Skip to main content
Journal of Medicine and Life logoLink to Journal of Medicine and Life
. 2022 Sep;15(9):1105–1109. doi: 10.25122/jml-2021-0196

Molecular detection of Metallo-Beta-Lactamase and alginate in multidrug resistance Pseudomonas aeruginosa isolated from the clinical specimen

Govend Musa Qader 1, Khanzad Khudhur Jarjees 2,*, Rozhhalat Khudhur Jarjees 3
PMCID: PMC9635232  PMID: 36415531

Abstract

Pseudomonas aeruginosa pathogen is opportunistic. Several virulence factors and biofilms can cause its pathogenicity. Furthermore, infections triggered via multidrug-resistant P. aeruginosa among hospitalized patients are a public health concern. The primary antimicrobial agents in treating Gram-negative infection include Meropenem and Imipenem. Moreover, the spread of Carbapenem-resistant P. aeruginosa is a focal concern worldwide. The present research aims to determine the spread of Carbapenem-resistant P. aeruginosa, and the distribution of the Alginate and Metallo-beta-lactamase encoding gene in clinical isolates. In the present cross-sectional descriptive research, 50 wound and sputum clinical specimens were obtained. Isolates were all identified by applying cultural characteristics and biochemical tests. The Polymerase Chain Reaction (PCR) was conducted to distinguish algD, BLA-VIM, BLA-IMP, and 16SrRNA genes. Moreover, the phenotypic method was used to detect hemolysin. The disk diffusion technique was applied to screen clinical isolates for eight antimicrobial agents. The PCR results showed all isolates to be positive for algD and negative for BLA-VIM and BLA-IMP genes. Hemolysin and multidrug resistance prevalence was 100% and 76%, respectively. Furthermore, Meropenem proved to be the most efficient antibiotic against clinical isolates. Alginate and hemolysin are considered significant virulence factors for P. aeruginosa, playing a key role in triggering diseases and tissue or skin lesions. The emergence of Multidrug Resistant (MDR) isolates indicates that developing antibiotic stewardship in our regional community hospital is a top priority. Infection control measures could help control the distribution of virulence genes in P. aeruginosa isolates. Moreover, regular observation is needed to decrease public health threats, distributing virulence factors and Imipenem-resistance patterns in clinical isolates of P. aeruginosa.

Keywords: Alginate, Pseudomonas aeruginosa, Hemolysin, Metallo-beta-lactamase, Imipenem resistance isolates

ABBREVIATIONS: AMK – Amikacin, CAZ – Ceftazidime, CIP – Ciprofloxacin, CLSI – Clinical and Laboratory Standards Institute, ESBL – Extended Spectrum Beta-Lactamase, GEN – Gentamicin, IPM – Imipenem, LPS – Lipopolysaccharide, MBLs – Metallo-β-lactamases, MDR – Multidrug Resistant, PCR – Polymerase Chain Reaction, PIP – Piperacillin, RND – Resistance-Nodulation-Division, TSB – Tryptic Soy Broth, TTSS – Type III Secretion System

INTRODUCTION

P. aeruginosa forms several secreted and cell-related virulence factors with a role in infection pathogenesis [1]. Forming intractable biofilm and secreting myriads of virulent factors such as Type III secretion (TTSS) effectors, LasB elastase, LasA protease, pyoverdin, pyocyanin, and alginate leads to the development of P. aeruginosa pathogenicity [25]. Mucoid strains may yield biofilms, representing communities of attached microorganisms on a surface. Biofilms have a crucial part in infectious diseases. Further, they have a favorable antibiotic resistance, with their matrix playing a major role [68].

Producing mucoid colonies using P. aeruginosa strains with alginate defends the organism against antimicrobials and the host's immune system response; thus, it facilitates the pulmonary system's chronic inflammation [3]. Alginates, like lipopolysaccharide (LPS), act in the adherence of the bacterium to the respiratory epithelium [9]. They also operate as a barrier to certain antibiotics. In other words, alginate formation reduces aminoglycosides' absorption and early bacterial effect. Moreover, alginate hinders the diffusion of positively charged hydrophilic medicines [7, 10]. The expression of the algD gene is influenced by environmental factors, including nitrogen/carbon/phosphate limitation, slow growth rate, and oxygen concentration [11, 12].

Alginate, structurally, is a simple linear polysaccharide; it has a high molecular weight, and it contains two uronic acids: β-D-mannuronic acid and its C5 epimer, α-Lguluronic acid. It is a capsule-like exopolysaccharide in P. aeruginosa and loosely adheres to P. aeruginosa cells, thus being found in the culture supernatant [13].

In P. aeruginosa, antibiotic resistance involves several processes, such as overexpressing active efflux systems, producing modifying enzymes, and reducing external membrane permeability [14].

P. aeruginosa infections grow intrinsically and could display attained resistance to various routinely prescribed antimicrobial medications. Furthermore, they are usually difficult to be treated owing to the advent of multidrug-resistant P. aeruginosa isolates [15]. Many studies have used the term multidrug-resistant P. aeruginosa to describe isolates resistant to at least three types of antimicrobial drugs, most commonly carbapenems, aminoglycosides, antipse1udomonal penicillins, cephalosporins, and quinolones [16].

The primary antimicrobial agents to treat P. aeruginosa infections are carbapenems, such as Imipenem, doripenem, and Meropenem [17]. Such antibiotics are grouped as β-lactam antibiotics. Carbapenems have a broad spectrum of activity as a major drug to treat P. aeruginosa infections. However, carbapenem hydrolyzing enzymes, including MBLs, can effectively hydrolyze all beta-lactam antibiotics, except for monobactams [18].

Mechanisms of carbapenem resistance occur for several reasons, including reduced outer membrane permeability, decreased expression or defect in outer membrane porines including OprD, presence of chromosomal AmpC beta-lactamase gene, production of beta-lactamase enzymes, and increase in the activity of pump efflux systems [1921]. Therefore, the present descriptive research is performed to assess the profiles of antibiotic resistance and the prevalence of BLA-VIM and BLA-IMP genes in imipenem-resistant P. aeruginosa, as well as detecting hemolysin factor and alginate encoding genes from clinical isolates.

MATERIAL AND METHODS

P. aeruginosa Isolation and identification

Fifty P. aeruginosa isolates were obtained from sputum and wound samples of admitted patients in the Teaching Rizgari Hospital between January and April 2019. Isolates were identified based on the standard bacteriological approaches, such as colony morphology, pyocyanin pigment production, Gram staining, growth at 44℃, and biochemical tests [22]. Moreover, the identification was confirmed by 16S rRNA [23]. In addition, some bacteria isolates were stored at -70℃ in a microtube containing tryptic soy broth (TSB) and 20% glycerol for further studies [24].

Antimicrobial susceptibility testing

Based on the Clinical and Laboratory Standards Institute (CLSI) guideline [25], antimicrobial susceptibility was defined on Mueller-Hinton agar via the Kirby Bauer disk diffusion assay. The susceptibility profiles were determined for eight antibiotics, namely Piperacillin/Tazobactam (100/10 µg), Piperacillin (PIP, 100 µg), Gentamicin (GEN, 10 µg), Ceftazidime (CAZ, 30 µg), Imipenem (IPM, 10 µg), Amikacin (AMK, 30 µg), Ciprofloxacin (CIP, 5 µg), and Meropenem (10 µg).

In each antimicrobial susceptibility assay, P. aeruginosa ATCC 27835 was applied as quality control. Based on the CLSI criteria and the manufacturer's protocols, the results were considered resistant or susceptible.

Hemolysin detection

Bacterial isolated colonies were all plated (Sheep blood agar 5%) at 37℃ for 24h to detect hemolysins. The lysis of red blood cells (clear zone) was produced close to the cultured colonies following incubation, indicating positivity for hemolysins [26].

Bacterial genomic DNA extraction

In Tryptic Soy Broth (Merck, Germany), bacterial strains were sub-cultured, then incubated at 37℃ for 48 h. Following the manufacturer's instructions, the DNA extraction kit (Geneaid/Korea) was used to extract the DNA from P. aeruginosa colonies. The extracted DNA was then subjected to PCR reactions, targeting BLA-VIM, BLA-IMP, and algD genes.

Molecular analysis of BLA-VIM, BLA-IMP, and algD by polymerase chain reaction (PCR)

Table 1 shows how primer sequences and amplification protocols work [27, 28]. Then to identify BLA-VIM and BLA-IMP, Multiplex PCR was used as a method to amplify specific gene target sequences in a thermocycler (Techne/UK). The master mix preparation was executed in a total volume of 25 µl (12.5 µl Gotaq Green Master Mix (Promega/USA), 3 µl of genomic DNA, 1 µl for each BLA-IMP and BLA-VIM primer, and 5.5 µl nuclease-free water). For BLA-VIM and BLA-IMP amplification reactions, the mixtures were heated for 4 min at 95℃ before thermocycling, DNA denaturation for 30 sec at 94℃, primer annelation for 1 min at 60℃, and extensions for 1 min at 72℃. In the next step, the mixtures were kept at 72℃ for 6 min after finishing 30 cycles.

Table 1.

The oligonucleotide sequences for the antibiotic-resistant and virulence genes.

Target gene Primer sequences (5' – 3') PCR product size Reference
BLA-IMPF 5'GGCATAGAGTGGCTTAATTCTC3' 250 bp Saberi et al., 2017 [27]
BLA-IMPR 5'GGCCAAGCTTCTATATTTGC3'
BLA-VIMF 5'CAAATTGGACTTCCTGTAACG3' 273 bp
BLA-VIMR 5'TATAGAGGTGGGCCATTCAG3'
algDF 5'ATG CGA ATC AGC ATC TTT GGT3' 1310 bp Benie et al., 2017 [28]
algDR 5'CTA CCA GCA GAT GCC CTC GGC3'

For algD identification gene, all strains were checked by Uniplex PCR. The PCR premix for the algD gene was in a total volume of 25 µl, 12.5 µl (Gotaq Green Master Mix (Promega/USA), 3 µl genomic DNA, 1.5 µl for each primer, and 6.5 µl nuclease-free water). The PCR was performed as initial denaturation for 5 min at 94℃. Next, the 35-cycle amplification for 35 secs at 94℃ was executed followed by an annellation for 1 min at 61℃, an extension at 72℃ for 1 min, and, lastly, another extension for 10 min at 72℃ (Table 1).

The PCR product amplicons were finally analyzed using agarose gel electrophoresis (2%), and the DNA was stained with Safe dye (Bioland/USA). In addition, the presence and absence of the virulence and antibiotic-resistant genes were determined using a UV transilluminator (Syngene/UK). Also, the PCR product band for BLA-VIM, BLA-IMP, and algD genes was identified on the gel compared to the standard DNA ladder/1kb (Norgenbiotek/Canada).

RESULTS

In the present cross-sectional descriptive research, 45 bacterial isolates from wound infections and 5 strain isolates from sputum samples were collected. The clinical specimens were then inoculated into the routine and selective culture media for P. aeruginosa (Figure 1). Biochemical tests were performed to identify the colonies, which was confirmed by 16SrRNA [27].

Figure 1.

Figure 1

Clear beta-type hemolysis around the P. aeruginosa colonies on blood agar media.

The PCR results revealed that all bacterial isolates carried the alg D gene, and none was positive for BLA-VIM and BLA-IMP genes (Figure 2).

Figure 2.

Figure 2

Electrophoresis of the amplicon products for the virulence gene in P. aeruginosa; Lane: 1 ladder of 1kb, Lane 2-10: algD (1310 bp) gene.

All isolates appeared to be resistant to Piperacillin, Ceftazidime, and Piperacillin/Tazobactam in the current research. In contrast, the resistance to Imipenem, Meropenem, Amikacin, Gentamicin, Tobramycin, and Ciprofloxacin, respectively were 5%, 5%, 9%, 15%, 15%, and 9%. In contrast, intermediate resistance to Imipenem and Gentamicin was 16% and 3%. In addition, 76% of the isolates were multidrug-resistant [38].

DISCUSSION

The frequency of the algD gene was 100%. This finding was in line with earlier studies, indicating that the gene exists in about all specimens [29].

The researchers [3032] reported 98%, 95.24%, and 92.3% isolates to be positive for the algD gene, respectively.

Many hypotheses have attempted to clarify biofilm resistance (poor antibiotic penetration, nutrient limitation, high cell density, slow growth, adaptive stress response); however, no data exist explaining this phenomenon to date [33]. Fazlul has reported 48.33% and 7.5% of P. aeruginosa isolates to produce Hemolysin and Metallo beta-lactamase [26].

VIM and BLA-IMP genes were not detected; this finding was in line with that of ALjaafreha. Further, Shahi has reported none of the isolates to be BLA-VIM genes positive. According to previous and current studies, the differences observed in the incidence of BLA-VIM and BLA-IMP genes can be explained by the use of Imipenem and improper application of antibiotics in different regions [29, 34].

In Pseudomonas aeruginosa, mechanisms such as OprD, AmpC, and MexAB, as non-carbapenemase resistance mechanisms, may develop carbapenem resistance [3538]. Pump efflux systems play an important role in the antibiotic resistance of Pseudomonas aeruginosa isolates to various antibiotics. Pseudomonas aeruginosa has the potential to express 12 types of multidrug efflux pumps called Mex. Mex efflux systems belong to the Resistance-Nodulation-Division (RND) family. MexAB-OprM is the only secretory pump found in all Pseudomonas aeruginosa isolates and causes the inherent resistance of these bacteria to antibiotics. Ertapenem, Meropenem and Doripenem are substrates of the MexAB-OprM efflux system. Therefore, increasing the expression of MexAB-OprM pump efflux system plays an important role in the antibiotic resistance of Pseudomonas aeruginosa isolates to beta-lactam antibiotics, especially carbapenems [39, 40]. Another resistance mechanism in Pseudomonas aeruginosa is AmpC cephalosporins, a chromosomally encoded enzyme whose basic expression is resistance to beta-lactams except for cefpime, ceftazidime and carbapenems. Therefore, meropenem and imipenem resistant profiles can be created due to increased expression of MexAB-OprM flow pump genes, decreased expression or purine expression of OprD, and overexpression of AmpC carbapenemase, respectively. In this regard, some authors have suggested the possibility of inferring the mechanism of resistance from the antibiogram [4143].

With the spread of ESBL-producing gram-negative bacteria and carbapenemase-producing organisms that cause infection in patients in intensive care units, the use of carbapenems seems necessary [44].

All isolates in the current research were resistant to Tazobactam/Piperacillin. Metallo beta-lactamase P. aeruginosa were resistant to different antimicrobial agents, except for Tazobactam/Piperacillin. The multidrug-resistant phenotype is anticipated in Metallo beta-lactamase producers since they hydrolyze all beta-lactams, apart from aztreonam, and are related to gene cassettes, protecting various resistance genes [45].

To identify regulatory genes and structural changes in Carbapenem-resistant encoded proteins, further studies should be performed in addition to studies in the field of identification and expression of genes of this resistance. Extensive studies should also be performed to further identify the causes of the regular occurrence of virulence-related genes in MDR isolates.

CONCLUSIONS

In this study, the increase and spread of potentially very pathogenic and Carbapenem-resistant strains incorporated with multidrug-resistant patterns are concerned since a probable result would have increased clinical severity and would be accompanied by significant restrictions in antibiotic therapy. Imipenem resistance isolates comprise virulence factors, including hemolysin and alginate, responsible for serious infections.

ACKNOWLEDGEMENTS

Conflicts of interest

The authors declare no conflict of interest.

Ethics approval

The study protocol was approved by the Ethics Committee for Human Research at Salahaddin University (HREC-SUE), College of Science (approval No: 4S/87, 2022).

Authorship

KKJ contributed to conceptualizing, the methodology, writing the original draft and data analysis. GMQ contributed to conceptualizing, methodology and writing the original draft. RKJ contributed to data collection, data curation and editing the manuscript. KKJ, GMQ AND RKJ contributed to data collection and curation. GMQ and KKJ contributed to editing the manuscript.

References

  • 1.May TB, Shinabarger D, Maharaj R, Kato J, et al. “Identification of residues in the Pseudomonas aeruginosa elastase propeptide required for chaperone and secretion activities”. Microbiology. 2004;150(12):3969–3977. doi: 10.1099/mic.0.27340-0. [DOI] [PubMed] [Google Scholar]
  • 2.Kessler E, Safrin M, Abrams WR, Rosenbloom J, Ohman DE. “Inhibitors and specificity of Pseudomonas aeruginosa LasA”. The Journal of Biological Chemistry. 1997;272(15):9884–9889. doi: 10.1128/IAI.73.3.1695-1705.2005. [DOI] [PubMed] [Google Scholar]
  • 3.Lee VT, Smith RS, Tummler B, Lory S. “Activities of Pseudomonas aeruginosa effectors secreted by the type III secretion system in vitro and during infection”. Infection and Immunity. 2005;73(3):1695–1705. doi: 10.1074/jbc.272.15.9884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hauser AR. “The type III secretion system of Pseudomonas aeruginosa: infection by injection,”. Nature Reviews Microbiology. 2009;7(9):654–665. doi: 10.1038/nrmicro2199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Jarjees KK. Molecular detection of type III secretory toxins in Pseudomonas aeruginosa isolates. Cellular and Molecular Biology. 2020;66(5):9–14. doi: 10.14715/cmb/2020.66.5.2. [DOI] [PubMed] [Google Scholar]
  • 6.O'Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial development. Annu Rev Microbiol. 2000;45:49–79. doi: 10.1146/annurev.micro.54.1.49. [DOI] [PubMed] [Google Scholar]
  • 7.Høiby N, Johansen HK, Moser C, Song ZJ, et al. Pseudomonas aeruginosa and the biofilm mode of growth. Microb Infect. 2001;3:1–13. doi: 10.1016/S1286-4579(00)01349-6. [DOI] [PubMed] [Google Scholar]
  • 8.Prasanna SS, Doble M. Medical biofilms–Its formationand prevention using organic molecules. J Indian Inst Sci. 2008;88:27–35. [Google Scholar]
  • 9.Fadhil L, Al-Marzoqi AH, Zahraa MA, Shalan AA. Molecular and phenotypic study of virulence genes in a pathogenic strain of Pseudomonas aeruginosa isolated from various clinical origins by PCR: profiles of genes and toxins. Res J Pharm. Biol Chem Sci. 2016;7:590–598. [Google Scholar]
  • 10.Mohktari1 K, Amini K. Molecular Identification of Virulence Genes in Pseudomonas aeruginosa Isolated from Human and Animal Samples and Their Antibiotic Resistance Pattern. Iranian Journal of Medical Microbiology. 2020;13(03):294–297. doi: 10.30699/ijmm.13.4.294. [DOI] [Google Scholar]
  • 11.Bayer AS, Eftekhar F, Tu J, Nast CC, Speert DP. Oxygen-dependent up-regulation of mucoid exopolysaccharide (alginate) production in Pseudomonas aeruginosa. Infect. Immun. 1990;58:1344–1349. doi: 10.1128/iai.58.5.1344-1349.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Tang HB, DiMango E, Bryan R, Gambello M, Iglewski BH, et al. Environmental conditions which influence mucoid conversion in Pseudomonas aeruginosa PAO1. Infect. Immun. 1991;59:471–477. doi: 10.1128/iai.59.2.471-477.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sumita J, Ohman ED. Role of an alginate lyase for alginate transport in mucoid Pseudomonas aeruginosa. Infect Immun. 2005;73:6429–36. doi: 10.1128/IAI.73.10.6429-6436.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Strateva T, Yordanov D. Pseudomonas aeruginosa a phenomenon of bacterial resistance. Journal of Medical Microbiology. 2009;58:1133–1148. doi: 10.1099/jmm.0.009142-0. [DOI] [PubMed] [Google Scholar]
  • 15.Al-Charrakh AH, Al-Awadi SJ, Mohammed AS. Detection of metallo-β-lactamase producing Pseudomonas aeruginosa isolated from public and private hospitals in Baghdad, Iraq. Acta Med Iran. 2016;54(2):107–13. [PubMed] [Google Scholar]
  • 16.Falagas ME, Koletsi PK, Bliziotis IA. The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J Med Microbiol. 2006;55(12):1619–29. doi: 10.1099/jmm.0.46747-0. [DOI] [PubMed] [Google Scholar]
  • 17.Poole K. Pseudomonas aeruginosa resistance to the max. Front Microbiol. 2011;2(65) doi: 10.3389/fmicb.2011.00065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Cornaglia G, Giamarellou H, Rossolini GM. Metallo-beta-lactamases: a last frontier for beta-lactams? Lancet Infect Dis. 2011;11(5):381–393. doi: 10.1016/S1473-3099(11)70056-1. [DOI] [PubMed] [Google Scholar]
  • 19.Meletis G, Exindari M, Vavatsi N, Sofianou D, Diza E. Mechanisms responsible for the emergence of carbapenem resistance in Pseudomonas aeruginosa. Hippokratia. 2012;16(4):303–7. [PMC free article] [PubMed] [Google Scholar]
  • 20.Safaei HG, Moghim Isfahani BH, Fazeli H, et al. Distribution of the Strains of Multidrug-resistant, Extensively Drug-resistant, and Pandrug-resistant Pseudomonas aeruginosa Isolates from Burn Patients. Adv Biomed Res. 2017;6:74. doi: 10.4103/abr.abr_239_16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Emaaneini M, Kalantar-Neyestanki D, Jabalameli L, Hashemi M, et al. Molecular analysis and antimicrobial resistance pattern of distinct strains of Pseudomonas aeruginosa isolated from cystic fibrosis patients in Iran. Iranian Journal of Microbiology. 2019;11(2):98–107. [PMC free article] [PubMed] [Google Scholar]
  • 22.Forbes BA, Sahm DF, Weissfeld AS. United States: Mosby; 1998. Bailey & Scott's Diagnostic Microbiology. [Google Scholar]
  • 23.Sales AJ, Fathi R, Mobaiyen H, Bonab FR, et al. Molecular Study of the Prevalence of CTX-M1, CTX-M2, CTXM3 in Pseudomonas aeruginosa Isolated from Clinical Samples in Tabriz Town, Iran. Electronic Journal of Biology. 2017;13(3):253–259. [Google Scholar]
  • 24.Magalhães MJTL, Pontes G, Serra PT, Balieiro A, et al. Multidrug resistant Pseudomonas aeruginosa survey in a stream receiving effluents from ineffective wastewater hospital plants. BMC Microbiol. 2016;16:193. doi: 10.1186/s12866-016-0798-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fricks-Lhmaa CM, Hendriksona M, Allgaiera H, Zhuoa Jp, et al. Differeces in biofilm formation and antimicrobial resistance of Pseudomonas aeroginosa isolated from airway of mechanically ventilated patients and cystic fibrosis patients. Int J Antimicobs Agents. 2011;4(37):309. doi: 10.1016/j.ijantimicag.2010.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Fazlul MKK, Najnin A, Farzana Y, Rashid MA, et al. Detection of virulence factors and β lactamase encoding genes among the clinical isolates of Pseudomonas aeruginosa. Journal of International Pharmaceutical Research. 2018;45 doi: 10.48550/arXiv.1902.02014. [DOI] [Google Scholar]
  • 27.Saberi M, Zamani H, Salehzadeh A. Prevalence of IMP and VIM Metallo-Beta-Lactamase in Pseudomonas aeruginosa Isolated from Clinical and Environment Specimens in Intensive Care Units (ICU) of Rasht Hospitals, Iran. J Med Microbial Infec Dis. 2017;3(3-4):62–66. [Google Scholar]
  • 28.Benie CKD, Dadie A, Guessennd N, Kouame ND, et al. Molecular identification and virulence factors of Pseudomonas aeruginosa strains isolated from animal products. Journal of Bacteriology and Mycology. 2017;4(3):91–95. doi: 10.15406/jbmoa.2017.04.00094. [DOI] [Google Scholar]
  • 29.ALjaafreha LY, Tawalbeh M, Shehabi AA. (2020) Otitis External Infections Among Jordanian Patients with Emphasis on Pathogenic Characteristics of Pseudomonas aeruginosa Isolates. The Open Microbiology Journal. 2019;13:292–296. doi: 10.2174/1874285801913010292. [DOI] [Google Scholar]
  • 30.Heba Y, Obeidat DN, Abu-Qatouseh LF, Asem A, Shehabi AA. Antimicrobial resistance and putative virulence genes of Pseudomonas aeruginosa isolates from patients with respiratory tract infection. GERMS. 2018;8(1):32. doi: 10.18683/germs.2018.1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jahromi SIP, Mardaneh J, Sharifi IA, Pezeshkpour V, et al. Occurrence of a Multidrug Resistant Pseudomonas aeruginosa Strains in Hospitalized Patients in Southwest of Iran: Characterization of Resistance Trends and Virulence Determinants. Jundishapur J Microbiol. 2018;11(4):57341. doi: 10.5812/jjm.57341. [DOI] [Google Scholar]
  • 32.Georgescu M, Gheorghe I, Curutiu C, Lazar V, et al. Virulence and resistance features of Pseudomonas aeruginosa strains isolated from chronic leg ulcers. BMC Infectious Diseases. 2016;16(1):92. doi: 10.1186/s12879-016-1396-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Stewart PC. Mechanisms of antibiotic resistance in bacterial biofilms. Int. J. Med. Microbiol. 2002;292(2):107–113. doi: 10.1078/1438-4221-00196. [DOI] [PubMed] [Google Scholar]
  • 34.Shahi FA, Hashemi Kh, Abdolmaleki Z, Shahi Sh, et al. Antibacterial effects of Quercus Brantii fruits and Stachys lavandulifolia methanol extracts on imipenemase-type metallo-beta lactamase-producing Pseudomonas aeruginosa. Research Journal of Pharmacognosy (RJP) 2017;4(3):59–66. [Google Scholar]
  • 35.Santella G, Pollini S, Docquier JD, Almuzara M, et al. Carbapenem resistance in Pseudomonas aeruginosa isolates: an example of interaction between different mechanisms. Rev Panam Salud Publica. 2011;30(6):545–8. doi: 10.1590/s1020-49892011001200008. [DOI] [PubMed] [Google Scholar]
  • 36.Vanegas JM, Cienfuegos AV, Ocampo AM, López L, et al. Similar frequencies of Pseudomonas aeruginosa isolates producing KPC and VIM carbapenemases in diverse genetic clones at tertiary-care hospitals in Medellín, Colombia. J Clin Microbiol. 2014;52(11):3978–86. doi: 10.1128/JCM.01879-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Akhi MT, Khalili Y, Ghotaslou R, Yousefi S, et al. Evaluation of carbapenem resistance mechanisms and its association with Pseudomonas aeruginosa Infections in the Northwest of Iran. Microb Drug Resist. 2017 doi: 10.1089/mdr.2016.0310. [DOI] [PubMed] [Google Scholar]
  • 38.Maryam M, Haghkhah M. Antimicrobial Resistance Profiles and Virulence Genes of Pseudomonas aeruginosa Isolates Originated from Hospitalized Patients in Shiraz, Iran. Med Microbiol Infect Dis. 2018;6(2-3):72–76. doi: 10.29252/JoMMID.6.2.3.72. [DOI] [Google Scholar]
  • 39.Tomás M, Doumith M, Warner M, Turton JF, et al. Efflux pumps, OprD porin, AmpC beta-lactamase, and multiresistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob Agents Chemother. 2010;54(5):2219–24. doi: 10.1128/AAC.00816-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Aghazadeh M, Hojabri Z, Mahdian R, Nahaei MR, Rahmati M, et al. Role of efflux pumps: MexAB-OprM and MexXY(-OprA), AmpC cephalosporinase and OprD porin in non-metallo-β-lactamase producing Pseudomonas aeruginosa isolated from cystic fibrosis and burn patients. Infection, Genetics and Evolution. 2014;24:187–92. doi: 10.1016/j.meegid.2014.03.018. [DOI] [PubMed] [Google Scholar]
  • 41.Lee J-Y, Ko KS. OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. International Journal of Antimicrobial Agents. 2012;40(2):168–72. doi: 10.1016/j.ijantimicag.2012.04.004. [DOI] [PubMed] [Google Scholar]
  • 42.Shigemura K, Osawa K, Kato A, Tokimatsu I, et al. Association of overexpression of efflux pump genes with antibiotic resistance in Pseudomonas aeruginosa strains clinically isolated from urinary tract infection patients. J Antibiot (Tokyo) 2015;68(9):568–72. doi: 10.1038/ja.2015.34. [DOI] [PubMed] [Google Scholar]
  • 43.Samaneh R, Ramazanzadeh R. Prevalence of blaOxacillinase-23-and blaOxacillinase-24/40-type Carbapenemases in Pseudomonas aeruginosa Species Isolated from Patients with Nosocomial and Non-Nosocomial Infections in the West of Iran. Iran J Pathol. 2018;13(3):348–356. [PMC free article] [PubMed] [Google Scholar]
  • 44.Voor in't holt AF, Severin JA, Lesaffre EM, Vos MC. A systematic review and meta-analyses show that carbapenem use and medical devices are the leading risk factors for carbapenem-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2014;58:2626–37. doi: 10.1128/AAC.01758-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-β-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18(2):306–25. doi: 10.1128/CMR.18.2.306-325.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Medicine and Life are provided here courtesy of SC Jurnalul pentru Medicina si Viata SRL

RESOURCES