Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 2.
Published in final edited form as: Curr Res Virol Sci. 2022 Jun 20;3:100023. doi: 10.1016/j.crviro.2022.100023

CRISPR-Cas9 Expressed in Stably Transduced Cell Lines Promotes Recombination and Selects for Herpes Simplex Virus Recombinants

Hyung Suk Oh 1, Fernando M Diaz 1,*, Changhong Zhou 1, Nicholas Carpenter 1,+, David M Knipe 1,#
PMCID: PMC9629518  NIHMSID: NIHMS1837947  PMID: 36330462

Abstract

Recombinant herpes simplex virus strains can be constructed by several methods, including homologous recombination, bacterial artificial chromosome manipulation, and yeast genetic methods. Homologous recombination may have the advantage of introducing fewer genetic alterations in the viral genome, but the low level of recombinants can make this method more time consuming if there is no screen or selection. In this study we used complementing cell lines that express Cas9 and guide RNAs targeting the parental virus to rapidly generate recombinant viruses. Analysis of the progeny viruses indicated that CRISPR-Cas9 both promoted recombination to increase recombinant viruses and selected against parental viruses in the transfection progeny viruses. This approach can also be used to enrich for recombinants made by any of the current methods.

Introduction

Recombinant viral vectors have many applications for gene delivery for immunization and gene therapy due to their ability to transduce various cell types. Adenoviruses have been used as a vaccine platform including recent COVID vaccines (Coughlan et al., 2022; Zhang and Zhou, 2016), and adeno-associated viruses are utilized widely as gene therapy vectors (Lugin et al., 2020; Wang et al., 2019). Herpes simplex virus (HSV) has a large (>150kbp), linear, double-stranded DNA genome, and it has gained attention as a gene therapy and vaccine vector due to its broad cell tropism including neurons and its large gene delivery capacity (Goins et al., 2020). Several methods have been used to engineer recombinant HSV genomes (Knipe et al., 2021). First, for homologous recombination, infectious viral DNA is co-transfected into permissive cells along with a linearized DNA cassette encoding mutation(s) or gene(s) of interest flanked by regions of homology to the viral genome. Homologous recombination leads to the introduction of the sequences from the plasmid into the viral genome. Second, the donor plasmid can be transfected into cells followed by infection with virus, and homologous recombination then yields recombinant viruses. However, the efficiency of cellular homologous recombination to introduce mutations to viral DNA can limit these approaches, and multiple rounds of plaque purification are needed. Third, bacterial artificial chromosomes (BACs) containing the viral genome can be readily modified in bacteria, and introduction of the BAC into mammalian cells leads to a pure recombinant. This technique may be limited by changes in the viral sequences in bacteria (Gierasch et al., 2006; Horsburgh et al., 1999; Tanaka et al., 2003). In addition, HSV genomes can be modified using yeast genetics (Oldfield et al., 2017), but this has not yet been used broadly. Further developments could improve these methods for the rapid generation of HSV recombinant vectors.

The CRISPR (Clustered regularly-interspaced short palindromic repeats)/Cas9 system can induce site-specific DNA double-stand breaks (DSBs) adjacent to protospacer adjacent motifs (PAM) through its guide RNA (gRNA)-Cas9 complex (Jinek et al., 2012). The DNA cleavage triggers cellular DNA repair systems including homology-directed recombination/repair (HDR) and error-prone non-homologous end joining (NHEJ). During NHEJ, random deletions and insertions can occur (Cong et al., 2013; Doudna and Charpentier, 2014; Mali et al., 2013). Alternatively, HDR occurs using homologous DNA template, which introduces insertion of mutation(s) and gene(s) of interest (GOIs) at the cleavage site. CRISPR/Cas9 has been shown to increase the efficiency of mutagenesis of large viral DNA genomes such as the herpesviruses, adenoviruses, and poxviruses (Bi et al., 2014; Lin et al., 2016; Russell et al., 2015; Suenaga et al., 2014; Van Cleemput et al., 2021). These studies were largely performed by transfection of donor DNA and infection of parental virus, and there has been little study of the effect of CRISPR/Cas9 on co-transfected HSV genomes and donor plasmids.

We have used co-transfection methods to generate HSV-1 recombinants (Knipe et al., 1979; Knipe et al., 1978), vaccines (Da Costa et al., 2000), and vaccine vectors (Murphy et al., 2000). Furthermore, our laboratory has used an HSV-1 recombinant virus, d106 (Samaniego et al., 1998), as a vaccine vector (Liu et al., 2009; Watanabe et al., 2009). HSV-1 d106 expresses only the viral ICP0 immediate-early protein, which counters host cell epigenetic silencing (Cliffe and Knipe, 2008), to allow expression from the viral genome. Because CRISPR/Cas9 can induce DSBs, which could enhance HDR between d106 and a shuttle plasmid due to the DSBs and/or via cleavage of the parental d106 viral genome, we hypothesized that the CRISPR/Cas9 system can facilitate genetic modification of d106. To test this, we generated cell lines stably expressing gRNA(s) and Cas9 that target a site in the d106 genome where we want to introduce transgene-encoding DNA. Using these cell lines, we observed that the frequency of recombinants increased by more than 100-10000-fold, which allows the rapid isolation of recombinant viruses. Our results indicated that CRISPR/Cas9 both increases recombination and selects against parental genomes.

Results

Construction of a shuttle plasmid and generation of CRISPR/Cas9 cell lines

To facilitate the isolation of recombinant viruses in cells co-transfected with the HSV-1 d106S viral genome and a shuttle plasmid pd27B (Liu et al., 2009, Fig. 1A), we designed guide RNAs (gRNA-1, −2, and −3) that targeted sequences between the UL53 and UL54 genes in the d106S genome, where a GOI can be inserted using pd27B (Fig 1B). Because pd27B also contains these gRNA target sequences, we mutated pd27B to prevent cleavage induced by Cas9 and gRNAs (Fig. 1C). To replace the gRNA-targeting sequences in pd27B, we synthesized a double-stranded DNA molecule (gBlock) containing multiple mutations in gRNA recognition sites in pd27B (Fig 1A). Because the d106S virus requires complementing cells (E11) to grow, we generated E11 cell lines that express no gRNA (as a control), single (#1, 2, and 3) or all three (#1+2+3) gRNAs with Cas9 using lentivirus transduction and confirmed the expression of Cas9 in all the lentivirus-transduced cell lines using immunoblotting (Fig. 2A). Previously, we showed that CRISPR/Cas9-induced HSV-1 genome cleavage can reduce viral replication (Oh et al., 2019). Therefore, to validate the functional activity of gRNA/Cas9 in E11 cell lines, we infected gRNA/Cas9 expressing cells with d106S virus at multiplicities of infection (MOI) of 0.1 or 0.01, harvested progeny virus at 48 h post infection (hpi), and determined the viral yields by plaque assay on E11 cells. All four cell lines showed a 4-12-fold reduction in viral yield compared to the parental E11 and gRNA control cells (Fig. 2B). These results indicated that our gRNAs/Cas9 are functionally active to cleave their target sites in HSV-1 genome and can reduce viral replication.

Figure 1. Schematic diagram of the gRNA target sites in the plasmid shuttle vector.

Figure 1.

Open in a new tab

(A) Diagrams of d106S genome and pd27B shuttle vector. The clear boxes show the repeated sequences and the red lines indicate deleted sites of ICP22, ICP27, and two ICP4. The deleted ICP27 (UL54) location is represented in two angled lines. The expended map represents details of organization of sequences including CMV promoter (CMVp, light red), GFP (green), poly-A tail (poly-A, light blue), and HSV-1 sequences of UL54 and UL53 (gray). GFP gene can be replaced with Gene of Interest (GOI, in this study, mCherry, EBOV-GP, or SARS-CoV-2 spike) by homologous recombination with the shuttle vector of pd27B. (B) Sequences shown are the original sequence in pd27B plasmid (top) and synthesized gBlock sequence (bottom). The targeting regions for three gRNAs (gRNA-1, −2, and −3) in the pd27B shuttle plasmid are indicated by the blue arrow lines. Homologous sequences are shown in black bars and nucleic acids define the differences between pd27B and gBlock (also pd27Bmut). (C) Maps of the original shuttle plasmid (pd27B) and mutated shuttle plasmid (pd27Bmut). pd27B has flanking homologous sequences (UL54 and UL53) to HSV-1 DNA, CMVp (light red), GOI (light brown), and poly-A (light blue). Alterations in the three gRNA sequences located near the 5’ end of the UL53 gene were introduced into pd27mut using the gBlock (yellow). Co-transfection of pd27Bmut and d106S genome to complementing cell line E11 produces GOI inserted d106S virus.

Figure 2. Effects of CRISPR/Cas9 on HSV-1 replication in different gRNA cell lines.

Figure 2.

Open in a new tab

(A) Expression of Cas9 in the various cell lines. E11 cells transduced with lentiviruses expressing SaCas9 and sgRNA were harvested to yield lysates, and Cas9-FLAG was detected in the lysates by immunoblotting using antibodies specific for FLAG. Immunoblots of GAPDH are shown as a loading control. (B) Replication of d106S virus in the Cas9/gRNA cell lines. Parental E11 and gRNA/Cas9 expressing E11 cells (#1, #2, #3, and #1+2+3) were infected with wildtype HSV-1 (MOI of 0.1 or 0.01), harvested at 48 hpi, and viral titers were determined by plaque assay. -gRNA: Cells expressing Cas9 but no gRNA. The graph shows the mean values and standard errors from three biological replicate experiments and log-transformed data were analyzed by one-way ANOVA with Tukey’s multiple comparisons test. Statistical significance relative to -gRNA control is presented. * p<0.05, *** p<0.001, and **** p<0.0001.

CRISPR/Cas9-mediated recombination of d106S

HSV-1 d106 contains deletions of immediate-early (IE) genes or regulatory regions, including ICP4, ICP22, ICP27, and ICP47 (Samaniego et al., 1998). The pd27B shuttle vector plasmid contains sequences from the HSV-1 UL53 and UL54 genes that serve as flanking sequences for recombination of a GOI into the ICP27 locus (Fig 1A). HSV-1 d106 has a GFP gene (enhanced GFP from Clontech plasmid pEGFP-C1 plasmid) in the ICP27 gene deletion site, and recombination between pd27B containing GOI (in this study, GOI is either mCherry, EBOV-GP, or SARS-CoV-2 spike) and d106S replaces GFP with the GOI resulting in GFP-negative virus plaques. Therefore, GFP-negative plaques are GOI containing d106 candidates to isolate and analyze its recombination.

To evaluate the effects of CRISPR/Cas9 on recombinant virus formation, we examined recombinant virus production in cells co-transfected with d106S DNA and linearized pd27Bmut-mCherry shuttle plasmid expressing mCherry, or pd27Bmut-EBOV-GP expressing Ebola virus GP protein, into the various individual cell lines expressing gRNA(s) and Cas9. To quantify the levels of parental versus recombinant viruses, we harvested the co-transfected cell progeny viruses at 7 d post infection (dpi) and performed plaque assay to measure GFP-positive and GFP-negative viruses. From control cell lines (E11 and E11 no gRNA cell lines), we observed 100-1000-fold more GFP-positive than GFP-negative progeny viruses, resulting in less than 1% GFP-negative or recombinant virus (Fig. 3A and B). In contrast, from #1 or #3 gRNA-expressing cell lines, we detected 5-68-fold more GFP-negative viruses than from the control cell lines and 2-5-fold fewer GFP-positive viruses compared to the control cell lines, resulting in 3-11% GFP-negative progeny viruses (Fig. 3A and B). From #2 gRNA-expressing cells, we detected 4-83-fold more GFP-negative viruses but 76-170-fold reduced GFP-positive viruses, resulting in 68.2% GFP-negative viruses (Fig. 3A and B). From #1+2+3 gRNA-expressing cells, we detected 2-16-fold more GFP-negative progeny viruses and 1700-3200 fewer GFP-positive viruses than control cells, resulting in 89.7% GFP-positive progeny viruses (Fig. 3A and B). Therefore, CRISPR-Cas9 promotes recombinant formation while reducing parental virus in the progeny from the co-transfected cells.

Figure 3. Effect of CRISPR/Cas9 on Viral Progeny from Co-Transfected Cultures.

Figure 3.

Open in a new tab

Viral d106S DNA and linearized shuttle plasmid were co-transfected and harvested at 7 dpi. GFP-positive (parental d106S) plaques and GPF-negative (recombinant virus, either mCherry or EBOV-GP) plaques in the harvested virus were counted in serial dilutions of the progeny virus from the various transfection progeny. (A) The numbers of GFP-positive and -negative plaques in the various transfection progeny are shown. (B) The percentages of GFP-negative viruses were calculated for each sample. Cells #1, #2, #3, and #1+2+3 indicate gRNA-expressing cell lines that were used for co-transfection of d106S and a shuttle plasmid. -gRNA: Cells with Cas9 but no gRNA. The graph shows the mean values and standard errors from combined two biological replicate experiments with one-way ANOVA with Tukey’s multiple comparisons test, ** p<0.01 and *** p<0.001.

To validate the structure of the GFP-negative recombinants generated by the CRISPR/Cas9 selection, we used our system to construct recombinant d106S vectors expressing SARS-CoV-2 spike protein. To this end, we constructed the pd27mut-COV2-S shuttle plasmid with a SARS-CoV-2 spike protein expression cassette, and we transfected d106S DNA and linearized pd27mut-COV2-S plasmid into #1+2+3 gRNA/Cas9 cells and harvested the progeny virus at 5 d after transfection. We found that most of the plaques were GFP-negative. To verify the insertion sites and integrity of the transgene in the recombinant d106S-vectored virus, we isolated 16 plaques and infected E11 cells with the plaque-purified viruses. Two sets of primers were used for PCR amplification of the SARS-CoV-2 virus spike gene and the flanking sequences in the recombinant virus from the infected cell DNA. Nearly all the clones (14 of 16) of plaque-isolated virus showed an amplified fragment of about 3900 bp (Fig. 4A), and the primers for the 5’ and 3’ conjunction areas also amplified fragments of expected size (results not shown). The sequences of the PCR products were verified by sequencing. Spike protein expression of the isolated virus was confirmed by infecting human foreskin fibroblast (HFF) cells and immunoblotting of the infected cell lysate with an antibody against the SARS-CoV-2 virus spike protein (Fig. 4B). Over 83% of the isolated GFP-negative plaques expressed the correct size of spike protein. These results confirmed that our CRISPR/Cas9-mediated d106S mutagenesis system is highly efficient and robust enough to minimize the time needed for isolation of recombinant d106S vectors.

Figure 4. Verification of the integrity and expression of the transgene in d106S recombinants.

Figure 4.

Open in a new tab

(A) Verification of transgene in the HSV-1 d106S recombinants. E11 cells were infected with recombinant d106S-CoV2-S or the d106S vector at an MOI of 10. Total DNA from the infections was isolated, and PCR was carried out on the DNA with primers specific for SARS-CoV2 spike gene within the recombinant virus. (B) Immunoblotting for SARS-CoV-2 virus spike protein in infected cell lysates. Human foreskin fibroblast (HFF) cells were infected with each purified clone of the d106S-CoV2-S recombinants. Infected cells were harvested at 24 hpi. Proteins in the cell lysate were separated by SDS-PAGE and probed with a rabbit antibody for the SARS-CoV-2 spike protein as the primary antibody. Antibody for the GAPDH protein was used as a loading control.

Based on these results, we concluded that our designed gRNAs/Cas9 are functional and their expressing cell lines can reduce HSV-1 replication resulting in significant reduction of transfected parental viral genome recovery and promotion of recombination of the parental HSV genome and a co-transfected shuttle vector. These results support the idea that CRISPR-induced DNA break can facilitate HDR-mediated mutagenesis of HSV-1 genome in the regions of gRNA targeting site. Therefore, this CRISPR/Cas9 system can greatly increase the efficiency of recombinant virus generation in co-transfected cells.

Discussion

In this study, we demonstrated that CRISPR/Cas9 can facilitate the isolation of recombinants in HSV-1 using Cas9- and gRNA-expressing cell lines. Several methods are commonly used to modify HSV genome, including co-transfection of viral DNA and a donor plasmid, transfection of the donor plasmid followed by infection, and genetic manipulation of a bacterial artificial chromosome containing a copy of the viral genome, and then transfection into cells. Recent studies have shown that CRISPR/Cas9 can increase the efficiency of mutagenesis of large viral DNA genomes (Borca et al., 2018; Suenaga et al., 2014; Tang et al., 2021). However, most of the previous studies were performed by transfection of donor DNA and infection of parental virus (Lin et al., 2016; Russell et al., 2015; Van Cleemput et al., 2021). In these studies, we tested co-transfection of HSV genome and donor DNA in Cas9- and gRNA- expressing cell lines. Our results showed that this co-transfection method could enhance the efficiency of recombination of the HSV-1 genome, and isolation of pure recombinants could be accomplished with a single round of plaque purification.

Mechanisms of CRISPR/Cas9-mediated mutagenesis of HSV genome: increased homologous recombination and decreased parental background virus growth

We and others have shown that the efficiency of CRISPR/Cas9-induced mutations in HSV-1 genome correlates to the efficiency of CRISPR/Cas9-induced dsDNA cleavage (Oh et al., 2019; Roehm et al., 2016; van Diemen et al., 2016). In this study, we found that the efficiency of HDR is also correlated to the efficiency of CRISPR/Cas9-induced DSB. In addition to the enhanced recombination rate by DSB, significant reduction of parental or undesired non-insertion introduced virus growth was observed in gRNA-expressing cells compared to the control cells, and the reduction was proportionally increased along with inhibitory efficiencies of gRNAs for viral replication. Therefore, at least two mechanisms contribute to enhancing mutagenesis of HSV-1 genome by CRISPR/Cas9, first, enhanced HDR between DSB-induced viral genome and donor DNA and second, reduced parental virus recovery by highly efficient gRNA. Homologous recombination (HR) is a rare event, and it occurs primarily during the S and G2 phases in mitotic cells. During S and G2 phases, double strand DNA break occurs and this event enhances HDR by orders of magnitude compared to the unbroken DNA condition (Elliott et al., 1998). Therefore, efficient DNA cleavage is critical to increase the HDR-mediated mutagenesis, which can be achieved by efficient gRNAs/Cas9.

DSBs also can reduce parental and undesired non-insertion introduced virus growth, which is critical to isolate desired recombinant virus progeny, because parental virus levels are often several orders of magnitude higher than recombinant virus in viral progeny. This high background of parental virus hampers isolated pure recombinant virus growth, which requires several cycles of plaque isolation. DNA cleavage can be repaired by HDR or NHEJ. However, NHEJ is faster and a more favorable repair pathway than HDR (Beucher et al., 2009; Mao et al., 2008), and repaired DNA can be cycled back to the CRISPR/Cas9-mediated DNA break cycle. Although NHEJ is known to be an error-prone pathway, the actual rate of mutation frequency is not high, and most repairs by NHEJ are error free (Betermier et al., 2014; Frank-Vaillant and Marcand, 2002; Lee et al., 1999; Song and Bae, 2021). Therefore, efficient gRNAs can continuously induce DSB during the several cycles of NHEJ-mediated repair, which can significantly reduce parental or undesired mutant virus growth.

Potential methods for further improvement of mutagenesis

CRISPR/Cas9-induced DSB can be repaired by HDR or NHEJ. Repair of the viral genome through NHEJ can rescue the original sequence, but random mutations including insertion and deletion also occur, and these mutated sequences cannot be recognized by Cas9/gRNA, which causes undesired virus growth without insertion of desired DNA sequence. Therefore, induction of DSB and inhibition of the NHEJ pathway can increase the efficiency of HDR while reducing the undesired virus growth. Based on our results, both enhanced HDR and reduction of the undesired virus growth could be further achieved by using multiple gRNAs compared to a single gRNA (Oh et al., 2019; van Diemen et al., 2016). This implies that although single gRNA-induced DSB may introduce mutations, other gRNAs can induce DSBs at neighboring sites for HDR. Accessibility of the Cas9/gRNA complex to the target sequence is a critical factor in determining the efficiency of CRISPR/Cas9-mediated mutation (Horlbeck et al., 2016; Jensen et al., 2017; Uusi-Makela and Ramet, 2018; Yarrington et al., 2018). Changing the chromatin status from heterochromatin to euchromatin and removal of histone and other DNA binding proteins at gRNA target sequence have shown to improve CRISPR/Cas9-induced DSB and mutation rates in host chromosome and endonuclease-induced mutation in viral DNA (Aubert et al., 2014; Horlbeck et al., 2016; Liu et al., 2019). Therefore, drugs or enzymatic treatment that can change the chromatin status from heterochromatin to euchromatin can facilitate the mutagenesis mediated by CRIPSR/Cas9. Blocking the NHEJ pathway also showed improved mutagenesis of the HSV genome using endonucleases (Lin et al., 2016). Therefore, inhibiting the NHEJ pathway by inhibitors, knock out, or knock down of proteins in NHEJ pathway can potentially improve the efficiency of CRISPR/Cas9-mediated mutagenesis of viral DNA. Further studies are needed to determine the efficiency of these methods and any synergistic effect of combination of two or more of these methods.

Methods

Viruses and Cells

The HSV-1 d106S virus was obtained by back-crossing d106 virus (Samaniego et al., 1998) with the parental wildtype HSV-1 KOS virus to obtain a version that was fully acyclovir-sensitive (Liu et al., 2009). The d106S virus was grown on E11 cells derived from Vero cells by co-transformation of the HSV ICP4 and ICP27 genes (Samaniego et al., 1998) and provided by Neal DeLuca, University of Pittsburgh.

Construction of a CRISPR/Cas9 resistant shuttle plasmid and a reporter plasmid

To generate gRNA/Cas9 resistant shuttle plasmid, pd27B was mutated using a synthesized dsDNA block (IDT, gBlock: ATGTGGTAAAATCGATAAGGATCGATCTCCAGGCTACACGTGGATTATCATGGTATTTTTCATTTACATATGACTATACATTTCAAATGGGCCTTGCACTCAACTCGTTTCCAGTTTGCATATGCCGTTATGCGCGAATAATGCCTGGATGTGACGTCATACGTCAAACAGGCGCCTCTGGATCTCCTGCTCGTAGTGAAGCGCCACGAGCACCACCCCGGCCACCACGGCGATATAACACAATCGCATTGCGATGCCCGACAGGATGATGGAACAACAGCGCCCGCAGACGCCCGACAGCCCCTTGGATCGCCCCGGGGCGGCGGCCTTGTCTGCGTTCTTGGGGGCCGGGCCCCGCCGCAGAATACAATACAGCTCTGTCAGGCCGATGGTGGAGACAAAACACCAGGTGGTGATGGTCAGAAACAGGGGGTATGT). The synthesized gBlock was inserted into pd27B using the NEBuilder HiFi DNA Assembly kit (NEB #E5520) following the manufacturer’s protocol.

To construct the pd27B-mCherry and pd27Bmut-mCherry plasmids, the mCherry coding sequences was PCR-amplified from pmCherry-N1 using 5’-atatatGGTACCATGGTGAGCAAGGGC-3’ and 5’-atatatGCGGCCGCATGGTGAGCAAGGGC-3’ and digested with KpnI and NotI, and then was inserted between the KpnI and NotI restriction sites of pd27B and pd27Bmut, respectively. The spike gene ORF of the original Wuhan strain of SARS-CoV-2 was synthesized and cloned into pUC57 vector by Genscript to generate pUC57-nCov-S plasmid. To construct the pd27B-COV2-S and pd27mut-COV2-S plasmids, the SARS-CoV-2 spike coding sequences were cleaved from the pUC57-nCov-S plasmid, which was kindly provided by Dr. Jonathan Abraham of Harvard Medical School, using restriction enzymes KpnI and BglII. The spike gene was then inserted between the KpnI and Bgl II restriction sites in pd27B and pd27Bmut, respectively. The insertions of the mCherry and the CoV-2 spike coding sequences in the shuttle plasmids were confirmed by sequencing of the corresponding genes and the junctions on each side of the insertion.

Construction of gRNA/Cas9 plasmids

To generate gRNAs targeting UL53, we designed gRNAs (crispr.mit.edu website (Zhang lab, MIT)) and cloned the individual gRNA-coding sequences into lentiCRISPRv2-EF. LentiCRISPRv2-EF contains modified trans RNA in lentiCRISPRv2 (addgene #52961) to improve the efficiency of CRISPR (Chen et al., 2013). To construct the lentiCRISPRv2-EF plasmid, a PCR fragment (forward primer: AAAGGACGAAACACCGGAGACGTGTACGTCTCTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAG; reverse primer: CCTAGCTAGCGAATTCAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTG) was ligated to linearized lentiCRISPRv2 (KpnI/EcoR1 digested and blunt-ended using DNA polymerase I (Klenow)) using In-Fusion Assembly kit (Clontech). The ligated plasmid was transformed into Stabel3 competent cells, allowed to recover at 37 °C for 1 h, and selected on Carbenicillin (100 µg/mL) agar plates at 30 °C for 1 d. To construct the gRNA coding sequences, forward and reverse primers (Table 1) were annealed (95 °C for 5 min and gradual decrease (2 °C/min) to 27 °C) and phosphorylated using T4 PNK (NEB) in T4 ligation buffer (NEB) at 37 °C for 1 h. The phosphorylated gRNA coding sequences were ligated to lentiCRISPRv2-EF (digested with Esp3I) to generate lentiCRISPRv2-HSV-gRNA1, -gRNA2, and -gRNA3. 2961)

Table 1.

Primers for gRNAs

gRNA Sequences Name
#1 gRNA CACCGAAATGAAAATCGTTCCCCCG HSV UL53-54_1F
AAACCGGGGGAACGATTTTCATTTC HSV UL53-54_1R
#2 gRNA CACCGTTACATATGACGCGTCGGGT HSV UL53-54_2F
AAACACCCGACGCGTCATATGTAAC HSV UL53-54_2R
#3 gRNA CACCGACATCCAGGCCGGCGGAAAC HSV UL53-54_3F
AAACGTTTCCGCCGGCCTGGATGTC HSV UL53-54_3R
Open in a new tab

Generation of gRNA/Cas9 expressing E11 cell lines

To generate single (#1, #2, or #3) or triple (#1+2+3) gRNA- and Cas9-expressing stable cell lines, we produced individual gRNA/Cas9 expressing lentiviruses as described (Oh et al., 2019) and transduced E11 cells with individual or all three lentiviruses. After 4 d, cells were treated with 5 µg/mL puromycin and increased the concentration of puromycin to 9 µg/mL for next 7–10 d. The resulting cell lines were maintained in DMEM supplemented with G418 (500 µg/mL) and puromycin (6 µg/mL).

Generation of recombinant d106S virus

As described previously (Kurt-Jones et al., 2021), we co-transfected purified d106S DNA with linearized pd27Bmut shuttle plasmid into E11 or E11 gRNA/Cas9 expressing cells using Lipofectamin LTX with Plus reagent (Thermo Fisher Scientific) following manufacturer’s protocol. The cells were incubated at 37 °C and harvested at 5–7 d post transfection. The harvested cells were sonicated, serially diluted, and the resulting cell lysates were used to infect E11 and E11 gRNA/Cas9 expressing cells. To isolate single plaque, after 5–7 dpi, the cell monolayer was overlaid with 0.5% low-melt agarose (SeaKem) containing DMEM + 1% BCS and isolated GFP-negative single plaque using a Pasteur pipette. The isolated plaques were resuspended in 1 ml of sterilized milk:DMEM-1% bovine calf serum (50:50), sonicated, and used to infect a fresh cell monolayer.

SDS-PAGE and immunoblotting

For detection of transgene proteins encoded by the recombinant d106S viruses, we infected human HFF cells in a 12-well plate with the clones of the putative d106S-CoV2-S viruses. Cells were harvested at 24 hpi by scraping and lysed in RIPA buffer as described previously (Kurt-Jones et al., 2021). Proteins in the cell lysate were separated by electrophoresis in a 4–12% polyacrylamide gradient gel and transferred onto a nitrocellulose membrane. A rabbit monoclonal antibody against SARS-CoV-2 spike protein (Sino Biological) was used as the primary antibody, and a fluorophore-tagged anti-mouse IgG was used as a secondary antibody for detection by LI-COR.

Statistical analysis

Results from biological replicate experiments were analyzed to determine statistical significance using Prism 9 (Version 9.3.1) software (GraphPad Software). The graphs show mean values with standard errors.

Acknowledgments

This research was supported by NIH grant AI106934 and a grant from the Massachusetts Consortium for Pathogen Readiness. We thank Jeho Shin for technical assistance and Patrick T. Waters for assistance with the manuscript.

Footnotes

Editorial Disclosure

Given David M. Knipe’s role as the Editor-in-Chief, the authors had no involvement in the peer-review process of this article and have no access to information regarding its peer-review. Full responsibility for the editorial process for this article was delegated to Karl Munger.

References

  1. Aubert M, Boyle NM, Stone D, Stensland L, Huang ML, Magaret AS, Galetto R, Rawlings DJ, Scharenberg AM, and Jerome KR (2014). In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease. Mol Ther Nucleic Acids 3, e146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Betermier M, Bertrand P, and Lopez BS (2014). Is non-homologous end-joining really an inherently error-prone process? PLoS Genet 10, e1004086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beucher A, Birraux J, Tchouandong L, Barton O, Shibata A, Conrad S, Goodarzi AA, Krempler A, Jeggo PA, and Lobrich M (2009). ATM and Artemis promote homologous recombination of radiation-induced DNA double-strand breaks in G2. EMBO J 28, 3413–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bi Y, Sun L, Gao D, Ding C, Li Z, Li Y, Cun W, and Li Q (2014). High-efficiency targeted editing of large viral genomes by RNA-guided nucleases. PLoS Pathog 10, e1004090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Borca MV, Holinka LG, Berggren KA, and Gladue DP (2018). CRISPR-Cas9, a tool to efficiently increase the development of recombinant African swine fever viruses. Scientific reports 8, 3154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cliffe AR, and Knipe DM (2008). Herpes simplex virus ICP0 promotes both histone removal and acetylation on viral DNA during lytic infection. J Virol 82, 12030–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Coughlan L, Kremer EJ, and Shayakhmetov DM (2022). Adenovirus-based vaccines-a platform for pandemic preparedness against emerging viral pathogens. Mol Ther [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Da Costa X, Kramer MF, Zhu J, Brockman MA, and Knipe DM (2000). Construction, phenotypic analysis, and immunogenicity of a UL5/UL29 double deletion mutant of herpes simplex virus 2. J Virol 74, 7963–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Doudna JA, and Charpentier E (2014). Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096. [DOI] [PubMed] [Google Scholar]
  12. Elliott B, Richardson C, Winderbaum J, Nickoloff JA, and Jasin M (1998). Gene conversion tracts from double-strand break repair in mammalian cells. Mol Cell Biol 18, 93–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Frank-Vaillant M, and Marcand S (2002). Transient stability of DNA ends allows nonhomologous end joining to precede homologous recombination. Mol Cell 10, 1189–99. [DOI] [PubMed] [Google Scholar]
  14. Gierasch WW, Zimmerman DL, Ward SL, Vanheyningen TK, Romine JD, and Leib DA (2006). Construction and characterization of bacterial artificial chromosomes containing HSV-1 strains 17 and KOS. J Virol Methods 135, 197–206. [DOI] [PubMed] [Google Scholar]
  15. Goins WF, Huang S, Hall B, Marzulli M, Cohen JB, and Glorioso JC (2020). Engineering HSV-1 Vectors for Gene Therapy. Methods Mol Biol 2060, 73–90. [DOI] [PubMed] [Google Scholar]
  16. Horlbeck MA, Witkowsky LB, Guglielmi B, Replogle JM, Gilbert LA, Villalta JE, Torigoe SE, Tjian R, and Weissman JS (2016). Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Horsburgh BC, Hubinette MM, and Tufaro F (1999). Genetic manipulation of herpes simplex virus using bacterial artificial chromosomes. Methods Enzymol 306, 337–52. [DOI] [PubMed] [Google Scholar]
  18. Jensen KT, Floe L, Petersen TS, Huang J, Xu F, Bolund L, Luo Y, and Lin L (2017). Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett 591, 1892–1901. [DOI] [PubMed] [Google Scholar]
  19. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, and Charpentier E (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Knipe DM, Heldwein EE, Mohr IJ, and Sodroski CN (2021). Herpes Simplex Viruses: Mechanisms of Lytic and Latent Infection. In Fields Virology PM Howley DM Knipe BA Damania, and Cohen JI, eds. (Philadelphia: Lippincott Williams & Wilkins; ), pp. 235–296. [Google Scholar]
  21. Knipe DM, Ruyechan WT, Honess RW, and Roizman B (1979). Molecular genetics of herpes simplex virus: the terminal a sequences of the L and S components are obligatorily identical and constitute a part of a structural gene mapping predominantly in the S component. Proc Natl Acad Sci U S A 76, 4534–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Knipe DM, Ruyechan WT, Roizman B, and Halliburton IW (1978). Molecular genetics of herpes simplex virus: demonstration of regions of obligatory and nonobligatory identity within diploid regions of the genome by sequence replacement and insertion. Proc Natl Acad Sci U S A 75, 3896–900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kurt-Jones EA, Dudek TE, Watanabe D, Mandell L, Che J, Zhou S, Cao L, Greenough T, Babcock GJ, Diaz F, et al. (2021). Expression of SARS coronavirus 1 spike protein from a herpesviral vector induces innate immune signaling and neutralizing antibody responses. Virology 559, 165–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lee SE, Paques F, Sylvan J, and Haber JE (1999). Role of yeast SIR genes and mating type in directing DNA double-strand breaks to homologous and non-homologous repair paths. Current Biology 9, 767–70. [DOI] [PubMed] [Google Scholar]
  25. Lin C, Li H, Hao M, Xiong D, Luo Y, Huang C, Yuan Q, Zhang J, and Xia N (2016). Increasing the Efficiency of CRISPR/Cas9-mediated Precise Genome Editing of HSV-1 Virus in Human Cells. Scientific reports 6, 34531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu G, Yin K, Zhang Q, Gao C, and Qiu JL (2019). Modulating chromatin accessibility by transactivation and targeting proximal dsgRNAs enhances Cas9 editing efficiency in vivo. Genome biology 20, 145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu X, Broberg E, Watanabe D, Dudek T, Deluca N, and Knipe DM (2009). Genetic engineering of a modified herpes simplex virus 1 vaccine vector. Vaccine 27, 2760–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lugin ML, Lee RT, and Kwon YJ (2020). Synthetically Engineered Adeno-Associated Virus for Efficient, Safe, and Versatile Gene Therapy Applications. ACS nano 14, 14262–14283. [DOI] [PubMed] [Google Scholar]
  29. Mali P, Esvelt KM, and Church GM (2013). Cas9 as a versatile tool for engineering biology. Nature methods 10, 957–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mao Z, Bozzella M, Seluanov A, and Gorbunova V (2008). DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells. Cell Cycle 7, 2902–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Murphy CG, Lucas WT, Means RE, Czajak S, Hale CL, Lifson JD, Kaur A, Johnson RP, Knipe DM, and Desrosiers RC (2000). Vaccine protection against simian immunodeficiency virus by recombinant strains of herpes simplex virus. J Virol 74, 7745–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Oh HS, Neuhausser WM, Eggan P, Angelova M, Kirchner R, Eggan KC, and Knipe DM (2019). Herpesviral lytic gene functions render the viral genome susceptible to novel editing by CRISPR/Cas9. eLife 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Oldfield LM, Grzesik P, Voorhies AA, Alperovich N, MacMath D, Najera CD, Chandra DS, Prasad S, Noskov VN, Montague MG, et al. (2017). Genome-wide engineering of an infectious clone of herpes simplex virus type 1 using synthetic genomics assembly methods. Proc Natl Acad Sci U S A 114, E8885–E8894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Roehm PC, Shekarabi M, Wollebo HS, Bellizzi A, He L, Salkind J, and Khalili K (2016). Inhibition of HSV-1 Replication by Gene Editing Strategy. Scientific reports 6, 23146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Russell TA, Stefanovic T, and Tscharke DC (2015). Engineering herpes simplex viruses by infection-transfection methods including recombination site targeting by CRISPR/Cas9 nucleases. J Virol Methods 213, 18–25. [DOI] [PubMed] [Google Scholar]
  36. Samaniego LA, Neiderhiser L, and DeLuca NA (1998). Persistence and expression of the herpes simplex virus genome in the absence of immediate-early proteins. J Virol 72, 3307–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Song J, and Bae YS (2021). CK2 Down-Regulation Increases the Expression of Senescence-Associated Secretory Phenotype Factors through NF-kappaB Activation. International journal of molecular sciences 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Suenaga T, Kohyama M, Hirayasu K, and Arase H (2014). Engineering large viral DNA genomes using the CRISPR-Cas9 system. Microbiol Immunol 58, 513–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Tanaka M, Kagawa H, Yamanashi Y, Sata T, and Kawaguchi Y (2003). Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J Virol 77, 1382–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tang N, Zhang Y, Shen Z, Yao Y, and Nair V (2021). Application of CRISPR-Cas9 Editing for Virus Engineering and the Development of Recombinant Viral Vaccines. CRISPR J 4, 477–490. [DOI] [PubMed] [Google Scholar]
  41. Uusi-Makela M, and Ramet M (2018). Hijacking Host Angiogenesis to Drive Mycobacterial Growth. Cell Host Microbe 24, 465–466. [DOI] [PubMed] [Google Scholar]
  42. Van Cleemput J, Koyuncu OO, Laval K, Engel EA, and Enquist LW (2021). CRISPR/Cas9-Constructed Pseudorabies Virus Mutants Reveal the Importance of UL13 in Alphaherpesvirus Escape from Genome Silencing. J Virol 95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. van Diemen FR, Kruse EM, Hooykaas MJ, Bruggeling CE, Schurch AC, van Ham PM, Imhof SM, Nijhuis M, Wiertz EJ, and Lebbink RJ (2016). CRISPR/Cas9-Mediated Genome Editing of Herpesviruses Limits Productive and Latent Infections. PLoS Pathog 12, e1005701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang D, Tai PWL, and Gao G (2019). Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov 18, 358–378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Watanabe H, Sekine H, Uruma T, Nagasaki S, Tsunoda T, Machida Y, Kobayashi K, and Igarashi H (2009). Increase of atypical lymphocytes expressing CD4+/CD45RO+ in an infectious mononucleosis-like syndrome associated with hepatitis A virus infection. J Infect Chemother 15, 187–90. [DOI] [PubMed] [Google Scholar]
  46. Yarrington RM, Verma S, Schwartz S, Trautman JK, and Carroll D (2018). Nucleosomes inhibit target cleavage by CRISPR-Cas9 in vivo. Proc Natl Acad Sci U S A 115, 9351–9358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang C, and Zhou D (2016). Adenoviral vector-based strategies against infectious disease and cancer. Hum Vaccin Immunother 12, 2064–2074. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES