Skip to main content
NCBI home page
Molecular Biology of the Cell logoLink to Molecular Biology of the Cell
. 2022 Sep 22;33(12):br21. doi: 10.1091/mbc.E21-09-0437

Evidence for low-level translation in human erythrocytes

Sangeetha Devi Kumar a, Debaleena Kar a, Md Noor Akhtar a, Belinda Willard b, Debadrita Roy a, Tanweer Hussain c, Purusharth I Rajyaguru a, Sandeep M Eswarappa a,*
Editor: Karsten Weisd
PMCID: PMC9635303  PMID: 35976696

Abstract

It is generally believed that human mature erythrocytes do not possess functional ribosomes and therefore cannot synthesize proteins. However, the absence of translation is not consistent with the long lifespan of mature erythrocytes. They stay viable and functional for about 115 d in the circulatory system. Here, using a highly pure preparation of human mature erythrocytes, we demonstrate the presence of translation by polysome profiling, [35S]methionine labeling, and RiboPuromycylation. [35S]methionine labeling revealed that the translation in mature erythrocytes is about 10% of that observed in reticulocytes. We could observe polysomes by transmission electron microscopy in these cells. RNA-seq and quantitative real-time PCR performed on polysome fractions of these cells revealed that HBA (α-globin) and HBB (β-globin) transcripts are translated. Using a luciferase-based reporter assay and mutational studies, we show that the sequence of the 5′ untranslated region is crucial for the translation of these transcripts. Furthermore, mature erythrocytes showed reduced expression of globin proteins (α- and β-) when treated with translation inhibitors. Overall, we provide multiple lines of evidence for translation of globin mRNAs in human mature erythrocytes.

INTRODUCTION

Erythrocytes are cells circulating in the blood of all vertebrates. These cells are anucleate in mammals. They perform the crucial function of transporting oxygen to tissues. They also regulate the blood flow by manipulating the microvasculature through nitric oxide (Cortese-Krott and Kelm, 2014). Their relatively small size (5–8 μm) and membrane plasticity provide them an ability to pass through the very small lumen of capillaries. Circulating mature erythrocytes are generated from erythroblasts through a series of morphological changes in the bone marrow. In the terminal step of this process, reticulocytes, which form about 1% of circulating red blood cells, lose all membrane-bound organelles to form mature erythrocytes (Moras et al., 2017). It is believed that ribosomes are also lost during this process. The elimination of organelles ensures more space for the vital hemoglobin.

Widespread dynamic regulation of protein synthesis has been reported during erythropoiesis until the reticulocyte stage (Alvarez-Dominguez et al., 2017). Though reticulocytes show translation, it is believed that mature erythrocytes do not synthesize proteins (Borsook et al., 1952; Holloway and Ripley, 1952; Koury et al., 2005; Chen et al., 2008; Kabanova et al., 2009; Moras et al., 2017). The relatively long life of mature erythrocytes is not consistent with the absence of translation in these anucleate cells. Mature erythrocytes stay functional for about 115 d (range: 70–140 d) before they are removed from circulation (Cohen et al., 2008; Franco, 2012; Mock et al., 2012). A cell would need protein synthesis to survive and function for 115 d. Mature erythrocytes need a constant supply of globin proteins for hemoglobin. They need to replenish enzymes of important metabolic processes such as the glycolysis and pentose phosphate pathway and other housekeeping proteins. This is not possible without translation. Mature erythrocytes also have functional proteasome machinery, suggesting protein turnover in them (Kakhniashvili et al., 2004; Neelam et al., 2011). Besides, regulation of gene expression is desirable in mature erythrocytes because they are exposed to multiple stressful conditions (e.g., hypoxia), and this regulation is possible only at posttranscriptional levels in anucleate cells. Recent studies have reported the presence of both mRNAs and microRNAs (miRNAs) in mature erythrocytes, suggesting protein translation in them (Chen et al., 2008; Doss et al., 2015).

On the basis of these observations, we hypothesized that mature erythrocytes perform protein synthesis. Here, we demonstrate low-level translation in mature erythrocytes using multiple techniques—[35S]methionine labeling, RiboPuromycylation, polysome profiling, electron microscopy, and translatome analysis. RNA-seq of samples obtained from polysome fraction and quantitative real-time PCR (qRT-PCR) analysis revealed that globin transcripts are translated in mature erythrocytes. We also show a key role of the 5′UTR of HBA and HBB in their translation in mature erythrocytes.

RESULTS AND DISCUSSION

Purity of isolated mature erythrocytes

Mature erythrocytes lack all membrane-bound organelles, and they do not express CD71 (transferrin receptor 1) on their cell membrane (Loken et al., 1987; Doss et al., 2015). We performed magnetic-activated cell sorting (MACS) using CD71 MicroBeads to separate mature erythrocytes from reticulocytes and the rest of the human blood cells, which express CD71. Because translation is known to occur in reticulocytes (Skadberg et al., 2003), it is vital for our study to have a very pure population of mature erythrocytes. We first tested the purity of our mature erythrocyte population by Giemsa staining, a classic staining method for blood cells. This staining did not show any blue/purple-colored nucleated cells or reticulocytes. We observed only pink cells with a central hollow, which is a feature of biconcave-shaped mature erythrocytes (Figure 1A). Western blot confirmed the absence of CD71 protein in our preparations (Figure 1B). We then analyzed our samples using a flow cytometer after staining for CD71 protein. This assay confirmed the absence of CD71+ cells (Figure 1C). Nuclear staining with CyQUANT NF did not reveal any nucleated cells in our mature erythrocyte preparation (Supplemental Figure S1A). Furthermore, these cells lacked mitochondrial proteins VDAC1 (voltage-dependent anion-selective channel 1), MTCH2 (mitochondrial carrier homologue 2) and prohibitin (Figure 1D and Supplemental Figure S1B). Also, MitoTracker staining did not show any cells with mitochondria (Figure 1E).

FIGURE 1:

FIGURE 1:

Open in a new tab

Purity of isolated mature erythrocytes. Mature erythrocytes were isolated from human blood by performing MACS as described in Materials and Methods. (A) Mature erythrocytes stained with Giemsa. Cells were smeared on a glass slide, fixed, and stained with Giemsa solution. The smear was imaged using a microscope (Axio Scope.A1, Carl Zeiss; Objective: N-ACHROPLAN 20×/0.45 Ph2). (B) Western blot showing the absence of CD71 protein in mature erythrocytes. (C) Flow cytometry profile showing the absence of CD71+ cells in mature erythrocytes isolated by negative selection using MACS. (D) Western blot showing absence of mitochondrial markers in mature erythrocytes. GAPDH Western blot shows that isoform 2 (∼32 kDa) is predominant in mature erythrocytes, whereas isoform 1 (∼36 kDa) is predominant in HEK293 and HeLa cells. (E) Confocal microscopy images showing the absence of mitochondria in mature erythrocytes. MitoTracker Red CMXRos was used to stain mitochondria. K562 cells were used as positive control. Cells inside the black squares are enlarged. All results are representative of three independent experiments. Scale bar = 10 μm.

To further confirm the purity of our mature erythrocyte preparations, we performed mass spectrometry analysis of lysates from mature erythrocytes to detect reticulocyte contamination, if any, in our preparations (Supplemental Table S1). Because reticulocytes contain mitochondria, we generated a list of exclusively mitochondrial proteins using the information available in the Human Protein Atlas and UniProt databases (Supplemental Table S2). This list was compared with the list of proteins in mature erythrocytes identified by our mass spectrometry analysis. Mitochondrial markers such as VDAC1, prohibitin, MTCH2, and proteins involved in oxidative phosphorylation were absent in mature erythrocytes. Out of 330 mitochondrial proteins, only one was found in them (ATP5F1B), and that too with a very low normalized spectral abundance factor (NSAF) value of 0.000666. Together, these results demonstrate the purity of mature erythrocytes isolated by MACS using CD71 MicroBeads. The purity of the mature erythrocytes was confirmed by flow cytometry before the experiments described below.

Mature erythrocytes contain ribosomes and polysomes

To test whether translation is occurring in these mature erythrocytes, we first performed polysome profiling, a gold standard technique to study translation (King and Gerber, 2016). As shown previously, we observed a flat polysome profile without typical peaks corresponding to 40S, 60S, monosomes, and polysomes (Lacsina et al., 2011). All these peaks were found in the polysome profile of HeLa cells, validating our polysome profiling method (Figure 2A). Nonetheless, we could detect ribosomal protein RPL10a in the heavier fractions (Figure 2B). This observation provided a hint of a low level of translating ribosomes in mature erythrocytes.

FIGURE 2:

FIGURE 2:

Open in a new tab

Ribosomes in mature erythrocytes. (A) Polysome profile of mature erythrocytes showing the absence of distinct 40S, 60S, 80S, and polysome peaks. Inset shows polysome profile of HeLa cells where these peaks are seen. Fractions comprising translating and nontranslating mRNAs are indicated. (B) Western blot showing the presence of ribosomal protein RPL10a in pooled high-density fractions (translating pool) derived from mature erythrocytes. (C) The ribosomal pellet obtained after sucrose cushion centrifugation was resuspended and subjected to sucrose density gradient (10–50%) centrifugation to separate monosomes and polysomes. Absorbance (260 nm) profile of these fractions is shown. Sample treated with 2 mM puromycin and 600 mM KCl (right) does not show ribosome peaks. Twenty-five times more mature erythrocytes were taken for this assay compared with polysome profiling shown in A. (D) Levels of 18S rRNA and 28S rRNA in all fractions are shown as Ct values. Four fractions were pooled to obtain RNA, which was used for cDNA synthesis and qRT-PCR. (E) Electron microscopy images of monosomes and polysomes. Fractions 11–16 (monosomes) and 21–27 (polysomes) were pooled, concentrated, and stained for electron microscopy as described in Materials and Methods. More images are shown in Supplemental Figure S1C. Scale bar, 100 nm. Results are representative of at least two independent experiments.

Encouraged by this observation, we decided to isolate ribosomes, if any, from mature erythrocytes using sucrose cushion centrifugation (Belin et al., 2010). The pellet obtained after this procedure (presumably containing ribosomes) was resuspended and subjected to sucrose density gradient (10–50%) centrifugation to separate monosomes and polysomes, if any. The absorbance (260 nm) profile of these fractions revealed the presence of peaks corresponding to monosomes and polysomes, which were reduced when treated with 2 mM puromycin and a high salt concentration (600 mM KCl) (Figure 2C). We performed qRT-PCR to check the presence of rRNAs in these fractions. Cycle threshold (Ct) values of 18S and 28S rRNAs were much lower in denser polysome fractions compared with those values in lighter soluble fractions, indicating the presence of ribosomes in heavier fractions (Figure 2D). Notably, we observed monosomes in low-density fractions (11–16) and polysomes in high-density fractions (21–27) under a transmission electron microscope, which is strong evidence for translation in mature erythrocytes (Figure 2E and Supplemental S1C).

Translation in mature erythrocytes

After visualizing polysomes, we performed metabolic labeling using [35S]methionine to confirm the occurrence of translation in mature erythrocytes. We incubated the cells with [35S]methionine in methionine-free and serum-free RPMI-1640 medium. During translation the radioactive [35S]methionine will be incorporated in newly synthesized proteins, which can be detected by autoradiography. [35S]methionine-treated mature erythrocytes showed a prominent band around 15 kDa and a minor band between 25 and 37 kDa, which was reduced in intensity when cells were treated with harringtonine, a translation inhibitor. This observation provided another evidence for active translation in mature erythrocytes. HeLa cells, treated with [35S]methionine under the same conditions, showed multiple bands as expected (Figure 3A). Similar observations were made when mature erythrocytes were isolated either by fluorescence-activated cell sorting using anti-CD71 antibody or by MACS coupled with lineage cell depletion (Supplemental Figure S1, D and E).

FIGURE 3:

FIGURE 3:

Open in a new tab

Evidence for translation in mature erythrocytes. (A) The autoradiogram shows the incorporation of [35S]methionine in mature erythrocytes. Treatment with harringtonine (3 µg/ml) reduced the radioactive signal. Mean values (N = 3 experiments) of densitometry analysis are shown. Another autoradiogram showing incorporation of [35S]methionine in HeLa cells under the same conditions served as positive control for the assay. (B) Liquid scintillation counts from total protein extracts of cells treated with [35S]methionine. Equal numbers of mature erythrocytes and reticulocytes were taken for comparison. Graph shows mean ± SE (N = 3). (C) RiboPuromycylation in mature erythrocytes demonstrates translation. Mature erythrocytes were treated with puromycin (91 µM) and probed with anti-puromycin antibody. Confocal microscopy images show puromycin incorporation in mature erythrocytes. Results are representative of three independent experiments. Scale bar, 10 μm. Harringtonine (3 μg/ml) was used to inhibit translation. All images were taken under identical microscope settings. Enlarged image of two cells inside the red square is shown. Corrected total cell fluorescence (mean ± SE, N > 50 cells) values are shown.

To quantify the translation in mature erythrocytes relative to reticulocytes, we performed metabolic labeling using [35S]methionine and measured the radioactive signal using a scintillation counter. The radioactive signal from mature erythrocytes was about 10% of that from reticulocytes. Equal numbers of mature erythrocytes and reticulocytes from the same donor were taken for this comparison (Figure 3B). It is important to note that the reticulocytes make up just 1% of erythrocytes in healthy individuals. Thus, the translation signal we observed in mature erythrocytes (10% of that in reticulocytes) in this assay is much higher than the signal that is expected due to reticulocyte contamination, if any.

We then employed the RiboPuromycylation method to detect translation (Bastide et al., 2018). Mature erythrocytes were treated with puromycin, which mimics charged tRNATyr. If there is translation, puromycin will be incorporated into nascent polypeptide chains during translation, which can be detected using anti-puromycin antibody. Consistent with the results of the metabolic labeling experiment, we found puromycin-specific signal in mature erythrocytes treated with puromycin using confocal microscopy. Importantly, it was reduced to background level in cells where translation was inhibited using harringtonine. Also, most of the cells in a given field were showing the puromycin-specific signal, which cannot be explained by contaminant cells, if any (Figure 3C). Furthermore, a Western blot performed using anti-puromycin antibody revealed puromycylated proteins around 15 kDa and above 25 kDa, similar to those in the [35S]methionine labeling experiment, in puromycin-treated mature erythrocytes (Supplemental Figure S1F). The band intensity was reduced when the cells were treated with harringtonine. Together, the results of the [35S]methionine labeling experiment and the RiboPuromycylation assay demonstrate translation in mature erythrocytes.

Globin mRNAs are translated in mature erythrocytes

Our next goal was to identify the mRNAs that are translated in mature erythrocytes. We subjected the RNA isolated from a translating pool (fractions 7–10, Figure 2A) to deep sequencing. mRNAs of α-globin (HBA1 and HBA2) and β-globin (HBB) were the top three most abundant mRNAs in the translating pool. Analysis of total RNA-seq data (includes both the translating and the nontranslating pool) revealed that these RNAs are enriched more than 3.5-fold in the translating pool (Table 1). However, CA1 and CA2 mRNAs, whose protein products were detected by mass spectrometry analysis (Supplemental Table S1), were not enriched in the translating pool. The abundant transcripts identified in our study were not found at a high level in a previous study (Doss et al., 2015). This is because of the difference in the method of RNA isolation. The authors in that study removed the globin mRNAs and rRNAs before RNA-seq. This step was not included in our protocol as our aim was to detect the rRNAs as well as the translatome.

TABLE 1:

Top protein-coding transcripts present in the translating pool of mature erythrocytes.

Gene name RPKM
Polysome sample A Polysome sample B Total RNA sample A Total RNA sample B
HBA1 5825.59 7515.57 286.44 927.67
HBA2 3169.87 3988.55 301.81 997.1
HBB 125.69 160.09 13.55 23.34
DUSP1 10.78 11.29 0.48 0.93
JUNB 7.93 8.17 ND 0.63
FOS 7.81 17.3 ND 0.43
FTL 5.40 8.35 0.68 2.55
ZFP36 5.78 6.89 0.34 0.05
UBB 4.79 7.95 0.69 3.78
CA1 0.05 0.03 0.56 0.53
CA2 0.03 0.01 0.52 0.36
Open in a new tab

CA1 and CA2 do not appear in the top-10 list. They are included here for comparison.

Translatome analysis revealed some unexpected results (Table 1). DUSP1, JUNB, FOS, FTL, ZFP36, and UBB were found to be enriched in the translating pool (Table 1). Analysis of their untranslated regions did not reveal any conserved sequences. FOS and JUNB encode components of AP1 transcription factor. It will be interesting to know the function of these transcription factors in erythrocytes that lack the nucleus. A noncanonical cytoplasmic function of c-Fos (coded by FOS) in the regulation of phospholipid synthesis has been reported (Caputto et al., 2014). Given the unique cell biology of mature erythrocytes, it is quite possible that they express protein isoforms with noncanonical functions.

To further confirm the enrichment of globin transcripts in polysome fractions, we performed qRT-PCR of the cDNA samples derived from the RNA of translating (dense fractions) and nontranslating (light fractions) pools of polysome profile. Ct values of 18S and 28S rRNAs were much smaller in the translating pool compared with the nontranslating pool as expected, which validated our polysome fractionation method. Importantly, Ct values of HBB (β-globin) and HBA (α-globin) were also significantly reduced in the translating pool compared with the nontranslating pool, indicating their translation (Figure 4A). While CA1 transcript was undetectable, the Ct values of CA2 (carbonic anhydrase) were comparable in both translating (29.52) and nontranslating (30.27) pools. These results suggest that α- and β-globin proteins are synthesized in mature erythrocytes. To demonstrate translation of globins, we treated mature erythrocytes with [35S]methionine and precipitated hemoglobin using nickel-nitrilotriacetic acid (Ni-NTA) beads as described previously (Williams et al., 2010). Precipitation of hemoglobin was confirmed by Western blot using anti–β-globin antibody. The autoradiogram revealed a prominent signal around 15 kDa, which was absent in control sample. Together, these results demonstrate translation of globins in mature erythrocytes (Figure 4B).

FIGURE 4:

FIGURE 4:

Open in a new tab

Translation of globin transcripts in mature erythrocytes. (A) Ct values of qRT-PCR analyses of 18S rRNA, 28S rRNA, HBB, and HBA mRNAs in the nontranslating (fractions 1–3 in Figure 2A) and translating fractions (fractions 7–10 in Figure 2A) of polysome profile of mature erythrocytes. The graphs show mean ± SD, n = 3. They represent three independent experiments. (B) Demonstration of translation of globins by [35S]methionine labeling. Mature erythrocytes were treated with [35S]methionine. The hemoglobin was precipitated using Ni-NTA beads. Precipitation of hemoglobin was confirmed by Western blot using anti–β-globin antibody. The autoradiogram revealed a prominent signal around 15 kDa. DF, dye-front. Result is representative of three independent experiments. (C, D) Luciferase assay to test the significance of the 5′UTR in the translation of HBB and HBA. cDNA of firefly luciferase (FLuc) was cloned downstream of and in-frame to the cDNA of HBB/HBA with the wild-type or mutant 5′UTR. Sequences of the 5′UTR, with the sites of mutation in red, are shown above the graph. Luciferase activity was measured after subjecting the constructs to in vitro transcription followed by in vitro translation using rabbit reticulocyte lysate. Graphs are representative of at least three independent experiments. Statistical significance (two-sided P value) was calculated using an unpaired Student’s t test. Graphs show mean ± SD; n = 3. (E, F) Western blot showing the effect of translation inhibition on the level of β-globin (E) and α-globin (F) in mature erythrocytes. Cells were treated with 100 μg/ml cycloheximide (CHX) or 3 μg/ml harringtonine (HGT). Media containing translation inhibitors was replaced every alternate day until the end of the experiment. Western blotting was performed 10 d after the treatment. The graph shows the densitometry analyses from three different experiments (mean ± SD). Statistical significance (two-sided P value) was calculated using a paired Student’s t test.

5´UTRs of HBA and HBB are important for their translation

To get more insights into the regulation of translation, we cloned the HBB coding sequence with or without its 5′UTR, upstream of the coding sequence of firefly luciferase. In vitro transcription followed by in vitro translation using rabbit reticulocyte lysate was performed using these constructs. We observed about a 10-fold increase in the translation of HBB in the presence of its 5′UTR compared with constructs without any 5′UTR or the one with a mutant sequence in place of the 5′UTR (Figure 4C). In the mutant sequence, an evolutionarily conserved region was mutated. Like the 5′UTR of HBB, the 5′UTR of HBA also enhanced the translation of its firefly luciferase construct. When conserved residues were mutated, the ability of the 5′UTR of HBA to enhance translation was decreased by about fourfold (Figure 4D). Unlike the 5′UTR of HBA and HBB, the 5′UTR of CA2, which was not a part of the translatome, did not enhance the translation in CA2-firefly luciferase construct (Supplemental Figure S2A). Furthermore, this 5′UTR-mediated enhancement of translation in luciferase reporter constructs was not observed in HEK293 or HeLa cells, which are nonerythroid cell lines (Supplemental Figure S2B). Together, these results show that the 5′UTRs of HBA and HBB play a critical role in recruiting their mRNAs for translation in cells of erythroid lineage.

Another factor that favors the translation of globin mRNAs in mature erythrocytes is their sheer abundance. As shown in Table 1, globin transcripts are 25–28-fold (HBB) or 600–1000-fold (HBA) more abundant compared with the next most abundant transcript, that is, DUSP1. Hence, globin transcripts are more likely to engage with translating machinery than other mRNAs. Furthermore, both HBA and HBB mRNAs have strong Kozak sequences, with a “G” in the +4 position and an “A” in the –3 position, which could also contribute to their preferential translation.

Translation is required for the maintenance of a normal level of globin proteins

Finally, we tested the effect of translation inhibition on the levels of β- and α-globins encoded by HBB and HBA mRNAs, which are translated in mature erythrocytes. We treated the cells with cycloheximide and harringtonine, two potent inhibitors of translation. After 10 d of treatment, we observed a significant reduction in the cellular levels of β- and α-globins. However, there was no change in the level of GAPDH, whose mRNA was not enriched in the polysome fractions of mature erythrocytes (Figure 4, E and F, and Supplemental Figure S2C). This observation shows that translation is required to maintain normal levels of β- and α-globins for long durations, and therefore hemoglobin, in mature erythrocytes. Treatment with cycloheximide and harringtonine for 10 d did not cause any change in the morphology or survival of mature erythrocytes (Supplemental Figure S2D). However, the same treatment for longer times caused apparent cell lysis, which could be attributed to inhibition of synthesis of essential proteins. Because globins are specific to erythroid cells, this observation rules out the possibility of contamination with nonerythroid cells, which do not express globins. Furthermore, an ∼50% reduction is much higher than the reduction expected if the signal was due to reticulocyte contamination.

Overall, our study provides multiple lines of evidence for translation in mature erythrocytes. Our results demonstrate functionally significant low-level translation in mature erythrocytes. This is consistent with recent studies that have reported the presence of both mRNAs and miRNAs in mature erythrocytes (Chen et al., 2008; Doss et al., 2015). Though the observed level of translation in mature erythrocytes is about 10% of that found in reticulocytes, its contribution will be physiologically significant given their long life (115 d) compared with reticulocytes (a few days).

It is important to note that the quantification of translation using [35S]methionine labeling, the RiboPuromycylation assay, and the significant reduction of globins observed upon translation inhibition show that the quantum of translation observed in mature erythrocytes is much above the level expected because of contaminating cells, if any, in our preparations.

In the absence of the nucleus, and therefore transcription, mature erythrocytes have to maintain mRNAs for their lifetime (∼115 d). This requires a mechanism to store them in a translationally repressed state as observed in certain RNA granules of nucleated cells (Buchan and Parker, 2009). This aspect needs to be explored.

The presence of translation in mature erythrocytes opens up new possibilities to treat erythrocyte-specific diseases. For example, β thalassemia patients with a premature stop codon in HBB can be treated with drugs that induce stop codon readthrough (e.g., Ataluren) (Welch et al., 2007; Kar et al., 2020). Similarly, miRNA-based and morpholino-based drugs that target protein translation can also be explored. Mature erythrocytes will be more accessible to these drugs than their precursor cells.

MATERIALS AND METHODS

Request a protocol through Bio-protocol.

Isolation of mature erythrocytes from whole blood

This study was approved by Institutional Human Ethics Committee of Indian institute of science (IHEC No: 18-28102016). Four milliliters of blood was taken from healthy volunteers and collected in heparinized vacutainers (BD Biosciences). Informed consent was obtained from all volunteers. The blood was centrifuged at 800 × g for 20 min at 4°C in a closed syringe without piston, and the plasma was discarded. After opening the syringe at the tip, about two-thirds of the sedimented erythrocytes were carefully allowed to drop out of the syringe without disturbing the white blood cell layer above the erythrocytes (Kabanova et al., 2009). The erythrocyte pellet was washed thrice with buffer containing 21 mM Tris, 4.7 mM KCl, 2 mM CaCl2, 140.5 mM NaCl, 1.2 mM MgSO4, 5.5 mM glucose and 0.5% bovine serum albumin (BSA) (Hanson et al., 2008). After washing, CD71+ cells were removed from erythrocytes using CD71 MACS MicroBeads and LD column (developed for depletion of human cells by Miltenyi Biotec) as per the manufacturer’s instructions. At the end, the CD71– population of mature erythrocytes was collected. The purity of the CD71– cells was confirmed before every experiment by flow cytometry as described below. Mature erythrocytes were maintained at 37°C and 5% CO2 in RPMI-1640 medium with 10% fetal bovine serum (Life Technologies), 100 U/ml penicillin, and 100 μg/ml streptomycin (Lonza).

To visualize mature erythrocytes, they were smeared on a glass slide and fixed in absolute methanol for 2 min. The smear was then rinsed and placed in Giemsa solution (Nice Chemicals, India) for 5 min. The smear was rinsed thoroughly with water and imaged using a microscope (Axio Scope.A1, Carl Zeiss; Objective: N-ACHROPLAN 20×/0.45 Ph2).

Western blot

Cell lysis was done in ice-cold cell lysis buffer containing 10 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 1% Triton X-100 and protease inhibitor cocktail. Fifty micrograms of total protein was used to perform SDS–PAGE, and the separated proteins were transferred onto a polyvinylidene fluoride (PVDF) membrane (0.45/0.2 µm; Merck Millipore). The membrane was blocked using 5% skimmed milk or 3% BSA in phosphate-buffered saline-Tween-20 (PBS-T) for 1 h at room temperature. The membrane was incubated with primary antibody overnight at 4°C with gentle rocking. Secondary antibodies were added the next day, and the blot was developed using the Clarity ECL reagent (Bio-Rad) or the SuperSignal West Femto reagent (Thermo Scientific). Images were captured using a LAS-3000 imager (Fujifilm) or the ChemiDoc Imaging System (Bio-Rad). Anti-MTCH2 (PA5-25406) and secondary antibodies (32430 and 32460) were from Thermo Scientific; anti-GAPDH antibody (G9295) was from Sigma-Aldrich; anti-CD71 (SC-32272), anti-RPL10a (SC-100827), anti–β-globin (SC-130320), and anti–α-globin (SC-514378) antibodies were from Santa Cruz Biotechnology; anti-puromycin antibody (PMY-2A4) was from Developmental Studies Hybridoma Bank; anti-VDAC1 antibody (820701) was from Biolegend; anti-prohibitin antibody (MA5-12858) was from Invitrogen. All antibodies were used according to the manufacturer’s protocol.

Flow cytometry

About 106 mature erythrocytes were washed with PBS containing 5% BSA and 0.1% sodium azide. They were then incubated with 1 μg of CD71 antibody at 4°C overnight. After three washes, fluorescently labeled secondary antibody (Alexa Fluor 488–conjugated; Life Technologies) was added and incubated in the dark on ice for 45 min. Cells were then washed and resuspended in 100 μl of PBS containing 5% BSA and 0.1% sodium azide. Cells were analyzed using the BD FACSCanto II flow cytometer.

Imaging of mitochondria and nuclei

Cells were washed with serum-free RPMI media and seeded in a 35 mm glass-bottomed confocal dish. The cells were treated with 100 nM MitoTracker Red CMXRos for mitochondria (Invitrogen) or 0.025% CyQUANT NF dye for nuclei (Invitrogen). Stained cells were visualized using a 100× objective (Super Apo Chromatic lens with numerical aperture 1.35) in a confocal microscope (Olympus FLUOVIEW FV3000). The imaging medium was Olympus IMMOIL-F30CC (low autofluorescence immersion oil Type F).

Polysome profiling

In a 10-cm cell culture dish, about 8 × 106 HeLa cells were incubated in complete DMEM containing cycloheximide (AMRESCO) (100 µg/ml) for 15 min at 37°C to block translation. Cells were then washed with cycloheximide-containing PBS and lysed using TMK lysis buffer (10 mM Tris [pH 7.4], 5 mM MgCl2, 100 mM KCl, 1% Triton X-100, 0.5% deoxycholate, freshly added 2 mM dithiothreitol [DTT], and 100 µg/ml cycloheximide) (Yao et al., 2012). In the case of mature erythrocytes, we started with about 5 × 108 cells. The lysis buffer contained 20 mM Tris (pH 7.4), 5 mM MgCl2, 150 mM NaCl, 1% Triton X-100, freshly added 2 mM DTT, and 100 µg/ml cycloheximide (Ingolia et al., 2012). Sucrose solutions (10 and 50%) containing 100 µg/ml cycloheximide and 1 mM DTT were prepared in gradient buffer (10×: 0.5 M Tris acetate [pH 7.0], 0.5 M NH4Cl, 0.12 M MgCl2 in diethyl pyrocarbonate water). The gradient was prepared using a gradient profiler (Biocomp Gradient Station ip Model 153) with the following parameters: angle, 81.5°; time, 1 min 55 s; rpm, 25. The cell lysate (HeLa; 200 μg of total protein; mature erythrocytes, 1.5 mg of total protein) was carefully laid on top of the sucrose gradient. The tubes were centrifuged at 29,000 rpm (144208 RCFmax; SW 41 Ti rotor; Optima L-70K centrifuge; Beckman Coulter) for 4 h at 4°C. Polysome fractionation was carried out, and 10 fractions were collected. The bottom-most fraction was discarded as it contains cell debris.

Isolation of ribosomes using sucrose cushion

Ribosomes were isolated from mature erythrocytes using a sucrose cushion as described previously (Belin et al., 2010). About 1010 mature erythrocytes were resuspended in buffer containing 250 mM sucrose, 250 mM KCl, 5 mM MgCl2, 50 mM HEPES-KOH (pH 7.4), and 100 µg/ml cycloheximide. They were lysed by adding NP-40 (0.7% final concentration). The lysate was centrifuged at 12,500 × g for 10 min at 4°C. Supernatant (11 ml) was layered on 1 ml of sucrose cushion (1 M sucrose, 0.5 M KCl, 5 mM MgCl2, 50 mM HEPES-KOH [pH 7.4], and 100 µg/ml cycloheximide) in a polycarbonate tube (13.5 ml capacity). Tubes were centrifuged at 45,000 rpm (equivalent to 183254 RCFmax; TI 50 rotor and L8-60M ultracentrifuge; Beckman Coulter) for 4 h at 4°C. Ribosomes appear as solid, translucent pellet at the bottom of the tube. The supernatant was carefully decanted, and the pellet was rinsed with buffer containing 25 mM KCl, 5 mM MgCl2, 50 mM HEPES-KOH (pH 7.4), and 100 µg/ml cycloheximide to remove residual proteins adhering to it. The pellet containing ribosomes was then resuspended in the same buffer.

To separate polysomes from monosomes, we performed density gradient ultracentrifugation. Sucrose gradient (10–50%) was prepared as described above. The ribosome-containing sample (from the previous step) was carefully loaded on top of the gradient. The tubes were centrifuged at 29,000 rpm (144208 RCFmax; SW 41 Ti rotor; Optima LE-70 ultracentrifuge; Beckman Coulter) for 4 h at 4°C. After centrifugation, 400 μl fractions were collected and absorbance at 260 nm was measured using BioPhotometer D30 (Eppendorf). A total of 30 fractions were collected. Fractions 11–16 constitute the monosomes, and fractions 21–27 constitute the polysomes. These fractions were pooled and concentrated using a Vivaspin 500 100 K MWCO PES concentrator (Sartorius) for negative staining.

Negative staining and transmission electron microscopy

Three microliters of the concentrated monosome and polysome fractions (derived from the sucrose cushion as described above) was applied on formvar/carbon (10 nm formvar and 1 nm carbon)-coated copper grids (400 mesh) (Electron Microscopy Sciences; FCF400-Cu) and incubated for 1 min. Excess sample was removed using blotting paper. Three microliters of 2% uranyl acetate (Electron Microscopy Sciences; 22400) was added to the grid and incubated for 30 s. The excess stain was removed using blotting paper. The grids were then visualized using a transmission electron microscope (Tecnai T12; FEI; accelerating voltage, 120 kV; beam source, LaB6). The images were acquired using a Veleta TEM side-mounted camera (software, Tecnai User Interface, TIA).

qRT-PCR

RNA was isolated from fractions using the GeneJet RNA purification kit (Thermo Scientific). cDNA was synthesized from the obtained RNA using RevertAid Reverse Transcriptase (Thermo Scientific). qRT-PCR was done using a SYBR Green mix (Takara) on an iQ5 instrument (Bio-Rad). Reactions were carried out in triplicate. The cycling conditions used were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, and a single final step at 72°C for 5 min. Melting curves were generated after each reaction.

Sequences of primers used are given below:

HBA1 and HBA2:

  • 5′ CAACTTCAAGCTCCTAAGCCACTGC 3′ and 5′ CGGTGCTCACAGAAGCCAG 3′

HBB:

  • 5′ AGGAGAAGTCTGCCGTTACTG 3′ and 5′ CCGAGCACTTT­CTTGCCATGA 3′ RNA18S1:

  • 5′ GGCCCTGTAATTGGAATGAGTC 3′ and 5′ CCAAGATCCAA­CTACGAGCTT 3′

RNA28S1:

  • 5′ GGGTGGTAAACTCCATCTAAGG 3′ and 5′ GCCCTCTTG­AACTCTCTCTTC 3′

Labeling with [ 35S]methionine

About 108 mature erythrocytes were incubated with methionine-free, serum-free RPMI-1640 medium containing 3 μl of 11 mCi/ml [35S]methionine for 4 h. Control cells were incubated in complete RPMI medium. In one sample, 3 μg/ml harringtonine was added 2 h before treatment with [35S]methionine and continued for 4 h. After the incubation period, cells were washed twice with PBS to remove residual label. Cells were then lysed, and the lysate was subjected to SDS–PAGE. The gel was dried and exposed overnight to exposure cassette (GE Healthcare). The film was visualized using the Phosphorimager (Typhoon FLA 9000; GE).

To compare the translation efficiencies in CD71+ and CD71- erythrocytes, about 108 cells were treated with [35S]methionine (7 µl of 10 mCi/ml stock in 1 ml of medium) as described above for 2 h. After being washed with PBS, the cells were lysed with 1 ml of lysis buffer containing 10 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 1% Triton X-100. The lysate was centrifuged at 15,000 rpm for 10 min. This lysate (150 μl) was subjected to trichloroacetic acid (TCA) precipitation. NaOH (150 μl of 1 N) was added to the lysate and incubated at room temperature for 10 min. Ice-cold 25% TCA (300 μl) was added to it and incubated on ice for 20 min. The contents were centrifuged at 14,000 rpm for 3 min. The pellet was washed thrice with ice-cold 5% TCA, and a final rinse was done with ice-cold acetone. The pellet was allowed to air dry. Scintillation fluid (300 μl) (50% 2-methoxy ethanol, 50% toluene, 0.5% 2,5-diphenyloxazole [PPO], and 0.05% 1,4-bis(5-phenyloxazol-2-yl) benzene [POPOP]) was added to the air-dried pellet, and the scintillation count per minute was measured using a MicroBeta2 2450 microplate counter (Perkin Elmer).

RiboPuromycylation

Mature erythrocytes (108) were treated with 91 μM puromycin (Sigma-Aldrich) for 4 h at 37°C (David et al., 2012). In one group, cells were pretreated with harringtonine (3 μg/ml) for 18 h before puromycin treatment. Cells were then smeared on glass slides and air-dried. They were fixed with ice-cold methanol for 15 s at room temperature and washed thrice with PBS. Blocking was done with buffer containing 1% BSA, 22.52 mg/ml glycine, 0.1% Tween-20 in PBS for 30 min (Abcam protocol). Cells were then incubated overnight at 4°C with anti-puromycin antibody followed by secondary antibody conjugated Alexa Fluor 488. After three washes, the coverslip was mounted on the slide using DuoLink in situ mounting medium (Sigma-Aldrich). Slides were imaged using 100× objective (Super Apo Chromatic lens with numerical aperture 1.35) in a confocal microscope (Olympus FLUOVIEW FV3000). The imaging medium was Olympus IMMOIL-F30CC (low autofluorescence immersion oil Type F). A high sensitivity spectral detector (GaAsP) was used to visualize the fluorescence. FLUOVIEW FV31S-SW software was used to acquire images.

Mass spectrometry

Lysate from mature erythrocytes was electrophoresed on 12% SDS–PAGE. The gel was cut into pieces and washed with water and dehydrated in acetonitrile and then reduced with DTT and alkylated with iodoacetamide. In-gel digestion was carried out by adding 5 μl of 10 ng/μl trypsin in 50 mM ammonium bicarbonate overnight at room temperature. Peptides were extracted from the polyacrylamide in two aliquots of 30 μl 50% acetonitrile with 5% formic acid. These extracts were combined and evaporated to <10 μl in Speedvac and then resuspended in 1% acetic acid. The liquid chromatography-mass spectrometry system used was the Thermo Scientific Fusion Lumos mass spectrometer system. The high performance liquid chromatography column was a Dionex 15 cm × 75 µm id Acclaim PepMap C18, 2 μm, 100 Å reversed-phase capillary chromatography column (Thermo Scientific). Five-microliter volumes of the extract was injected, and the peptides were eluted from the column by an acetonitrile/0.1% formic acid gradient at a flow rate of 0.25 μl/min. The microelectrospray ion source was operated at 2.5 kV. The digest was analyzed using the data-dependent multitask capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra. The data were analyzed by using all high energy collisional dissociation spectra collected in the experiment to search the human UniProtKB database with the search program Mascot and Sequest. Protein and peptide validation were performed using the program Scaffold.

RNA sequencing

Total RNA was isolated from fractions 7–10 of the polysome profile using a GeneJet RNA purification column (Thermo Scientific). This comprised the “Polysome RNA” (translating pool). Total RNA was also isolated from mature erythrocytes and comprised the “Total RNA.” Next-generation sequencing was done by Clevergene Biocorp (Bengaluru, India). The RNA library was prepared using the NEBNext Ultra II RNA library prep kit for Illumina. The library quality was checked using the Agilent Bioanalyzer DNA 1000 assay kit (Agilent Technologies), and quantity was checked using Qubit dsDNA HS Assay kit (Thermo Scientific). The QC passed libraries were sequenced using Illumina HiSeqX as per the manufacturer’s instructions. Sequence data quality was assessed using FastQC and MultiQC programs. Trim galore was used to remove adapter sequences and low-quality bases. As erythrocytes lack mitochondria, the mitochondrial genome was removed from the reference genome while building the index. The processed reads were mapped to reference genome (GRCh 38) using STAR Aligner. The number of reads mapped per gene was obtained using the featureCounts program. Multimapped and overlapped reads were also considered during read counting. RPKM (reads per kilobase of transcript per million reads mapped) values were calculated using the R statistical program.

In vitro transcription, translation, and luciferase assay

HBB/HBA/CA2 coding sequences were cloned upstream of and in-frame with the cDNA of firefly luciferase with or without 5′UTR in the pcDNA 3.1 plasmid. A linker sequence (5′ GGCGGCTCCGGCGGCTCCCTCGTGCTCGGG 3′) was included between luciferase and the test sequence (HBB/HBA/CA2). PCR-based site-directed mutagenesis was used to generate mutations in the 5′UTR. Plasmids were linearized and subjected to in vitro transcription using T7 RNA polymerase (Thermo Scientific) for 3 h at 37°C. The RNA was purified using a GeneJet RNA purification column (Thermo Scientific). It (0.5–2 μg) was subjected to in vitro translation using the Rabbit Reticulocyte Lysate system (Promega) for 90 min at 30°C. Luciferase activity was measured using the Luciferase Assay System (Promega) in GloMax Explorer (Promega).

Data availability

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the data set identifier PXD021774 and 10.6019/PXD021774.

The data can be accessed using the following credentials: Username: reviewer_pxd021774@ebi.ac.uk; Password: 6YVyxjDX.

Raw data related to polysome-associated RNAs and cellular RNAs are available in NCBI’s GEO with accession number GSE128648.

Supplementary Material

Click here for additional data file. (6MB, pdf)
Click here for additional data file. (301.2KB, pdf)
Click here for additional data file. (54.7KB, xlsx)

Acknowledgments

We acknowledge the financial support from the Department of Science and Technology (Department of Biotechnology (DBT), Ministry of Science and Technology, Govt. of India; Swarnajayanti Fellowship), a STARS grant from the Ministry of Education, Govt. of India, DST Funds for Improvement of S&T infrastructure, the DBT–Indian Institute of Science Partnership Program for Advanced Research in Biological Sciences, and funds from the University Grants Commission (UGC), India. S.M.E. (IA/I/15/1/501833), T. H. (IA/I/17/2/503313), and P.I.R. (IA/I/12/2/500625) are recipients of Department of Biotechnology–Wellcome Trust India Alliance Intermediate Fellowships. A grant for Young Scientists from the DST–Science and Engineering Research Board (SERB), India (YSS/2 institution 015/000989 to S.M.E.), is acknowledged. The Fusion Lumos instrument was purchased via a National Institutes of Health shared instrument grant, 1S10OD023436-01 (to B. W.).

Abbreviations used:

BSA

bovine serum albumin

CA

carbonic anhydrase

Ct

cycle threshold

DTT

dithiothreitol

EDTA

ethylenediamine tetra acetic acid

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

MACS

magnetic activated cell sorting

UTR

untranslated region.

Footnotes

This article was published online ahead of print in MBoC in Press (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E21-09-0437) on August 17, 2022.

REFERENCES

  1. Alvarez-Dominguez JR, Zhang X, Hu W (2017). Widespread and dynamic translational control of red blood cell development. Blood 129, 619–629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bastide A, Yewdell JW, David A (2018). The RiboPuromycylation Method (RPM): an Immunofluorescence technique to map translation sites at the sub-cellular level. Bio-Protoc 8, e2669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Belin S, Hacot S, Daudignon L, Therizols G, Pourpe S, Mertani HC, Rosa-Calatrava M, Diaz JJ (2010). Purification of ribosomes from human cell lines. Curr Protoc Cell Biol Chapter 3, Unit 3.40. [DOI] [PubMed] [Google Scholar]
  4. Borsook H, Deasy CL, Haagensmit AJ, Keighley G, Lowy PH (1952). Incorporation in vitro of labeled amino acids into proteins of rabbit reticulocytes. J Biol Chem 196, 669–694. [PubMed] [Google Scholar]
  5. Buchan JR, Parker R (2009). Eukaryotic stress granules: the ins and outs of translation. Mol Cell 36, 932–941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Caputto BL, Cardozo Gizzi AM, Gil GA (2014). c-Fos: an AP-1 transcription factor with an additional cytoplasmic, non-genomic lipid synthesis activation capacity. Biochim Biophys Acta 1841, 1241–1246. [DOI] [PubMed] [Google Scholar]
  7. Chen SY, Wang Y, Telen MJ, Chi JT (2008). The genomic analysis of erythrocyte microRNA expression in sickle cell diseases. PLoS One 3, e2360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cohen RM, Franco RS, Khera PK, Smith EP, Lindsell CJ, Ciraolo PJ, Palascak MB, Joiner CH (2008). Red cell life span heterogeneity in hematologically normal people is sufficient to alter HbA1c. Blood 112, 4284–4291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cortese-Krott MM, Kelm M (2014). Endothelial nitric oxide synthase in red blood cells: key to a new erythrocrine function? Redox Biol 2, 251–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. David A, Dolan BP, Hickman HD, Knowlton JJ, Clavarino G, Pierre P, Bennink JR, Yewdell JW (2012). Nuclear translation visualized by ribosome-bound nascent chain puromycylation. J Cell Biol 197, 45–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Doss JF, Corcoran DL, Jima DD, Telen MJ, Dave SS, Chi JT (2015). A comprehensive joint analysis of the long and short RNA transcriptomes of human erythrocytes. BMC Genom 16, 952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Franco RS (2012). Measurement of red cell lifespan and aging. Transfus Med Hemother 39, 302–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hanson MS, Stephenson AH, Bowles EA, Sridharan M, Adderley S, Sprague RS (2008). Phosphodiesterase 3 is present in rabbit and human erythrocytes and its inhibition potentiates iloprost-induced increases in cAMP. Am J Physiol Heart Circ Physiol 295, H786–H793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Holloway BW, Ripley SH (1952). Nucleic acid content of reticulocytes and its relation to uptake of radioactive leucine in vitro. J Biol Chem 196, 695–701. [PubMed] [Google Scholar]
  15. Ingolia NT, Brar GA, Rouskin S, McGeachy AM, Weissman JS (2012). The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments. Nat Protoc 7, 1534–1550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kabanova S, Kleinbongard P, Volkmer J, Andree B, Kelm M, Jax TW (2009). Gene expression analysis of human red blood cells. Int J Med Sci 6, 156–159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kakhniashvili DG, Bulla LA Jr, Goodman SR (2004). The human erythrocyte proteome: analysis by ion trap mass spectrometry. Mol Cell Proteomics 3, 501–509. [DOI] [PubMed] [Google Scholar]
  18. Kar D, Sellamuthu K, Kumar SD, Eswarappa SM (2020). Induction of translational readthrough across the thalassemia-causing premature stop codon in beta-globin-encoding mRNA. Biochemistry 59, 80–84. [DOI] [PubMed] [Google Scholar]
  19. King HA, Gerber AP (2016). Translatome profiling: methods for genome-scale analysis of mRNA translation. Brief Funct Genomics 15, 22–31. [DOI] [PubMed] [Google Scholar]
  20. Koury MJ, Koury ST, Kopsombut P, Bondurant MC (2005). In vitro maturation of nascent reticulocytes to erythrocytes. Blood 105, 2168–2174. [DOI] [PubMed] [Google Scholar]
  21. Lacsina JR, LaMonte G, Nicchitta CV, Chi JT (2011). Polysome profiling of the malaria parasite Plasmodium falciparum. Mol Biochem Parasitol 179, 42–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Loken MR, Shah VO, Dattilio KL, Civin CI (1987). Flow cytometric analysis of human bone marrow: I. Normal erythroid development. Blood 69, 255–263. [PubMed] [Google Scholar]
  23. Mock DM, Lankford GL, Matthews NI, Burmeister LF, Kahn D, Widness JA, Strauss RG (2012). Accelerated removal of antibody-coated red blood cells from the circulation is accurately tracked by a biotin label. Transfusion 52, 1097–1105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Moras M, Lefevre SD, Ostuni MA (2017). From erythroblasts to mature red blood cells: organelle clearance in mammals. Front Physiol 8, 1076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Neelam S, Kakhniashvili DG, Wilkens S, Levene SD, Goodman SR (2011). Functional 20S proteasomes in mature human red blood cells. Exp Biol Med 236, 580–591. [DOI] [PubMed] [Google Scholar]
  26. Skadberg O, Brun A, Sandberg S (2003). Human reticulocytes isolated from peripheral blood: maturation time and hemoglobin synthesis. Lab Hematol 9, 198–206. [PubMed] [Google Scholar]
  27. Welch EM, Barton ER, Zhuo J, Tomizawa Y, Friesen WJ, Trifillis P, Paushkin S, Patel M, Trotta CR, Hwang S, et al. (2007). PTC124 targets genetic disorders caused by nonsense mutations. Nature 447, 87–91. [DOI] [PubMed] [Google Scholar]
  28. Williams LM, Fu Z, Dulloor P, Yen T, Barron-Casella E, Savage W, Van Eyk JE, Casella JF, Everett A (2010). Hemoglobin depletion from plasma: considerations for proteomic discovery in sickle cell disease and other hemolytic processes. Proteomics Clin Appl 4, 926–930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yao P, Potdar AA, Arif A, Ray PS, Mukhopadhyay R, Willard B, Xu Y, Yan J, Saidel GM, Fox PL (2012). Coding region polyadenylation generates a truncated tRNA synthetase that counters translation repression. Cell 149, 88–100. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file. (6MB, pdf)
Click here for additional data file. (301.2KB, pdf)
Click here for additional data file. (54.7KB, xlsx)

Data Availability Statement

The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the data set identifier PXD021774 and 10.6019/PXD021774.

The data can be accessed using the following credentials: Username: reviewer_pxd021774@ebi.ac.uk; Password: 6YVyxjDX.

Raw data related to polysome-associated RNAs and cellular RNAs are available in NCBI’s GEO with accession number GSE128648.

Articles from Molecular Biology of the Cell are provided here courtesy of American Society for Cell Biology

RESOURCES