.7,16b | X66477 |
| 2135 | 11 | B | 15 | P1.7,16 | P1.7,16 | X66480 |
| B385 | 15 | B | 4 | P1.[19],15 | P1.19,15 | X81110 |
| IHN5363 | 15 | B | 4 | P1.9 | P1.Eb,9 | X79056 |
| IH36109 | 15 | B | 4 | P1.[5],2 | P1.5,2e | X78467 |
| INH36152 | 15 | B | NS | NST | P1.E,A | X81111 |
| INH36117 | 15 | B | 14 | NST | P1.7b,13d | X78802 |
| MC54 | 18 | NDf | ND | P1.[3] | P1.Ea,3 | Z14281/82 |
| MC104 | 18 | ND | ND | P1.7,16 | P1.7,16b | Z14273/74 |
| MC105 | 18 | ND | ND | P1.1 | P1.Ec,1 | Z14275/76 |
| L2470 | 18 | ND | ND | P1.4 | P1.7b,4 | Z14261/62 |
| L2502 | 18 | ND | ND | P1.4 | P1.7b,4 | Z14265/66 |
| MC106 | 18 | ND | ND | P1.7,9 | P1.7,9 | Z14277/78 |
| MC56 | 18 | ND | ND | P1.[19],15 | P1.19,15 | Z14283/84 |
| MC101 | 18 | ND | ND | P1.[19],15 | P1.19,15 | Z14271/72 |
| L91/33 | 18 | ND | ND | P1.[19],15 | P1.19,15 | Z14269/70 |
| L2488 | 18 | ND | ND | P1.[19],15 | P1.19,15a | Z14263/64 |
| L2214 | 18 | ND | ND | P1.[19],15 | P1.19a,15b | Z14259/60 |
| L2130 | 18 | ND | ND | P1.[19],15 | P1.19,15 | Z14257/58 |
| MC86 | 18 | ND | ND | P1− | P1.5b,16 | Z14293/94 |
| MC71 | 18 | ND | ND | P1− | P1.19b,13a | Z14291/92 |
| MC116 | 18 | ND | ND | P1− | P1.5,16 | Z14279/80 |
| MC70 | 18 | ND | ND | P1− | P1.5,2 | Z14289/90 |
| MC64 | 18 | ND | ND | P1− | P1.5,2b | Z14287/88 |
| L71 | 18 | ND | ND | P1.16 | P1.7b,16 | Z14267/68 |
| MC59 | 18 | ND | ND | P1.7,16 | P1.7,16b | Z14285/86 |
| 8529 | 26 | B | 15 | P1.3 | P1.7b,3 | L02929 |
| Z1073 | 28 | A | ND | P1.3 | P1.Ea,3 | X77423 |
| Z1403 | 28 | A | ND | P1.5,2 | P1.5a,2c | X77424 |
| Z4734 | 28 | A | ND | P1.16 | P1.F,16 | X77433 |
| Z1227 | 28 | A | ND | P1.5,9 | P1.5a,9 | X77426 |
| Z4063 | 28 | A | 4 | P1.7 | P1.7c,10c | X77428 |
| Z1318 | 28 | A | 4,21 | P1.[13] | P1.7b,13a | X77430 |
| Z1048 | 28 | A | 4,21 | P1.7,[13] | P1.7,13a | X77427 |
| Z4060 | 28 | A | ND | P1.10 | P1.7a,10 | X77429 |
| Z1054 | 28 | A | ND | P1.20,9 | P1.20,9 | X77425 |
| Z4084 | 28 | A | ND | P1.22 | P1.22,B | X77432 |
| Z1388c | 28 | A | 4,21 | NST | P1.5b,del | X77431 |
| Z1040 | 28 | A | 4,21 | P1.10 | P1.5b,10 | X77422 |
| 3/89 | 35 | B | 14 | P1.7,13 | P1.7,13a | Z48024/25 |
| 98/90 | 35 | B | 15 | P1.12 | P1.12a,13f | Z48032/33 |
| 24/90 | 35 | B | 15 | P1.12,13 | P1.12a,13 | Z48020/21 |
| 28/90 | 35 | B | NS | P1.12,13 | P1.12a,13a | Z48022/23 |
| 49/92 | 35 | B | 16 | P1.12,13 | P1.12a,13a | Z48028/29 |
| 139/92 | 35 | B | 15 | P1.12,13 | P1.12a,13 | Z48016/17 |
| 131/92 | 35 | B | 15 | P1.12,13 | P1.12a,13 | Z48012/13 |
| 138/91 | 35 | B | 15 | P1.13 | P1.E,13b | Z48014/15 |
| 23/89 | 35 | B | 15 | P1.13 | P1.7b,13a | Z48018/19 |
| 44/92 | 35 | B | NS | P1.13 | P1.7b,13 | Z48026/27 |
| 12274 | 3 | C | 2a | P1.5,2 | P1.5,2 | U31060 |
| 12748 | 3 | C | ND | ND | P1.5,2 | U31061 |
| 13489 | 3 | C | 2a | P1.3 | P1.Ea,3 | U31062 |
| 16576 | 3 | C | 4 | P1.22,9 | P1.22,9 | U31063 |
| 16662 | 3 | C | 2a | P1.5,2 | P1.5,2 | U31064 |
| 19209 | 3 | C | 2a | P1.5,2 | P1.5,2 | U31065 |
| 19789 | 3 | C | 4 | P1.15 | P1.19,15 | U31066 |
| 23630 | 3 | C | 2a | P1.5,2 | P1.5,2 | U31067 |
| 19747 | 4 | B | ND | ND | P1.12b,13a | U93898 |
| 23042 | 4 | B | ND | ND | P1.5c,10a | U93899 |
| 24955 | 4 | B | ND | ND | P1.7e,16e | U93900 |
| 19649 | 4 | B | ND | ND | P1.B,16d | U93901 |
| 20788 | 4 | B | ND | ND | P1.F,16e | U93902 |
| 21290 | 4 | B | ND | ND | P1.F,16e | U93903 |
| 23099 | 4 | C | ND | ND | P1.7b,13e | U93904 |
| 23196 | 4 | B | ND | ND | P1.B,16d | U93905 |
| 24955 | 4 | B | ND | ND | P1.7e,16e | U93906 |
| 25828 | 4 | B | ND | ND | P1.7b,13g | U93907 |
| 26209 | 4 | B | ND | ND | P1.B,16f | U93908 |
| Partial sequences not found in GenBank (n =6) | ||||||
| 104/84 | 6, 20 | B | 15 | P1.7,16 | P1.7,16c | ND |
| 7967 | 27 | Z | 4 | NST | P1.22,14b | ND |
| 8659 | 27 | B | NS | P1.14 | P1.22,14c | ND |
| 8778 | 27 | B | NS | P1.7,14 | P1.7,14 | ND |
| 8779 | 27 | B | NS | P1.7,14 | P1.7,14 | ND |
| 9304 | 27 | B | NS | P1.14 | P1.23,14 | ND |
MPIG, Max-Planck-Institut für Molekulare Genetik; FDA, Food and Drug Administration, Bethesda, Md.; SIFF, National Institute for Public Health, Oslo, Norway; NIPH, National Institute of Public Health of Prague, Prague, Czech Republic; LCDCTP, Laboratory Centers for Disease Control, Tunney’s Pasture; ALI, Adolfo Lutz Institute; CDC, Centers for Disease Control and Prevention.
P1−, no expression of PorA class 1 protein by SDS-polyacrylamide gel electrophoresis; NS, nonserotypeable; NST, nonserosubtypeable; parentheses around a number, based on predicted reaction with the serosubtype-defining MAb; brackets around a number, based on predicted reaction with the serosubtype-defining MAb (GenBank sequences only).
Strain Z1388 has an 87-bp deletion that includes the porA VR2 region (28).
Boldface GenBank accession numbers are those for which the nucleotide sequences were determined in this work.
Because we did not have access to meningococcal strains from sequences obtained from GenBank (n = 82) and strains with partial sequences not found in GenBank (n = 6), the serosubtyping of those strains was not repeated in our laboratory.
ND, not described.
TABLE 2.
Serosubtype-defining MAbs and their identification and epitope locations
| Serosubtype-defining MAb | PorA serosubtype epitope location
|
MAb
|
||
|---|---|---|---|---|
| VR1 | VR2 | Identificationa | Source(s)b | |
| P1.1 | × | F10-5G6/1B11 | ALI | |
| MN14C2.3 | NIBSC, NIPH | |||
| P1.2 | × | 1649C7 | FDA | |
| MN16C10F4 | NIBSC, NIPH | |||
| P1.3 | × | 12-1 | WRAIR | |
| 5G8B2F9 | NIPH | |||
| P1.4 | × | F11-2A9/1A4 | ALI | |
| MN20B9.34 | NIBSC, NIPH | |||
| P1.5 | × | MN22A9.19 | NIBSC, NIPH | |
| P1.7 | × | MN14C11.6 | NIBSC, NIPH | |
| P1.9 | × | MN5A10.7 | NIPH | |
| P1.10 | × | MN20F4.17 | NIBSC, NIPH | |
| P1.12 | × | MN20A7.10 | NIBSC, NIPH | |
| P1.13 | × | MN25H10.75 | NIBSC, NIPH | |
| P1.13a | × | 202, G-12 | SIFF | |
| P1.14 | × | MN21G3.17 | NIBSC, NIPH | |
| P1.15 | × | MN3C5C | NIBSC, NIPH | |
| MN3C5C | NIBSC, NIPH | |||
| P1.16 | × | 3-1-P1.16 | WRAIR | |
| MN5C11G | NIBSC, NIPH | |||
| P1.19c | × | 2-1-P1.15 | WRAIR | |
| P1.20 | × | NU | ||
| P1.22 | × | NU | ||
| P1.23 | × | F4-1F1/1F3 | ALI | |
NU, serosubtype-defining MAbs P1.20 and P1.22 were not available for use in this study.
ALI, Adolfo Lutz Institute; FDA, Food and Drug Administration; WRAIR, Walter Reed Army Institute of Research, Washington, D.C.; NIPH, National Institute for Public Health and Environment Protection, Bilthoven, The Netherlands; NIBSC, National Institute for Biological Standards and Control, Potters Barr, England; SIFF, National Institute for Public Health (O. L. Frøholm).
MAb P1.19 specificity was described as P1.15 specificity before 1996 (36).
PCR.
The PCR primers P14 (this study) and P22 (17), based on porA nucleotide sequence accession no. X12899, were predicted to amplify a porA gene product of 1,236 bp (Table 3). This product, 120 bp longer than that obtained with primers P21 and P22 described by Maiden et al. (17), includes the start codon. Each final reaction mixture (100 μl) contained 5 U of Expand DNA polymerase (Boehringer Mannheim); 10 μl of whole-cell suspension as a template; 10 mM Tris-Cl (pH 8); 50 mM KCl; 1.5 mM MgCl2; 200 μM (each) dATP, dCTP, dGTP, and dTTP; and 0.4 μM concentrations of each primer. Reaction mixtures were first incubated for 5 min at 95°C. Then five cycles of 1 min at 94°C, 2 min at the annealing temperature of 65°C, and 20 s at 72°C were performed. This was followed by 25 cycles of 30 s at 90°C, 20 s at 65°C, and 20 s at 72°C. Reaction mixtures were then incubated at 72°C for a further 5 min. PCR products were purified with a High Pure PCR product purification kit (Boehringer Mannheim).
TABLE 3.
Nucleotide sequences of primers used for porA gene amplification and sequencing
| Primera | Direction of primerb | Nucleotide sequence |
|---|---|---|
| P14 | F | GGG TGT TTG CCC GAT GTT TTT AGG |
| P21 | F | CTG TAC GGC GAA ATC AAA GCC GGC GT |
| U86 | F | GCC CTC GTA TTG TCC GCA CTG |
| 910 | F | ATC AGG TAC ACC GCC TGA CGG GCG GC |
| 738 | F | TCG GAT GTG TAT TAT GCC GGT CTG |
| 435 | F | GCC ATT GAT CCT TGG GAC AGC AA |
| 773 | F | ATG GCG GTT TTG CCG GGA ACT ATG CC |
| 435 | R | TTG CTG TCC CAA GGA TCA ATG GC |
| 773 | R | GGC ATA GTT CCC GGC AAA ACC GCC AT |
| 910 | R | GCC GCC CGT CAG GCG GTG TAC CTG AT |
| 738 | R | CAG ACC GGC ATA ATA CAC ATC CGA |
| 481 | R | TCG TCG TGG CGT TTG AAA ATA CCC A |
| 272 | R | AAG CTG CCA AAC AGC CTT CAG CCC |
| P22 | R | TTA GAA TTT GTG GCG CAA ACC GAC |
Primers P21 and P22 were described by Maiden et al. (17).
F and R, forward and reverse orientations of primer, respectively, in relation to the direction of transcription of the gene.
Sequences of porA genes.
To assess the genetic diversity of porA genes, 92 porA sequences (9 from serotype or serosubtype reference strains) were obtained from the GenBank database. porA nucleotide sequences were determined for a further 70 meningococcal strains chosen to represent additional serosubtypes or additional isolates of a serosubtype (n = 52) and serotyping reference strains (n = 18) (Table 1). For sequencing, we used 14 primers (7 forward and 7 reverse) designed to be complementary to the conserved regions of the porA gene (Table 3). Sequencing was performed by using a Taq Dye-deoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif.). Sequencing products were purified by using Centri-Sep spin columns (Princeton Separations, Adelphia, N.J.) and resolved on a 5% acrylamide–8 M urea gel with an Applied Biosystems model 373S automated DNA sequencing system. The DNA sequences obtained were aligned and edited, and consensus sequences were determined with the University of Wisconsin Genetics Computer Group software package (10). When a novel nucleotide sequence for any VR was found, the porA gene amplification and sequencing were repeated. Amino acid alignments were obtained by translating nucleotide sequences. Distance matrices were calculated by using the Distances program of the Genetics Computer Group package (10). An exact amino acid match was scored as 1.5, and any other residue was scored as 0.
Nucleotide sequence accession numbers.
The sequences of porA genes obtained during the study have been submitted to the GenBank database and assigned the accession numbers listed in Table 1.
RESULTS AND DISCUSSION
We propose a standardization of PorA VR typing nomenclature that builds on that of Suker et al. (28). A full description of the proposed nomenclature is presented in Table 4. Briefly, PorA VR types have been defined based on PorA VR sequences predicted from the nucleotide sequences of porA genes, while serosubtypes have been defined based on reactivities of serosubtype-defining MAbs with PorA VR epitopes. Some of these definitions have been proposed previously (13, 14, 18, 19, 28, 29, 35), and we have retained these designations or historical names whenever practical.
TABLE 4.
Summary of the nomenclatural recommendations for serosubtyping and PorA VR typing
| Term | Definition | Designation |
|---|---|---|
| Serosubtyping | Characterization of PorA VR epitopes by whole-cell dot blot or ELISA reactions with serosubtype-defining MAbs | |
| Serosubtype | Designates the epitope recognized by a serosubtype-defining MAb | P1. (class 1 protein) followed by one or two numbers referring to the epitopes characterized (e.g., P1.4 and P1.7,1). When two VRs are characterized for a given strain, the number corresponding to VR1 will be written first followed by the number corresponding to VR2, with commas separating the numbers. See Table 2 for PorA serosubtype epitope location. |
| Serosubtype-defining MAb | MAb that defines the serosubtype | MAb P1. followed by a number (e.g., MAb P1.13). The designation should refer to the order in which the MAb assignments were first made or to the serotype of the strain used for the serosubtype-defining MAb production. For those MAbs that recognize a PorA VR family variant but not the prototype of the same PorA VR family, a number followed by a lowercase letter that refers to that variant sequence (e.g., MAb P1.13a) is used. |
| Serosubtype reference strain | Strain used as immunogen to develop serosubtype-defining MAb | |
| Nonserosubtypeable strain | Absence of reactivity between a given strain and the set of serosubtype-defining MAbs used | NST |
| Unserosubtypeable strain | Absence of PorA protein | P1. followed by − |
| PorA VR typing | Characterization of PorA VR amino acid sequences | |
| PorA VR type | Amino acid sequence in a particular VR that may be predicted from DNA sequence | P1. followed by two underlined capital letters describing VR1 and VR2 (e.g., P1.A,C). The character can be a number if the VR type carries the epitope for a particular serosubtype-defining MAb. See Table 5 for PorA VR location. |
| PorA VR family | All VR types with at least 80% amino acid identity with the prototype VR | PorA VR1- or VR2- followed by the name of a family (e.g., PorA VR1-A family). The family name is the same as its prototype sequence designation. |
| PorA VR family prototype | VR amino acid sequence of the serosubtype reference strain; for a VR family member not recognized by any available MAb, the prototype is defined as the PorA VR amino acid sequence of the strain first sequenced | The prototype can be a capital letter or a number if it carries the epitope for a particular serosubtype-defining MAb (e.g., VR1-A and VR1-5). |
| PorA VR family variant | All VR types in a given family other than the VR prototype | VR type followed by a lowercase letter (e.g., VR1-5a and VR1-Eb). |
Our proposal differs from that of Feavers et al. (13) in that we combine serologic data from traditional PorA serosubtyping with molecular sequence data from predicted PorA VR amino acid sequences. Our PorA VR type designation system carries information describing the reactivity with serosubtype-defining MAbs. We believe it is important to include the enormous body of available serologic data because of its value in understanding meningococcal disease epidemiology.
PorA types.
PorA VR types were defined based on predicted amino acid sequences present in exposed loops I (VR1) and IV (VR2) of the PorA protein according to the structural model of class 1 OMPs (31). PorA VR amino acid sequences were located in relation to the position of the translated porA gene of strain MC50 (accession no. X12899) at amino acids 43 to 56 (VR1) and 195 to 208 (VR2) (5). According to our proposal, the PorA VR type composition of a particular strain is designated P1 followed by a period and two underlined capital letters describing the families of VR1 and VR2 (e.g., P1.A,C). PorA VR types are underlined to avoid misinterpretation of serosubtypes and PorA VR types as each other.
If an available MAb recognizes an epitope in a particular PorA VR type, the number designation of that MAb is also used to designate that VR amino acid sequence, e.g., P1.7,A (VR1 carries the epitope for serosubtype-defining MAb 7). Sequential letters were used for those VR sequences for which no MAbs are currently available.
For those PorA VR types previously designated serosubtypes (numbers) that are not recognized by any available MAb, we changed the designations from numbers to letters in order of elucidation; e.g., VR2-24 (13) was renamed VR2-D (Table 5) because there is no serosubtype-defining MAb 24 available.
TABLE 5.
Characteristics of porA gene VR nucleotide sequences and PorA VR families and types of N. meningitidis
| VR loop | VR identifiera | PorA VR typeb | Reactivity with MAbsc | Strain | VR nucleotide sequence | VR amino acid sequenced | GenBank accession no. |
|---|---|---|---|---|---|---|---|
| VR1 loop I | 4, 5, 7, 18, 64 | 5 | + | B16B6 | CCGCTCCAA---AATATTCAA---CCTCAG | PLQ-NIQ-PQ | X57182 |
| 4, 19 | 5a | + | 2996 | .........---.........CAA...... | ...-...Q.. | X57180 | |
| 31, 57 | 5b | − | H.276 | ......---CCA.........---...... | ..-P...-.. | U92931 | |
| 65 | 5c | ND | 23042 | .........---......A..CAA...... | ...-..KQ.. | U93899 | |
| 4, 7 | 7 | + | H.44/76 | GCACAAGCCGCTAACGGTGGA------GCGAGCGGTCAGGTAAAAGTTACTAAA | AQAANGG--ASGQVKVTK | X52995 | |
| 35 | 7a | −M | N.230/97 | .....................GCGGGA..................--------- | .......AG......--- | AF051540 | |
| 4, 7, 20, 64 | 7b | −M | Z1318 | .....................------..................--------- | .......--......--- | X77430 | |
| 4 | 7c | (+) | Z4063 | .....................GCGAGA........................... | .......AR......... | X77428 | |
| 20 | 7d | + | M978 | .....................GCGGGA........................... | .......AG......... | U92938 | |
| 64 | 7e | ND | 24955 | .....................GCGGTA........................... | .......AV......... | U93900 | |
| 7, 28 | 12 | + | S3032 | AAGCTCTCAAGCACTAACGCTAAAACGGGCAATAAGGTAGAA | KLSSTNAKTGNKVE | X57178 | |
| 7, 39 | 12a | + | 51/90 | ....C.................................... | .P............ | AF051542 | |
| 64 | 12b | ND | 19747 | ....C............G........................ | .P...K........ | U93898 | |
| 5, 7, 25, 64 | 19 | + | H355 | CCGCCCTCAAAGAGTCAACCTCAGGTAAAA | PPSKSQPQVK | X57177 | |
| 7, 26 | 19a | (+) | L2214 | ..................T........... | ......S... | Z14259 | |
| 29 | 19b | (−) | MC71 | ...................T.......... | ......L... | Z14291 | |
| 5 | 19c | (−) | MC119 | ...G.......................... | .A........ | Z48494 | |
| 4 | 20 | (+) | Z1054 | CAGCCCCAAACCGCTAACACTCAGCAAGGCGGTAAGGTAAAA | QPQTANTQQGGKVK | X77425 | |
| 7, 24, 64 | 22 | (+) | M982 | CAGCCCTCAAAGGCTCAAGGTCAAACGAACAATCAGGTAAAA | QPSKAQGQTNNQVK | X57181 | |
| 1, 23, 64 | 23 | + | 6557 | CAACCCTCAAGAACTCAAGGTCAAACGAGCAATCAGGTAAAA | QPSRTQGQTSNQVK | U92926 | |
| 32 | A | NAA | MC123 | CCCGCTCTCCCAAATATTCAACCTCAG | PALPNIQPQ | Z48495 | |
| 17, 45 | B | NAA | 35E | CCACCCCAAAAAAATCAAAGTCAACCGGTA | PPQKNQSQPV | X57179 | |
| 2 | C | NAA | M981 | CAGCCCCAAGCAACTAACGGTGTGCAAGGCGGTCGGCAAGGCAATCAGGTAACA | QPQATNGVQGGRQGNQVT | U92947 | |
| 33 | D | NAA | MC127 | CCCGCTCCCAAATATTCAACGACGCAG | PAPKYSTTQ | Z48487 | |
| 21, 46 | E | NAA | M990 | CCACCCTCAAAAGGTCAGACGGGCAATAAA | PPSKGQTGNK | X57183 | |
| 22, 36, 47 | Ea | NAA | Z1073 | .........C.................... | ...Q...... | X77423 | |
| 1 | Eb | NAA | N.300/94 | .A................GT.......... | Q.....V... | U92937 | |
| 16 | Ec | NAA | MC105 | ......................CA.TA... | .......AI. | Z14275 | |
| 27, 37, 50 | F | NAA | Z4734 | CAGCCCCAAGTAACTAACGGTGTGCAAGGCAATCAGGTAAAA | QPQVTNGVQGNQVK | X77433 | |
| VR2 loop IV | 7, 8 | 1 | + | M1080 | TATGTGGCGGTGGAAAATGGCGTAGCTAAAAAAGTTGCG | YVAVENGVAKKVA | X57184 |
| 5, 7, 8 | 2 | + | B16B6 | CATTTTGTTCAGCAGACTCCTAAAAGTCAGCCTACTCTCGTTCCG | HFVQQTPKSQPTLVP | X57182 | |
| 15 | 2a | + | 2996 | .....................G....................... | .......E....... | X57180 | |
| 7, 8 | 2b | (−) | MC64 | ...............C............................. | .....P......... | Z14288 | |
| 4, 5, 7 | 2c | + | MC119 | .....................C....................... | .......Q....... | Z48494 | |
| 5 | 2d | (+) | MC133 | ............G................................ | ....E.......... | Z48493 | |
| 1 | 2e | (+) | IH36109 | ..................T.......................... | ......S........ | X78467 | |
| 4, 13 | 3 | + | BB393 | ACTCTTGCTAATGGTGCTAATAATACAATTATTCGCGTTCCG | TLANGANNTIIRVP | U92929 | |
| 7, 8 | 4 | + | Z4008 | CATGTTGTTGTGAATAACAAGGTTGCTACTCACGTTCCG | HVVVNNKVATHVP | U92916 | |
| 2 | 4a | − | N.257/93 | ....................T.................. | ......N...... | U92948 | |
| 4, 7, 8 | 9 | + | M982 | TATGTCGATGAGCAGAGTAAGTATCATGCG | YVDEQSKYHA | X57181 | |
| 3, 4, 7 | 10 | + | H.276 | CATTTTGTTCAGAATAAGCAAAATCAGCGGCCTACTCTCGTTCCG | HFVQNKQNQRPTLVP | U92931 | |
| 3, 7 | 10a | +H | N.1302/95 | ............................C................ | .........P..... | U92939 | |
| 49 | 10b | +H | N.862/95 | ............................A................ | .........Q..... | U92496 | |
| 48 | 10c | (+)H | Z4063 | ......................G...................... | .......S....... | X77428 | |
| 34 | 10d | (−) | 2413 | ........................A..CC................ | ........KP..... | NFf | |
| 61 | 10e | (+) | MC117 | ...........................T..G.............. | .........WA.... | Z48488 | |
| 62 | 10f | (+) | MC127 | .......C......................G.............. | ..A.......A.... | Z48487 | |
| 63 | 10g | (+) | MC123 | ..............................G.............. | ..........A.... | Z48495 | |
| 6, 7 | 13 | +, −e | 24/90 | TATTGGACTACTGTGAATACCGGTAGTGCTACTACTACTACTACT------------TTCGTTCCG | YWTTVNTGSATTTTT----FVP | Z48021 | |
| 4, 6, 7, 14, 64 | 13a | −, +e | 51/90 | ..........................................---------------......... | ..............-----... | AF051542 | |
| 40 | 13b | −, +e | 138/91 | .......T..................................---------------......... | ..I...........-----... | Z48015 | |
| 7 | 13c | ND, NDe | NM | ..................................T.......---------------......... | ...........I..-----... | NF | |
| 51 | 13d | NDg, NTe | INH36117 | .......................................------------------......... | .............------... | X78802 | |
| 66 | 13e | −, −e | N.19/93 | .............................................ACT---------......... | ...............T---... | U92923 | |
| 1, 41 | 13f | −, −e | 98/90 | .............................................ACTACTACTACT......... | ...............TTTT... | Z48033 | |
| 68 | 13g | ND, NDe | 25828 | .............................................ACTACTACT---......... | ...............TTT-... | U93907 | |
| 1, 52, 71 | 14 | + | S3446 | TATGTGGATGAGAAGAAA---ATGGTTCATGCG | YVDEKK-MVHA | U92919 | |
| 2 | 14a | − | N.361/97 | .................GAAG............ | ......K.... | AF051541 | |
| 72 | 14b | − | 7967 | ND | ......K-... | NF | |
| 72 | 14c | + | 8659 | ND | .....N-.... | NF | |
| 7, 11, 70 | 15 | + | H355 | CATTATACTAGGCAGAACAATGCTGATGTTTTCGTTCCG | HYTRQNNADVFVP | X57177 | |
| 8 | 15a | (+) | L2488 | .....................A................. | .......T..... | Z14264 | |
| 7, 10 | 15b | (+) | L2214 | .....................AT................ | .......I..... | Z14260 | |
| 4, 7, 8, 9 | 16 | + | H44/76 | TATTATACTAAGGATACAAACAATAAT------CTTACTCTCGTTCCG | YYTKDTNNN--LTLVP | X52995 | |
| 2 | 16a | − | N.105/93 | .............G..A.......GC.------............... | ....GK..A--..... | U92930 | |
| 7, 8, 30 | 16b | (+) | MC104 | ............A.............------............... | ....N....--..... | Z14274 | |
| 30 | 16c | (+) | 104/84 | ND | -........--...@@ | NF | |
| 67 | 16d | ND | 19649 | ...............A....G.....------............... | .....K.D.--..... | U93901 | |
| 64 | 16e | ND | 20788 | ..........................CAATAAT............... | .........NN..... | U93902 | |
| 69 | 16f | ND | 26209 | ...............A....G...G------............... | .....K.DK--..... | U93908 | |
| 12, 53 | A | NAA | M990 | ACTTATACTGTGGATAGTAGTGGTGTTGTTACTCCCGTTCCT | TYTVDSSGVVTPVP | X57183 | |
| 38 | B | NAA | Z4084 | CATTGGAATACTGTGTATAACACTAACGGTACTACTACTACTTTCGTTCCG | HWNTVYNTNGTTTTFVP | X77432 | |
| 2 | C | NAA | 503/93 | CATTTTGTTCAGAATAAGCAAAATAAGCAAAATCAGCCGCCTACTCTCGTTCCG | HFVQNKQNKQNQPPTLVP | U92922 | |
| 55 | D | NAA | NM | ND | TLANVANTNIGVP | NF | |
| 44 | E | NAA | NM | ND | HFVADSQGKITRVP | NF | |
| 43 | F | NAA | NM | ND | YYYTTATNSSTSTTFVP | NF | |
| 58 | G | NAA | 2401 | CATTTTGTTCAGGATAAGAAAGGTCAGCCGCCTACTCTCGTTCCG | HFVQDKKGQPPTLVP | NF | |
| 59 | H | NAA | Z4272 | ND | HFVQNKQNKQNQPPTLVP | NF | |
| 60 | I | NAA | 2403 | CATTTTGTTCAGAATAAGCAAAATCAGCAAAATCAGCAAAATCAGCCGCCTACTCTCGTTCCG | HFVQNKQNQQNQQNQPPTLVP | NF | |
| 56 | J | NAA | NM | TATTATACTACTGTGACTCAGGGTAGTGCTACTACCACTACTTTCGTTCCG | YYTTVTQGSATTTTFVP | NF | |
| 54 | K | NAA | NM | ND | YVDEKQVSHA | NF | |
| SVR1 loop V | 42 | 6 | + | M990 | GATGCTTTTAATTTGTTCTTGCTTGGGCGCATCGGCGAGGGTGATGAA | DAFNLFLLGRIGEGDE | X57183 |
| 1 | 6a | + | 6940 | ........................................A....... | .............D.. | U92915 | |
| 1 | 6b | − | BB393 | ......................................T.A....... | ............DD.. | U92929 | |
| 1 | A | NAA | B16B6 | GATGCTTTTGAGTTGTTCTTGCTCGGCAGC---GGGAGT---GATGAA | DAFELFLLGS-GS-DE | X57182 | |
| 1 | Aa | NAA | M1080 | ..............................---......---...C.. | ..........-..-.Q | X57184 | |
| 1 | Ab | NAA | S3032 | A....................A........---......---...C.. | N......I..-..-.Q | X57178 | |
| 1 | Ac | NAA | H355 | ..............................---AC....---...... | ..........-T.-.. | X57177 | |
| 1 | Ad | NAA | MC117 | A.............................---CCC...AGT...C.. | N.........-P.S.Q | Z48488 | |
| 1 | Ae | NAA | MC127 | A.............................GCGAC....---...... | N.........AT.-.. | Z48487 | |
| 1 | Af | NAA | MC133 | A.............................---......---...... | N.........-..-.. | Z48493 | |
| 1 | Ag | NAA | MC125 | A.............................---......---...C.. | N.........-..-.Q | Z48485 | |
| 1 | Ah | NAA | MC130 | A.............................---AC....---...... | N.........-T.-.. | Z48492 | |
| 2 | B | NAA | N.34/94 | AATGCTTTTGAGTTGTTCTTGATCGGCAGCGCGACGAGTGATCAA | NAFELFLIGSATSDQ | U92925 | |
| 2 | Ba | NAA | N.300/94 | A....................A....................G.. | ..............E | U92937 | |
| 1 | Bb | NAA | Z1040 | .....................A....................G.. | D.............E | X77422 | |
| SVR2 loop VI | 1 | A | NAA | H355 | GGCGACAAAGCC | GDKA | X57177 |
| 1 | B | NAA | 2996 | GCCGAC | AD | X57180 | |
| 1 | Ba | NAA | B16B6 | .G.... | G. | X57182 |
VR identifiers: 1, PorA VR sequence named or renamed in this work; 2, new PorA VR sequence determined and named in this work; 3, VR designation corresponding to that of Suker et al. (29); 4, VR designation corresponding to that of Suker et al. (28); 5, VR designation corresponding to that of Brooks et al. (7); 6, VR designation corresponding to that of Wedege et al. (35); 7, VR designation corresponding to that of Feavers et al. (13); 8, VR, designation corresponding to that of McGuinness et al. (19); 9, VR2-16, originally named VR2-16a by Rosenqvist et al. (23); 10, VR2-15b, old designation was VR2-15c (19); 11, VR2-15, old designation was VR2-15b (7, 19); 12, VR2-A, old designation was VR2-X (19); 13, VR2-3, old designation was VR2-Y (19); 14, VR2-13a, old designation was VR2-Z (19); 15, VR2-2 and VR2-2a, previously named VR2-2a (19); 16, VR1-Ec, old designation was VR-1D (19); 17, VR1-B, old designation was VR1-E (19); 18, VR1-5, old designation was VR1-B2 (19); 19, VR1-5a, old designation was VR1-B3 (19); 20, VR1-7b and VR1-7d, originally named VR1-7 (19); 21, VR1-E, old designation was VR1-F (19); 22, VR1-Ea, old designation was VR1-G (19); 23, VR1-23, old designation was VR1-22a (13); 24, VR1-22, old designation was VR1-H (19); 25, VR1-19, old designation was VR1-I1 (19); 26, VR1-19a, old designation was VR1-I2 (19); 27, VR1-F, old designation was VR1-C (19); 28, VR1-12, old designation was VR1-A (19); 29, VR1-19b, old designation was VR1-I3 (19); 30, VR designation corresponding to that of Rosenqvist et al. (23); 31, VR1-5b, old designation was VR1-B1 (19); 32, VR1-A, old designation was VR1-5b (7); 33, VR1-D, old designation was VR1-29 (7); 34, VR2-10d, old designation was VR2-10g (13, 29); 35, VR1-7a, old designation was VR1-7d (28); 36, VR1-Ea, old designation was VR1-18a (28); 37, VR1-F, old designation was VR1-21 (28); 38, VR2-B, old designation was VR2-23 (28); 39, VR1-12a, old designation was VR1-12 (35); 40, VR2-13b , old designation was VR2-13a (35); 41, VR2-13f, described previously but not named (35); 42, VR designation corresponding to that of Maiden et al. (17); 43, VR2-F, old designation was VR2-28 (13); 44, VR2-E, old designation was VR2-26 (13), 45, VR1-B, old designation was VR1-17, (4, 13); 46, VR1-E, old designation was VR1-18, (4, 13); 47, VR1-Ea, old designation was VR1-18a (3, 4, 13); 48, VR2-10c, old designation was VR2-10e (28, 29); 49, VR2-10b, old designation was VR2-10c (13, 29); 50, VR1-F, old designation was VR1-21 (4, 13); 51, VR2-13d, old designation was VR2-13e (13); 52, VR2-14, old designation was VR2-27 (4, 13); 53, VR2-A, old designation was VR2-25 (4, 13); 54, VR2-K, old designation was VR2-27a (4, 13); 55, VR2-D, old designation was VR2-24 (13); 56, VR2-J, old designation was VR2-13d (13); 57, VR1-5b, old designation was VR1-5c (4, 13, 29); 58, VR2-G, old designation was VR2-10b (4, 13, 29); 59, VR2-H, old designation was VR2-10d (13, 29); 60, VR2-I, old designation was VR2-10f (13, 29); 61, VR2-10e, old designation was VR2-10h (7); 62, VR2-10f, old designation was VR2-10i (7); 63, VR2-10g, old designation was VR2-10j (7); 64, VR designation corresponding to that of Arhin et al. (4); 65, VR1-5c, old designation was VR1-5d (4); 66, VR2-13e, old designation was VR2-13g (4); 67, VR2-16d, old designation was VR2-16c (4); 68, VR2-13g, old designation was VR2-13f (4); 69, VR2-16f, old designation was VR2-16d (4); 70, VR2-15, old designation was VR2-15b (3); 71, VR2-14, old designation was VR2-14a (27); 72, VR designation corresponding to that of Saunders et al. (27).
PorA VR types were defined as described in Materials and Methods.
Reactivity with MAbs was determined by dot blotting according to the method of Wedege et al. (33). +, positive reaction; (+) not tested in the present study but has been described as positive in the literature; +H, positive reaction when a high concentration of MAb is used (29); (+)H, not tested in the present study but has been described as positive in the literature when a high concentration of MAb is used (29); −, negative reaction; (−), not tested in the present study but has been described as negative in the literature; −M, masked epitope, reactivity is positive only by immunoblotting; NT, not tested against the corresponding MAb; NAA, no antibody available.
VR amino acid sequences were located in relation to the position of the translated porA gene of strain MC50 (accession no. X12899). Amino acid positions of VR1 are 43 to 56, those of VR2 are 195 to 208, those of SVR1 are 247 to 261, and those of SVR2 are 299 to 302. Symbols: −, nucleotide deletion or amino acid deletion; ., nucleotide or amino acid identical to that of the PorA VR prototype; @, part of the amino acid sequence was not described by us and may or may be identical to that of the prototype.
The first-listed datum refers to reactivity with MAb P1.13, and the second-listed datum refers to reactivity with MAb P1.13a.
NF, not found.
ND, not described.
PorA VR types were defined for 97 previously sequenced and 70 newly sequenced porA genes in this study. The proposed PorA VR type designations for all 167 predicted amino acid sequences are described in Table 1. The alignment of these sequences revealed the locations of VR1 and VR2 (12, 17–19, 31). A distance matrix of amino acid sequences for each of these two regions identified 81 distinct PorA VR types, 29 and 52 of which are located in VR1 and VR2, respectively (Table 5).
PorA VR family.
As previously described (28, 29), PorA VR families were defined as all VR types with at least 80% amino acid sequence identity with the prototype VR. The prototype of the VR family was defined as that VR type sequence, of the serosubtype reference strain, that carries the epitope for a particular serosubtype-defining MAb; the prototype then receives the serosubtype-defining MAb name (number). For a PorA VR family not recognized by any available MAb, the prototype was defined as the VR amino acid sequence of the strain first sequenced in that family and was designated with a capital letter. The family and its prototype sequence received the same designation (letter or number). The 81 PorA VR types obtained (5 of which are newly described in this study) were grouped into 34 amino acid sequence families (Table 5).
PorA VR family variant.
The accumulation of mutations in the serosubtype-encoding regions of the porA gene results in VR families that comprise related amino acid sequences (28). These amino acid variant sequences in a VR family were designated as proposed by Suker et al. (28, 29). Distinct members of the same family were distinguished from the prototype VR and from other variants by lowercase letters given in order of elucidation; e.g., VR1-5b is a related variant in the VR1-5 family. A VR amino acid sequence variant with less than 80% sequence relatedness to the prototype of any family was assigned to a new family, in order of elucidation.
In three of the previously described families of related sequences, the VR1-5, VR2-10, and VR2-13 families, a total of five variants showed no reactivity with the corresponding serosubtype-defining MAb (8, 13, 29, 35). Our results showed that those variants display less than 80% amino acid sequence identity to the prototype family sequence as follows: VR1-5b (66%), VR2-10b (73%), VR2-10d (72%), VR2-10f (66%), and VR2-13d (77%). Therefore, we assigned those variants to new families (Table 5).
We did not change the original designations, except where a specific sequence had more than one name in the literature. In these cases, only one designation was retained or a new one was given in order of elucidation (Table 5). For instance, VR2-15b (12) was also named VR2-15c (19). The designation VR2-15b was maintained because the VR2-15 family possesses only the prototype sequence (VR2-15) and two variant sequences (VR2-15a and VR2-15b). Since the detection of PorA VR family variants is not made by immunochemical reactions, we propose the use of additional letters only as part of the PorA VR typing system and not as part of the serosubtyping designation.
PorA VR1-7 family.
The amino acid sequence ASGQ has previously been identified as the epitope for the serosubtype-defining MAb P1.7 (18). This epitope is present as part of six different PorA VR1 sequences, members of the VR1-7 family, which were designated VR1-7, -7a, -7b, -7c, -7d, and -7e in the present study (Table 5). VR1-7b has previously been shown to contain a 3-amino-acid deletion at the carboxy-terminal side of the epitope (34). As a result, the amino acid sequence ASGQ on VR1-7b may be inaccessible for antibody binding when intact cells are examined by dot blotting or enzyme-linked immunosorbent assay (ELISA) methods (34). In this study we demonstrate that VR1-7a also contains this 3-amino-acid deletion at the carboxy-terminal side of the epitope as well as a 2-amino-acid insertion at the amino-terminal side of the epitope (Table 5). Both changes are consistent with the ASGQ epitope being shifted down the side of loop I somewhat closer to the outer membrane, thus masking the epitope with the other loops or with other molecules such as lipopolysaccharide (19, 34).
In this study, we found that four of eight PorA VR1-7b strains reacted weakly with P1.7 MAb by dot blotting. The only PorA VR1-7a strain tested was negative with the P1.7 MAb by dot blotting; however, the P1.7 epitope was demonstrated on an immunoblot after denaturation of the cells with sodium dodecyl sulfate (SDS) (data not shown).
Given that two members of the VR1-7 family present a masked P1.7 epitope and that a reaction with P1.7 MAb in dot blots can present different degrees of reactivity, we suggest caution in the serosubtype designation of strains with such epitopes and care in interpretation of dot blotting results with P1.7 MAb. Additional investigation, such as denaturation of the cells with SDS and PorA VR typing, can be used to identify masked P1.7 epitopes.
SVRs.
PorA SVR amino acid sequences were located in relation to the position of the translated porA gene of strain MC50 (accession no. X12899) at amino acids 247 to 261 (SVR1) and 299 to 302 (SVR2) (5). Because SVR1 had previously been thought to contribute to the specificity of serosubtype-defining MAb P1.6 (MN19D6-13 [19]), we included SVR1 and SVR2 in our analysis (Table 4). We studied the correlation between serosubtype-defining MAb P1.6 reactivity and amino acid sequences of SVR1 families.
A distance matrix of amino acid sequences for each of these two regions identified 18 distinct PorA SVR types, 15 and 3 of which were located in SVR1 and SVR2, respectively (Table 5). The 18 PorA SVR types obtained were grouped into five amino acid sequence families as described above for PorA VR types (Table 5). Our data indicate that SVR1 is related to the location of P1.6 specificity. The SVR1-6 family consists of three members, SVR1-6, SVR1-6a, and SVR1-6b. All strains with P1.6 MAb reactivity possessed either SVR1-6 or SVR1-6a amino acid sequences. The SVR1-6b variant differs from the prototype SVR1-6 sequence by 2 amino acids close to the apex on loop V, which may explain the lack of reactivity with serosubtype-defining MAb P1.6. No other MAb reactivity was found to be related to SVR1 or SVR2 sequences.
Our results confirmed that amino acid variation in SVR1 and SVR2 is limited, indicating that diversity in these regions may not be a source of serosubtype differences among strains (19). We have chosen not to incorporate SVRs and MAb P1.6 into our proposed scheme of designations at this time, even though we show that MAb P1.6 correlates with epitopes at SVR1. We and others believe that insufficient evidence to confirm their usefulness in epidemiologic investigation exists at this time (13, 19). PorA SVR typing may be valuable for comparative studies dealing with the complete PorA protein (8).
Serosubtype-defining MAbs and PorA VR diversity.
Epitope-mapping studies have shown that most of the epitopes recognized by serosubtype-defining MAbs are linear moieties located at the apex of either loop I (VR1) or loop IV (VR2) of PorA. This should, in theory, generate two potential serosubtype specificities within each class 1 protein (18, 19). In practice, many isolates remain non- or only partially serosubtypeable.
To further estimate the diversity of PorA VR types and correlate the types with the current serosubtyping MAb panel, we typed a total of 79 strains representing additional serosubtypes or additional isolates of a serosubtype and serotyping reference strains (Table 1). Our data demonstrate that this panel of 17 MAbs that define serosubtypes detects only 48% (n = 39 [of the total 81]) of known PorA VR types (12 types at VR1 and 27 types at VR2) and 50% (n = 17 [of the total 34]) of the PorA VR families (7 families at VR1 and 10 families at VR2) (Table 5). MAbs for 17 VR families are not available, and 13 VR family variants within some families are not recognized by the current panel of serosubtype-defining MAbs (Table 5). Furthermore, we demonstrated complete correlation between serosubtyping and PorA VR typing with no ambiguity.
New serosubtype-defining MAbs may improve the sensitivity of this method by resolving a number of formerly nonserosubtypeable strains. Predicted PorA VR amino acid sequences can be used to make synthetic peptides as immunogens to prepare new MAbs tailored to regions where no MAbs currently exist. We estimate that approximately 30 additional new MAbs (for 17 families and 13 VR family variants) are needed to cover the diversity of PorA VR1 and VR2 so far characterized (Table 5).
Surveillance will need to continue in order to detect the appearance of new variants. We propose to sequence the porA genes of strains thought to represent new serosubtypes and to compare the predicted PorA VR or SVR nucleotide sequences with those described in this article to avoid misinterpreted designations for new serosubtype-defining MAbs.
Future directions in PorA characterization.
The present work represents the most complete and integrated set of PorA VR sequences (n = 167) and MAb reactivities of meningococci produced to date and serves as a guide for nucleotide or amino acid VR classification. To our knowledge, this collection reflects the diversity of N. meningitidis PorA sequences to date.
This proposed standardization of PorA VR typing nomenclature unifies the system of designations for PorA VR typing while remaining consistent with previously described PorA and PorB VR typing nomenclature (13, 24, 29, 30). Our proposal for VR typing is informative because an amino acid sequence and usually serologic information can be deduced simultaneously from a PorA VR designation. Thus, historical epidemiologic serosubtyping data can be related to results of future studies that will use only the PorA VR typing method. Furthermore, new PorA VR types can be incorporated systematically.
We recommend the continuation of serology as a screening method for PorA epitope characterization, particularly for screening large numbers of samples during epidemics or in field situations lacking specialized equipment. We have found the specificity of serosubtyping comparable to that of PorA VR typing. Strains that fail to react with any available MAb can be referred to specialized laboratories for determination of VR types by direct sequencing. In our hands, direct DNA sequencing produced no ambiguities in assignment of PorA type, unlike the situation described by Feavers et al. (13) in which DNA hybridization was used to estimate PorA diversity. PorA VR typing allows for a more systematic way to evaluate vaccine failures and provides a rational framework for understanding the mechanisms by which these vaccines confer protection, based on a knowledge of the primary sequences. PorA VR typing complements serosubtyping results, and a combination of both methods may be used to completely characterize potential PorA VR epitopes of meningococcal strains.
ACKNOWLEDGMENTS
We thank J. Suker of the NIBSC, L. O. Frøholm of the SIFF, W. D. Zollinger of the WRAIR, and J. T. Poolman of the NIPH for providing some of the MAbs and strains used in this work. We gratefully acknowledge the constructive criticism of E. Wedege.
REFERENCES
- 1.Abdillahi H, Poolman J T. Definition of meningococcal class 1 outer membrane protein subtyping antigens by monoclonal antibodies. FEMS Microbiol Immunol. 1988;47:139. doi: 10.1111/j.1574-6968.1988.tb02366.x. [DOI] [PubMed] [Google Scholar]
- 2.Abdillahi H, Poolman J T. Neisseria meningitidis group B serosubtyping using monoclonal antibodies in whole-cell ELISA. Microb Pathog. 1988;4:27–32. doi: 10.1016/0882-4010(88)90045-9. [DOI] [PubMed] [Google Scholar]
- 3.Arhin F F, Moreau F, Coulton J W, Mills E L. Subtyping of Neisseria meningitidis strains isolated in Quebec, Canada: correlation between deduced amino acid sequences and serosubtyping techniques. Can J Microbiol. 1997;43:234–238. doi: 10.1139/m97-032. [DOI] [PubMed] [Google Scholar]
- 4.Arhin F F, Moreau F, Coulton J W, Mills E L. Sequencing of porA from clinical isolates of Neisseria meningitidis defines a subtyping scheme and its genetic regulation. Can J Microbiol. 1998;44:56–63. [PubMed] [Google Scholar]
- 5.Barlow A K, Heckels J E, Clarke I N. The class 1 outer membrane protein of Neisseria meningitidis: gene sequence and structural and immunological similarities to gonococcal porins. Mol Microbiol. 1989;3:131–139. doi: 10.1111/j.1365-2958.1989.tb01802.x. [DOI] [PubMed] [Google Scholar]
- 6.Boslego J, Garcia J, Cruz C, et al. Efficacy, safety, and immunogenicity of a meningococcal vaccine group B (15:P1.3) outer membrane protein vaccine in Iquique, Chile. Chilean National Committee for Meningococcal Disease. Vaccine. 1995;13:821–829. doi: 10.1016/0264-410x(94)00037-n. [DOI] [PubMed] [Google Scholar]
- 7.Brooks J L, Rosenqvist E, Bjune G, Lambden P R, Heckels J E. Comparasion of the class-1 outer membrane protein from B:15:P1.16 Neisseria meningitidis strains isolated from patients previously immunized with a serogroup B outer membrane vaccine in Norway. Microb Pathog. 1994;17:425–430. doi: 10.1006/mpat.1994.1087. [DOI] [PubMed] [Google Scholar]
- 8.Brooks J L, Fallon R J, Heckels J E. Sequence variation in class 1 outer membrane protein in Neisseria meningitidis isolated from patients with meningococcal infection and close household contacts. FEMS Microbiol Lett. 1995;128:145–150. doi: 10.1111/j.1574-6968.1995.tb07514.x. [DOI] [PubMed] [Google Scholar]
- 9.Butcher S, Sarvas M, Runeberg-Nyman K. Class-3 porin protein of Neisseria meningitidis: cloning and structure of the gene. Gene. 1991;105:125–128. doi: 10.1016/0378-1119(91)90523-e. [DOI] [PubMed] [Google Scholar]
- 10.Devereux J P, Haeberli P, Smithies O. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 1984;12:387–395. doi: 10.1093/nar/12.1part1.387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Feavers I M, Heath A B, Bygraves J A, Maiden M C J. Role of horizontal genetic exchange in the antigenic variation of the class 1 outer membrane protein of Neisseria meningitidis. Mol Microbiol. 1992;6:489–495. doi: 10.1111/j.1365-2958.1992.tb01493.x. [DOI] [PubMed] [Google Scholar]
- 12.Feavers I M, Suker J, McKenna A J, Heath A B, Maiden M C J. Molecular analysis of the serotyping antigens of Neisseria meningitidis. Infect Immun. 1992;60:3620–3629. doi: 10.1128/iai.60.9.3620-3629.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Feavers I M, Fox A J, Gray S, Jones D M, Maiden M C J. Antigenic diversity of meningococcal outer membrane protein PorA has implications for epidemiological analysis and vaccine design. Clin Diagn Lab Immunol. 1996;3:444–450. doi: 10.1128/cdli.3.4.444-450.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Frasch C E, Zollinger W D, Poolman J T. Serotype antigens of Neisseria meningitidis and a proposed scheme for designation of serotypes. J Infect Dis. 1985;7:504–510. doi: 10.1093/clinids/7.4.504. [DOI] [PubMed] [Google Scholar]
- 15.Guillen G, Alvarez A, Lemos G, Paredes T, Silva R, Mart A. Comparison of the DNA sequence of nine different genes for the class 1 outer membrane protein from Neisseria meningitidis. Biotecnol Apl. 1993;10:108–113. [Google Scholar]
- 16.Hitchcock P J. Unified nomenclature for pathogenic Neisseria species. Clin Microbiol Rev. 1989;2:S64–S65. doi: 10.1128/cmr.2.suppl.s64. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Maiden M C, Suker J, McKenna A J, Bygraves J A, Feavers I M. Comparison of the class 1 outer membrane proteins of eight serological reference strains of Neisseria meningitidis. Mol Microbiol. 1991;5:727–736. doi: 10.1111/j.1365-2958.1991.tb00743.x. [DOI] [PubMed] [Google Scholar]
- 18.McGuinness B T, Barlow A K, Clarke I N, Farley J E, Anilionis A, Poolman J T, Heckels J E. Deduced amino acid sequences of class 1 protein (PorA) from 3 strains of Neisseria meningitidis: synthetic peptides define the epitopes responsible for serosubtype specificity. J Exp Med. 1990;171:1871–1882. doi: 10.1084/jem.171.6.1871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.McGuinness B T, Lambden P R, Heckels J E. Class 1 outer membrane protein of Neisseria meningitidis: epitope analysis of the antigenic diversity between strains, implications for subtype definition and molecular epidemiology. Mol Microbiol. 1993;7:505–514. doi: 10.1111/j.1365-2958.1993.tb01141.x. [DOI] [PubMed] [Google Scholar]
- 20.Moraes J C, Perkins B A, Camargo M C C, et al. Protective efficacy of a serogroup B meningococcal vaccine in São Paulo, Brazil. Lancet. 1992;340:1074–1078. doi: 10.1016/0140-6736(92)93086-3. [DOI] [PubMed] [Google Scholar]
- 21.Peeters C C A M, Rumke H C, Sundermann L C, Rouppe van der Voort E M, Meulenbelt J, Schuller M, Kuipers A J, van der Ley P, Poolman J T. Phase I clinical trial with a hexavalent PorA containing meningococcal outer membrane vesicle vaccine. Vaccine. 1996;14:1009–1015. doi: 10.1016/0264-410x(96)00001-1. [DOI] [PubMed] [Google Scholar]
- 22.Perkins B A, Jonsdottir K, Briem H, et al. Immunogenicity of two efficacious outer membrane protein-based serogroup B meningococcal vaccines among young adults in Iceland. J Infect Dis. 1998;177:683–691. doi: 10.1086/514232. [DOI] [PubMed] [Google Scholar]
- 23.Rosenqvist E, Høiby E A, Wedege E, Caugant D A, Frøholm L O, McGuinness B T, Brooks J, Lambden P R, Heckels J E. A new variant of serosubtype P1.16 in Neisseria meningitidis from Norway, associated with increased resistance to bactericidal antibodies induced by a serogroup B outer membrane protein vaccine. Microb Pathog. 1993;15:197–205. doi: 10.1006/mpat.1993.1070. [DOI] [PubMed] [Google Scholar]
- 24.Sacchi C T, Lemos A P S, Whitney A M, Solari C A, Brandt M E, Melles C E A, Frasch C E, Mayer L W. Correlation between serological and sequencing analyses of the PorB outer membrane protein in the Neisseria meningitidis serotyping system. Clin Diagn Lab Immunol. 1998;5:348–354. doi: 10.1128/cdli.5.3.348-354.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Saukkonen K, Abdillahi H, Poolmam J T, Leinonem M. Protective efficacy of monoclonal antibodies to class 1 and 3 outer membrane proteins of Neisseria meningitidis B:15:P1.16 in infant rat infection model: new prospects for vaccine development. Microb Pathog. 1987;3:261–267. doi: 10.1016/0882-4010(87)90059-3. [DOI] [PubMed] [Google Scholar]
- 26.Saunders N B, Zollinger W D, Rao V B. A rapid and sensitive PCR strategy employed for amplification and sequencing of porA from a single colony-forming unit of Neisseria meningitidis. Gene. 1993;7:153–162. doi: 10.1016/0378-1119(93)90001-j. [DOI] [PubMed] [Google Scholar]
- 27.Saunders N B, Brandt B L, Warren R L, Hansen B D, Zollinger W D. Immunological and molecular characterization of three variant subtype P1.14 strains of Neisseria meningitidis. Infect Immun. 1998;66:3218–3222. doi: 10.1128/iai.66.7.3218-3222.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Suker J, Feavers I M, Achtman M, Morelli G, Wang J-F, Maiden M C J. The porA gene in serogroup A meningococci: evolution stability and mechanism of genetic variation. Mol Microbiol. 1994;12:253–265. doi: 10.1111/j.1365-2958.1994.tb01014.x. [DOI] [PubMed] [Google Scholar]
- 29.Suker J, Feavers I M, Maiden M C J. Monoclonal antibody recognition of members of the meningococcal P1.10 variable region family: implications for serological typing and vaccine design. Microbiology. 1996;142:63–69. doi: 10.1099/13500872-142-1-63. [DOI] [PubMed] [Google Scholar]
- 30.Tsai C M, Frasch C E, Mocca L F. Five structural classes of major outer membrane proteins in Neisseria meningitidis. J Bacteriol. 1981;146:69–78. doi: 10.1128/jb.146.1.69-78.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.van der Ley P, Heckels J E, Virji M, Hoogerhout P, Poolman J T. Topology of outer membrane porins in pathogenic Neisseria spp. Infect Immun. 1991;59:2963–2971. doi: 10.1128/iai.59.9.2963-2971.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.van der Ley P, van der Biezen J, Hohenstein P, Peeters C, Poolman J T. Use of transformation to construct antigenic hybrids of the class 1 outer membrane protein in Neisseria meningitidis. Infect Immun. 1993;61:4217–4224. doi: 10.1128/iai.61.10.4217-4224.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wedege E, Høiby E A, Rosenqvist E, Frøholm L O. Serotyping and subtyping of Neisseria meningitidis isolates by co-agglutination, dot-blotting and ELISA. J Med Microbiol. 1990;31:195–201. doi: 10.1099/00222615-31-3-195. [DOI] [PubMed] [Google Scholar]
- 34.Wedege E, Dalseg R, Caugant D A, Poolman J T, Frøholm L O. Expression of an inaccessible P1.7 subtype epitope on meningococcal class 1 proteins. J Med Microbiol. 1993;38:23–28. doi: 10.1099/00222615-38-1-23. [DOI] [PubMed] [Google Scholar]
- 35.Wedege E, Kolberg J, Delvig A, Høiby E A, Holten E, Rosenqvist E, Caugant D A. Emergence of a new virulent clone within the electrophoretic type 5 complex of serogroup B meningococci in Norway. Clin Diagn Lab Immunol. 1995;2:314–321. doi: 10.1128/cdli.2.3.314-321.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wedege E, Caugant D A, Zollinger W D. Abstracts of the Tenth International Pathogenic Neisseria Conference 1996. 1996. P1.19 specificity of a previous P1.15 reference monoclonal antibody demonstrated by blotting methods, porA sequencing and peptide mapping, abstr. 202; p. 538. [Google Scholar]