Dear Editor,
Monkeypox has been declared as a global health emergency as infections soar on 23 July 2022. MPXV was first identified in Democratic Republic of the Congo in 1970 [1]. Monkeypox was not reported outside Africa until 2003 [1]. In 2003, a cargo of rats from Ghana introduced MPXV to Illinois pet prairie dogs, infecting more than 70 people in the US [1]. Adult travellers from Nigeria were diagnosed with monkeypox in Israel in 2018; in the UK in 2018, 2019, and 2021; in Singapore in 2019; in the US in 2019 [1]. Monkeypox is a viral zoonosis (a virus transmitted to humans from animals) with symptoms include fever, swollen lymph nodes, and a rash that forms blisters and then crusts over [2]. The severity leads to severe illness (a temperature of ⩾38.3 °C), pneumonia, encephalitis, and eye infections, which can be fatal [3], [4]. MPXV is transmitted from infected person through fluids secretion from the respiratory tract, skin lesions, body and contaminated materials [1]. An ongoing outbreak of MPXV was confirmed in May 2022, MPXV started spreading quickly in 75 countries of the world. Regions of the Americas and European Region became hotspots of MPXV outbreak [5]. Till date (21 July 2022, 16:00 EST), 15,734 laboratory confirmed cases, including five deaths have been reported [5], [6]. The case fatality rate has been around 3–6% recently [1]. Owing to rise in number of potential cases in this global pandemic situation, the clinician is under pressure to develop a quick, easier-to-use diagnostic test with high sensitivity that can be used in the early stages of both symptomatic and asymptomatic disease. Polymerase Chain (PCR) or real time PCR has been considered as a specific and sensitive molecular method to detect the viral titre in the humans [7]. Our aim of the study is to design monkeypox specific primers. In this study, Bioinformatics tools (Primer quest and MFE primer 3.1) were used to design and verify the monkeypox specific primers. qPCR primer and probe were designed within conserved region from DNA dependent RNA polymerase and envelope of MPXV isolated from Rivers State, Nigeria (Gene bank No: NC_063383). The details of primer, specificity, sensitivity and conditions were provided in Table 1. PCR primers were validated with tools such as SerialCloner 2.6.1, Primer-BLAST, and BLAST which allow to investigate the amplification targets of primers and probes to ensure adequate specificity and sensitivity. No cross reactivity of primer set A28-F1/R1 or A28-Probe-F1/A28-R1, H3-F2/R2 or H3-R2/H3-Probe-R1, and DDRP-F5/R5 or DDRP-Probe-F5/DDRP-R5 with other human-infecting Orthopoxviruses viz. Camelpox, Cowpox, Vaccinia and Variola (Variola major and Variola minor) were observed. Our study showed that all the primers (Table 1) either based on SYBR Green chemistry had binding capacity (ΔG) ranged from − 19.64 to − 23.26 (kcal/mole) while based on TaqMan probes had binding capacity (ΔG) ranged from − 26.48 to − 29.59 (kcal/mole). Higher binding capacity of primers in MFE primer 3.1 showed higher specificity against virus [8]. All these sets of primers of monkeypox were highly specific and any of the primer set either SYBR Green based or TaqMan probe based may be useful for commercial PCR based kit development for the molecular diagnosis of MPXV. The assay based on qPCR detection will be sensitive, rapid and specific to detect MPXV in swab of roof or fluid from vesicles and pustules, and dry crusts, and from cell culture supernatant, however in vitro validation and standardization of these primers are needed on patient samples. In conclusion, our study has designed primer set A28-F1/R1 or A28-Probe-F1/A28-R1, H3-F2/R2 or H3-R2/H3-Probe-R1, and DDRP-F5/R5 or DDRP-Probe-F5/DDRP-R5 as the potential monkeypox specific primers.
Table 1.
List of PCR primers synthesised in this study.
| No | Primer ID | Sequence (5′ → 3′) | Size (bp) | GC (%) | Tm (°C) | ΔG (kcal/mol) | Sensitivity (%)a | Specificity (%)b | Specificity (%)c | Specificity (%)d | Specificity (%)e |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | A28-F1 | CCTGGATAAACCACACATCTCC | 22 | 50.00 | 59.04 | -22.40 | 100 | 100 | 1.4 | 32.6 | 100 |
| A28-R1 | ACTCATGCAGCATTCGAGTATT | 22 | 40.91 | 58.78 | -22.31 | 100 | 100 | 100 | 100 | 100 | |
| A28-Probe-F1 | ACTCTCCTATCTAATGCCGGTGTTCCA | 27 | 48.15 | 65.66 | -28.74 | 100 | 100 | 1.4 | 19.6 | 100 | |
| 2 | A28-F2 | ACATTGTCGCATCGTGTTAAAT | 22 | 36.36 | 57.90 | -22.00 | 100 | 20.6 | 100 | 62.0 | 100 |
| A28-R2 | AGTGGAGATGTGTGGTTTATCC | 22 | 45.45 | 58.37 | -21.97 | 100 | 100 | 1.4 | 29.3 | 100 | |
| A28-Probe-R2 | TGGATTTCAGGCAGAAGTTGGACCC | 25 | 52.00 | 65.62 | -27.54 | 100 | 100 | 2.8 | 19.6 | 100 | |
| 3 | H3-F1 | CAGCGCCGTAGTAACTCTAATAA | 23 | 43.48 | 58.73 | -22.95 | 100 | 15.9 | 1.4 | 18.4 | 100 |
| H3-R1 | ACCGAGCTTGTAATAGACAAAGA | 23 | 39.13 | 58.19 | -22.41 | 99.6 | 100 | 100 | 100 | 0 | |
| H3-Probe-R1 | CAGGAGGGTATGATGTTAGCTTATCCGC | 28 | 50.00 | 65.40 | -29.59 | 99.9 | 7.9 | 1.4 | 3.3 | 0 | |
| 4 | H3-F2 | TTAGCAGCTACCGTTCCTATTC | 22 | 45.45 | 58.27 | -22.07 | 99.6 | 100 | 100 | 100 | 100 |
| H3-R2 | ACACGATCCTCGTCTTGTTG | 20 | 50.00 | 58.50 | -21.41 | 99.7 | 7.9 | 100 | 80.4 | 0 | |
| H3-Probe-R2 | ACACCGCTTCGAAACCATGAAACC | 24 | 50.00 | 64.92 | -26.97 | 100 | 100 | 100 | 91.3 | 100 | |
| 5 | H3-F3 | ACGTGTACATAACTCCTGGATAAC | 24 | 41.67 | 58.69 | -23.24 | 96.2 | 11.1 | 100 | 0 | 0 |
| H3-R3 | CCGCTTCGAAACCATGAAAC | 20 | 50.00 | 58.60 | -21.61 | 100 | 20.6 | 50.7 | 78.3 | 100 | |
| H3-Probe-F3 | AGCAGCTACCGTTCCTATTCTAGACCA | 27 | 48.15 | 65.42 | -28.66 | 99.9 | 100 | 100 | 100 | 100 | |
| 6 | DDRP-F1 | GGCAGACACGGACGATATTA | 20 | 50.00 | 57.71 | -20.95 | 100 | 100 | 100 | 83.7 | 100 |
| DDRP-R1 | AGTGACTCTCCATCTTCTTCATC | 23 | 43.48 | 57.92 | -22.21 | 100 | 11.1 | 43.7 | 3.3 | 0 | |
| DDRP-Probe-F1 | TCCGATGATCTCACCGAATACGAGGA | 26 | 50.00 | 65.35 | -28.18 | 99.6 | 93.7 | 38 | 32.6 | 0 | |
| 7 | DDRP-F2 | CTTCATGGTGGGAATATGCTCTA | 23 | 43.48 | 58.29 | -22.33 | 100 | 7.9 | 22.5 | 0 | 0 |
| DDRP-R2 | AACCCGCATTGGCTACAT | 18 | 50.00 | 57.40 | -19.64 | 99.9 | 20.6 | 100 | 95.7 | 100 | |
| DDRP-Probe-R2 | AGCTGTCAATGAGGAATGGCTAACTGC | 27 | 48.15 | 66.02 | -29.21 | 100 | 7.9 | 2.8 | 0 | 0 | |
| 8 | DDRP-F3 | CTCTACAGCAGTTAGCCATTCC | 22 | 50.00 | 59.05 | -22.49 | 99.9 | 20.6 | 100 | 56.5 | 100 |
| DDRP-R3 | ATCGTCGTTGAACTCGAACC | 20 | 50.00 | 58.79 | -21.61 | 100 | 7.9 | 2.8 | 0 | 0 | |
| DDRP-Probe-F3 | ACTACTCCAATGTTTAACAAGGGCCA | 26 | 42.31 | 63.20 | -26.48 | 100 | 100 | 100 | 63.0 | 100 | |
| 9 | DDRP-F4 | AGCCATTCCTCATTGACAGC | 20 | 50.00 | 58.74 | -21.25 | 99.8 | 12.7 | 0 | 0 | 0 |
| DDRP-R4 | TCCACGGGAAGAGAATTCAATC | 22 | 45.45 | 58.64 | -22.12 | 100 | 7.9 | 0 | 0 | 0 | |
| DDRP-Probe-F4 | TAGCCAATGCGGGTTCGAGTTCAA | 24 | 50.00 | 65.49 | -26.99 | 100 | 100 | 100 | 97.8 | 100 | |
| 10 | DDRP-F5 | CAACGTGTATCCTGGAGTATGG | 22 | 50.00 | 58.80 | -22.40 | 99.7 | 9.5 | 0 | 0 | 0 |
| DDRP-R5 | GATCACAAGGCTGGTACAGATAA | 23 | 43.48 | 58.50 | -22.53 | 99.8 | 100 | 100 | 100 | 100 | |
| DDRP-Probe-F5 | TCGTGGATACTTGTGCGAAGCCAT | 24 | 50.00 | 65.28 | -26.96 | 99.9 | 61 | 100 | 0 | 100 | |
| 11 | DDRP-F6 | TACCGGAACACTGGCTAGAA | 20 | 50.00 | 58.58 | -21.07 | 100 | 7.9 | 0 | 51 | 0 |
| DDRP-R6 | CTGCGTACTTGATGAGCGTATTA | 23 | 43.48 | 59.22 | -23.26 | 100 | 46 | 0 | 7 | 100 | |
| DDRP-Probe-F6 | TATGGTGGTCGACGGATACGGACA | 24 | 54.17 | 65.59 | -27.11 | 99.5 | 7.9 | 1.4 | 42 | 0 |
Sensitivity = (ts/Tts)* 100 (ts: number of target strains detected, Tts: total number of target strains tested), blasted over 1006 strains of monkeypox from NCBI database
Specificity = (nts/Tnts)* 100 (nts: number of non-target species undetected, Tnts: total number of non-target species tested), blasted over all verified 63 Variola from NCBI database
Specificity = (nts/Tnts)* 100 (nts: number of non-target species undetected, Tnts: total number of non-target species tested), blasted over all verified 71 Vaccinia from NCBI database
Specificity = (nts/Tnts)* 100 (nts: number of non-target species undetected, Tnts: total number of non-target species tested), blasted over all verified 92 Cowpox from NCBI database
Specificity = (nts/Tnts)* 100 (nts: number of non-target species undetected, Tnts: total number of non-target species tested), blasted over all verified 10 Camelpox from NCBI database
Funding
This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
Ethical approval
Not required.
Competing interests
The authors have no conflicts of interest to disclose.
References
- 1.World Health Organization. Monkeypox: key facts, 〈https://www.who.int/news-room/fact-sheets/detail/monkeypox〉; 2022 [Accessed July 26, 2022].
- 2.World Health Organization. Multi-country monkeypox outbreak: situation update. 〈https://www.who.int/emergencies/disease-outbreak-news/item/2022-DON396〉; 2022 [Accessed July 26, 2022].
- 3.Huhn G.D., Bauer A.M., Yorita K., Graham M.B., Sejvar J., Likos A., et al. Clinical characteristics of human monkeypox, and risk factors for severe disease. Clin Infect Dis. 2005;41:1742–1751. doi: 10.1086/498115. [DOI] [PubMed] [Google Scholar]
- 4.Guarner J., Del Rio C., Malani P.N. Monkeypox in 2022-what clinicians need to know. JAMA. 2022 doi: 10.1001/jama.2022.10802. [DOI] [PubMed] [Google Scholar]
- 5.Pan American Health Organization. Weekly Situation Report on Monkeypox Multi-Country Outbreak Response -Region of the Americas. 22 July 2022. 〈https://www.paho.org/en/documents/weekly-situation-report-monkeypox-multi-country-outbreak-response-region-americas-22-july〉; 2022 [Accessed July 26, 2022].
- 6.Center for Infectious Disease Research and Policy. WHO: 14,000 monkeypox cases worldwide, 5 deaths. 〈https://www.cidrap.umn.edu/news-perspective/2022/07/who-14000-monkeypox-cases-worldwide-5-deaths〉; 2022 [Accessed July 26, 2022].
- 7.Ebner K., Rauch M., Preuner S., Lion T. Typing of human adenoviruses in specimens from immunosuppressed patients by PCR-fragment length analysis and real-time quantitative PCR. J Clin Microbiol. 2006;44:2808–2815. doi: 10.1128/JCM.00048-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang K., Li H., Xu Y., Shao Q., Yi J., Wang R., et al. MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Res. 2019;47:610–613. doi: 10.1093/nar/gkz351. [DOI] [PMC free article] [PubMed] [Google Scholar]