Skip to main content
Heliyon logoLink to Heliyon
. 2022 Oct 31;8(11):e11324. doi: 10.1016/j.heliyon.2022.e11324

Prevalence and genetic diversity of coronaviruses, astroviruses and paramyxoviruses in wild birds in southeastern Kazakhstan

Andrey V Zhigailov a,b, Elina R Maltseva a,b,c, Yuliya V Perfilyeva a,b,, Yekaterina O Ostapchuk a,b, Dinara A Naizabayeva a,d, Zhanna A Berdygulova a, Saltanat A Kuatbekova a, Anna S Nizkorodova a,b, Akzhigit Mashzhan a,d, Andrey E Gavrilov e, Almat Zh Abayev e, Ilyas A Akhmetollayev a, Seidigapbar M Mamadaliyev a, Yuriy A Skiba a,b,c
PMCID: PMC9638769  PMID: 36353173

Abstract

Wild birds are natural reservoirs of many emerging viruses, including some zoonoses. Considering that the territory of Kazakhstan is crossed by several bird migration routes, it is important to know pathogenic viruses circulating in migratory birds in this region. Therefore, the aim of this study was to identify the host range, diversity and spatial distribution of avian paramyxoviruses, coronaviruses, and astroviruses in free-ranging wild birds in the southeastern region of Kazakhstan. For this purpose, we collected tracheal and cloacal swabs from 242 wild birds belonging to 51 species and screened them using conventional PCR assays. Overall, 4.1% (10/242) and 2.9% (7/242) of all examined birds tested positive for coronaviruses and astroviruses, respectively. Coronaviruses were found in the orders Pelecaniformes (30%; 3/10), Charadriiformes (30%; 3/10), Columbiformes (20%; 2/10), Anseriformes (10%; 1/10), and Passeriformes (10%; 1/10). All detected strains belonged to the genus Gammacoronavirus. Astroviruses were detected in birds representing the orders Passeriformes (57%; 4/7), Coraciiformes (14%; 1/7), Charadriiformes (14%; 1/7), and Columbiformes (14%; 1/7). Paramyxoviruses were observed in only two birds (0.8%; 2/242). Both strains were closely related to the species APMV-22, which had not been previously detected in Kazakhstan. Phylogenetic analysis of the partial RdRp gene sequences of the virus strains revealed three different clades of astroviruses, two clades of coronaviruses, and one clade of paramyxoviruses. The results of this study provide valuable information on the diversity and spatial distribution of paramyxoviruses, coronaviruses, and astroviruses in wild birds in southeastern Kazakhstan and highlight the importance of further thorough monitoring of wild birds in this region.

Keywords: Astroviruses, Coronaviruses, Paramyxoviruses, RdRp gene, Wild birds

Highlights

  • First study on CoVs and AstroVs in wild birds in Kazakhstan.

  • APMVs, CoVs and AstroVs are confirmed by RT-PCR and partial RdRp gene sequencing.

  • The CoVs prevalence is higher in aquatic birds as compared to terrestrial species.

  • The obtained CoV strains belong to the genus Gammacoronavirus

  • Strains closely related to APMV-22 not previously detected in Kazakhstan are shown.


Astroviruses; Coronaviruses; Paramyxoviruses; RdRp gene; Wild birds.

1. Introduction

Three of the eight major global migration routes for terrestrial and waterbirds cross the territory of Kazakhstan, including the West Asian/East African, Central Asian and Black Sea/Mediterranean flyways (BirdLife International, 2022). In addition, southeastern Kazakhstan is partially crossed by the fourth East Asian/Australasian flyway. Several wader species belonging to the order Charadriiformes stop here on their way from Siberia and the Russian Far East to Indonesia and northern Australia (Gavrin et al., 1962). After a long flight through the mountain ridges of the Pamir, Tibet, and the Tien Shan the migratory birds need to stop and replenish their strength for an onward flight. Wetlands of the southeastern region of Kazakhstan, surrounded by the Tien Shan mountain ridge in the south and the Dzhungarian Alatau and Altai ridges in the east, are attractive gathering places for a wide range of avian species.

Wild birds are important natural reservoirs and potential dispersers of a variety of highly pathogenic viruses. Due to their flocking behavior and ability to fly long distances, they have the potential to efficiently spread emerging pathogens among themselves, poultry, livestock, and humans (Lau et al., 2018). In particular, wild birds have been implicated in the spread of paramyxoviruses (APMVs), coronaviruses (CoVs), and astroviruses (AstroVs), the causative agents of significant diseases of avian and mammalian species including humans.

According to the International Committee on Taxonomy of Viruses (ICTV), APMVs are placed under the subfamily Avulavirinae of the family Paramyxoviridae. and represented by three genera, including Orthoavulavirus, Metaavulavirus and Paraavulavirus (Rima et al., 2019). To date, 22 species of APMVs (APMV-1 to APMV-22) that cause diseases with various clinical presentations in a wide variety of avian species have been identified (Rao et al., 2020). Coronaviruses belong to the family Coronaviridae, subfamily Orthocoronavirinae. They cause respiratory, hepatic, enteric, and neurological disorders in mammals and birds (Lau et al., 2018; Łukaszuk and Stenzel, 2020). Alpha-CoVs and beta-CoVs are found in mammals, whereas gamma-CoVs and delta-CoVs are mainly found in birds (Woo et al., 2012). Avian astroviruses are members of the genus Avastrovirus of the family Astroviridae. According to ICTV, three species of the genus Avastrovirus including Avastrovirus 1, Avastrovirus 2, and Avastrovirus 3 have been described (Todd et al., 2009). These viruses cause gastrointestinal disorders in poultry and are frequently detected in birds with enteritis as well as in clinically healthy ones (Cortez et al., 2017).

While surveillance of avian influenza viruses is conducted effectively in Kazakhstan (Lewis et al., 2021), surveillance of APMVs is sporadic (Bogoyavlenskiy et al., 2009; Karamendin et al., 2016, 2017), and to our knowledge, there are no data on the prevalence and genetic diversity of avian CoVs and AstroVs circulating in Kazakhstan. Meanwhile, the diseases caused by these viruses can lead to substantial economic losses to commercial poultry. Therefore, the aim of this study was to identify the host range, diversity, and spatial distribution of APMVs, CoVs and AstroVs in free-ranging wild birds in southeastern Kazakhstan.

2. Materials and methods

2.1. Ethics statement

This study was approved by the local ethical committee of the Institute of Genetics and Physiology of the Committee of Science of the Ministry of Education and Science of the Republic of Kazakhstan (approval # 2019-12-No2). All experimental procedures were performed in accordance with the International Guiding Principles for Biomedical Research Involving Animals.

2.2. Sample collection

Tracheal and cloacal swabs were collected from individual birds using sterile swabs, then placed into viral transport medium (Multitrans Collection and Transportation System, Starplex) and transferred to the laboratory in liquid nitrogen. Selection of sampling sites was based on the location of major migratory habitats. Samples from terrestrial birds were collected mainly at the ornithological station in the Chokpak Pass located between the Talas Alatau and Karatau mountain ranges in Zhambyl oblast. Samples were collected in 2020 and 2021 at the Chokpak-2020 (42°33′50″N, 70°37′04″E) and Chokpak-2021 (42°30′56″N, 70°39′51″E) sites, respectively. Samples from aquatic birds were collected in 2020 at four collection sites: Maykamys village on the northern coast of Lake Balkhash (46°39′02″N, 77°34′22″E), Tentek River (46°14′20″N 80°59′46″E), Mynkol Lakes (46°25′42″N, 81°13′37″E) and Big Alakol Island (46°11′32″N, 81°46′01″E) in Almaty oblast (Figure 1). After sampling, all captured birds were released back to the source habitat.

Figure 1.

Figure 1

Sites of sample collection in southeastern Kazakhstan. Map was generated using the ArcGIS Earth version 1.14.0.3321.

A total of 242 migratory and non-migratory birds representing 12 orders, 26 families, and 51 species were sampled at six locations in southeastern Kazakhstan (Table 1). Aquatic and terrestrial birds accounted for 27.7% (67/242) and 72.3% (175/242), respectively. Migratory birds outweighed resident birds in both the number of individuals collected (81%; 196/242 and 19%; 46/242, respectively) and across tested species (86%; 44/51 and 14%; 7/51, respectively). Most birds captured belonged to the order Passeriformes (44.2%; 107/242). Detailed information regarding bird species is presented in Table 2. Only 34.3% (83/242) birds were sampled in 2021, while all other birds (65.7%; 159/242) were captured and sampled in 2020.

Table 1.

Summary of data on birds sampled in southeastern Kazakhstan during the period 2020–2021.

Avian order Chokpak-2020 Chokpak-2021 Maykamys Tentek Mynkol Alakol Total (%)
Falconiformes 24 2 26 (10.7%)
Strigiformes 5 3 8 (3.3%)
Caprimulgiformes 6 6 (2.5%)
Columbiformes 13 1 14 (5.8%)
Coraciiformes 7 6 13 (5.4%)
Charadriiformes 40 8 1 49 (20.2%)
Passeriformes 41 64 2 107 (44.2%)
Galliformes 1 1 (0.4%)
Anseriformes 1 4 5 (2.1%)
Pelecaniformes 11 11 (4.6%)
Ciconiiformes 1 1 (0.4%)
Podicipediformes 1 1 (0.4%)
Total (%): 90 (37.2%) 83 (34.3%) 40 (16.5%) 12 (5.0%) 11 (4.5%) 6 (2.5%) 242

Table 2.

Data on RT-PCR-positive samples obtained from birds in southeastern Kazakhstan.

Order Family Species No of birds No (%) PCR-positive samples
CoV APMV AstroV
Falconiformes Accipitridae Pernis ptilorhynchus 1
Milvus migrans 7
Circus cyaneus 2
Accipiter gentilis 2
Accipiter nisus 5
Buteo buteo 6
Falconidae Falco subbuteo 2
Falco naumanni 1
Strigiformes Strigidae Asio otus 2
Asio flammeus 1
Otus scops 5
Columbiformes Columbidae Columba palumbus 2 1 (50%)
Columba oenas 4 1 (25%) 1 (25%)
Columba eversmanni 1
Columba livia 2 1 (50%) 1 (50%)
Streptopelia orientalis 5
Coraciiformes Meropidae Merops apiaster 12 1 (8%)
Coraciidae Coracias garrulus 1
Charadriiformes Laridae Larus ichthyaetus 1 1 (100%)
Hydroprogne caspia 40 1 (3%)
Larus ridibundus 2 1 (50%)
Scolopacidae Tringa totanus 4 1 (25%)
Charadriidae Vanellus vanellus 2
Passeriformes Hirundinidae Riparia diluta 11 1 (9%)
Hirundo rustica 13 1 (8%)
Hirundo daurica 1
Sturnidae Sturnus roseus 3
Sturnus vulgaris 1
Corvidae Corvus monedula 6 2 (33 %)
Corvus frugilegus 9 1 (11%)
Corvus corone 4
Corvus cornix 4
Turdidae Turdus atrogularis 1
Oenanthe pleschanka 4
Luscinia luscinia 1
Fringillidae Fringilla coelebs 2
Fringilla montifringilla 2
Emberizidae Emberiza leucocephalos 1
Emberiza calandra 3
Muscicapidae Muscicapa striata 2
Laniidae Lanius minor 3
Passeridae Passer hispaniolensis 34
Sylviidae Acrocephalus dumetorum 1
Paridae Parus bokharensis 1
Galliformes Phasianidae Perdix perdix 1
Caprimulgiformes Caprimulgidae Caprimulgus europaeus 6
Pelecaniformes Pelecanidae Pelecanus crispus 11 3 (27%)
Ciconiiformes Ardeidae Nycticorax nycticorax 1
Anseriformes Anatidae Tadorna ferruginea 4 1 (25%)
Anas platyrhynchos 1
Podicipediformes Podicipedidae Podiceps cristatus 1
Total: 242 10 (4.1%) 2 (0.8%) 7 (2.9%)

2.3. RNA extraction and cDNA synthesis

The swabs were stored at −80°С. Viral RNA was extracted using an RNeasy Mini Kit (Qiagen). RNA was eluted in 40 μl RNase-free water and used immediately for RT-PCR or stored at −80°С until further analysis. Complementary DNA (cDNA) was synthesized using a SuperScript IV Reverse Transcriptase Kit (Thermo Fisher scientific) according to the manufacturer’s instructions using random hexamer primers.

2.4. PCR assay

All samples were screened for APMVs, CoVs and AstroVs using a conventional RT-PCR assay. The primers used in the study are listed in Table 3.

Table 3.

Primers for PCR screening assays.

Pathogen Name Sequence Genome position∗ Target Ta [°C] Product size, bp Reference
Primers for detection and (or) molecular characterization of paramyxoviruses
Paramyxovirinae PAR-F1 (5′)GARGGNYDRTGYCARAARHTDTGGAC 10543–10568a 50 650–656 (Tong et al., 2008), modified
Paramyxovirinae (seminested PCR assay) PAR-R
PAR-F2
(5′)GCTGAAGTTACNGGHTCHCCDATRTTBC 11177–11204a L gene (RdRp locus)
(5′)GTTGCTTCAATGGTTCARGGNGAYAA 10621–10646a 573–579
Avulavirus, Rubulavirus PAR-Avu-F4 (5′)AGYRTNTTYHTNAARGAYAARGCAAT 9784–9809a 53 836–926 This study
PAR-Avu-R4 (5′)ATTRCYTGATTRTCWCCYTGNACCAT 10630–10655a
Primers for detection, typing and(or) molecular characterization of coronaviruses
Coronaviridae pan-CoV-outF (5′)CCAARTTYTAYGGHGGBTGG 14117–14137b Orf1a,b gene (RdRp locus) 53 670–673 (Xiu et al., 2020), modified
pan-CoV-outR (5′)TGTTGHGARCARAAYTCATGDGG 14767–14789b
Coronaviridae (nested PCR assay) CoV-RdRp-F2 (5′)GGTTGGGACTATCCTAAGTGTGA 14188–14210b 53 436–440 (Chu et al., 2011)
CoV-RdRp-R2 (5′)CCATCATCAGATAGAATCATCAT 14605–14627b
Coronaviridae (nested PCR assay) CoV-RdRp-F3 (5′)GGKTGGGAYTAYCCKAARTG 14188–14207b 53 599–602 (Chu et al., 2011)
CoV-RdRp-F3 (5′)TGYTGTSWRCARAAYTCRTG 14770–14789b
Gammacoronavirus CoV-Hel-GAM-F (5′)GTGYDGGTAGYGAAAAYGTTGATGAT 15428–15453b Orf1a,b gene (Hel locus) 54 1123 This study
CoV-Hel-GAM-R (5′)AARCACTSRCGTGATTCTGGGT 16529–16550b
Deltacoronavirus CoV-Hel-DEL-F (5′)ATCAACAAYTACATTTGTAGTGTTGA 13772–13797c 54 1436–1451 This study
CoV-Hel-DEL-R (5′)GMTGCTTTNRCATTCATAGCATT 15185–15207c
Coronaviridae (nested PCR assay) CoV-Hel-Pan-F (5′)TTYGCDGCWGARACNVTHARRGC 15535–15557b 50 461–475 This study
CoV-Hel-Pan-R (5′)TTRCCDSTRCCDGGDGGDCC 15982–16001b
Primers for detection and molecular characterization of astroviruses
Astroviridae AstroV-UNI-F (5′)TTGAYTGGACNMGHTWTGATGGYAC 4141–4165d Pol gene (RdRp locus) 50 417–447 (Todd et al., 2009), modified
AstroV-UNI-R (5′)CWGGYTTVACCCACATNCCAAA 4563–4584d

∗ Primer positions refer to the sequences of:aNewcastle disease virus (APMV-1) strain JS10, (GenBank: HQ008337);bGammacoronavirus strain IBV M41 (GenBank: DQ834384);cWigeon coronavirus HKU20 strain HKU20-9243 (GenBank: JQ065048);dDuck astrovirus strain SL2 (GenBank: KF753805).

For CoV detection, the initial RT-PCR run was performed with the outer primers ‘pan-CoV-outF’ and ‘pan-CoV-outR’ (Xiu et al., 2020), which target the RNA-dependent RNA polymerase (RdRp) region of the ORF1a,b gene (Table 3). For the second PCR reaction we used two pairs of inner primers ‘CoV-RdRp-F2’/‘CoV-RdRp-R2’ and ‘CoV-RdRp-F3’/‘CoV-RdRp-R3’ (Chu et al., 2011) (Table 3). In addition, for CoV detection and further PCR-typing of CoV-positive samples, two nested PCR assays were conducted. Two pairs of outer primers ‘CoV-Hel-GAM-F’ and ‘CoV-Hel-GAM-R’, which target the helicase (Hel) locus of the gamma-CoVs Orf1a,b gene, as well as ‘CoV-Hel-DEL-F’ and ‘CoV-Hel-DEL-R’, which target the Hel locus of the delta-CoVs Orf1a,b gene, were used. For both nested PCR assays, the inner primers ‘CoV-Hel-Pan-F’ and ‘CoV-Hel-Pan-R’ were used yielding an amplification product of 461–475 bp.

For APMV detection, a seminested PCR assay was performed using pan-PMV primers (Table 3) targeting a conserved fragment of the L-gene encoding RdRp (Tong et al., 2008). Because the pan-PMV primers do not detect all APMV species, we used additional degenerate primers ‘PAR-Avu-F4’ and ‘PAR-Avu-R4’ (Table 3), which amplify a 670–674 bp fragment of the L-gene of avulaviruses and rubulaviruses.

Universal degenerate primers (Table 3) targeting a conserved RdRp region of the ORF1b gene were utilized to detect the presence of AstroVs (Todd et al., 2009).

Hot-Taq DNA polymerase (SibEnzyme) was used for virus detection. Amplification for sequencing was performed using High-Fidelity Taq Polymerase (Thermo Fisher scientific) according to the manufacturer’s instructions. The conditions for PCR amplification were as follows: 94 °C for 10 min, 94 °C for 40 s, 50–54 °C (Ta values for each primer pair are indicated in Table 3) for 30 s, 72 °C for 1 min, followed by 5 min at 72 °C; 40 cycles were performed. PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized under UV light.

2.5. Sequencing and phylogenetic analysis

Elution of DNA fragments from agarose gels was performed using a QIAquick gel extraction kit (Qiagen). The purified DNA fragments were then sequenced in both directions using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and ABI 3500XL genetic analyzer (Applied Biosystems). Sequences were aligned using the MUSCLE algorithm. An unrooted phylogenetic tree was generated with the Maximum Likelihood Algorithm using the MEGA X software. The bootstrap method with 1000 replicates was used to evaluate the reliability of the tree topologies.

2.6. Statistical analysis

Statistical analysis was performed using EpiInfo v. 7.2.2.2 software (CDC). The exact Clopper-Pearson method based on the beta distribution was used to calculate the 95% confidence interval (CI). Pearson’s chi-square test was used to determine a statistically significant difference between groups. Differences were considered statistically significant at p < 0.05.

3. Results

All collected samples were examined for viruses belonging to three families, Paramyxoviridae, Coronaviridae and Astroviridae using RT–PCR assays.

3.1. Detection and genetic characterization of CoVs

Using the nested PCR targeting the RdRp locus we identified eight positive samples for CoVs (3.3%; 95% CI: 1.4–6.4%). The nested PCR targeting the Hel locus detected 7/242 or 2.9% (95% CI: 1.2–5.9%) of samples positive for CoVs. By combining the results of both PCR assays, 10/242 or 4.1% (95% CI: 2.0–7.5%) of all samples tested positive for CoVs in at least one PCR assay.

Ten CoV strains were found in eight avian species from five orders (Table 2). The detection rates of CoVs were 27% for Pelecaniformes (3/11; 95% CI = 6.0–61.0%), 20% for Anseriformes (1/5; 95% CI = 0.1–71.6%), 14% for Columbiformes (2/14; 95% CI = 1.8–42.8%), 6% for Charadriiformes (3/49; 95% CI = 1.3–16.9%), and 0.9% for Passeriformes (1/107; 95% CI = 0.01–5.1%). All detected CoVs were found to be gamma-CoVs. Delta-CoVs were not detected. RNA samples positive for CoV were found at four of the six locations tested including Chokpak-2020, Mynkol, Alakol and Tentek. The prevalence of CoVs was higher in aquatic birds (10%; 7/67; 95% CI = 4.3–20.4%) as compared to terrestrial birds (1.7%; 3/175; 95% CI = 0.4–4.9%; χ2 = 7.25; p = 0.0071).

Blast analysis of the sequences of the amplified CoV Orf1b Hel locus fragments confirmed that the detected CoVs belonged to the genus Gammacoronavirus (data not shown). Unfortunately, three of the ten CoV sequences obtained were of insufficient quality for further phylogenetic analysis. The phylogenetic tree for seven strains analyzed is shown in Figure 2. One of the strains (GenBank: OL912941) was closely related to avian infectious bronchitis virus strains. Six strains clustered into a distinct clade and shared 89–92% nucleotide sequence similarity with the pigeon-dominant CoV. Nine of ten CoV-positive samples were found in migratory avian species.

Figure 2.

Figure 2

Phylogenetic tree of avian CoVs based on partial sequences (461–475 bp) of the Hel locus of the Orf1a,b gene. Sites of CoV sample collection are indicated as follows: Chokpak-2020 – square (■), Mynkol – triangle (▲), Tentek – rhombus (♦), Alakol – cycle (●). The scale bar corresponds to 0.1 substitutions per nucleotide position. GenBank accession numbers are indicated in parentheses. The hosts of CoV strains identified in this study are indicated in square brackets.

Phylogenetic analysis revealed no pronounced clustering of strains based on geographic location or host species. Two gamma-CoV strains (GenBank: OL912941 and OL912942) that shared only 80% nucleotide identity were detected in pigeons captured at Chokpak-2020. At the same time, six genetically close gamma-CoV strains (GenBank: OL912936 to OL912940 and OL912942) with more than 95% nucleotide identity were identified in both aquatic (pelicans, gulls, sandpipers) and terrestrial (pigeons) bird species that are evolutionarily distinct.

3.2. Detection and genetic characterization of APMVs

Only two samples were positive for APMV RNA (0.8%; 95% CI = 0.1–3.0%) as detected by both PCR assays. Positive samples were collected from pigeons at the Chokpak-2020 location. The overall prevalence of APMVs in Columbiformes was shown to be 14% (2/14; 95% CI = 1.8–42.8%).

The partial L-gene sequences of the obtained APMV strains had a nucleotide identity of 75.6% with APMV-21 (GenBank: MK677430) and 72.5% with APMV-7 (GenBank: FJ231524) (Figure 3). Although the partial L-gene sequences of these two strains were almost identical, they were collected from pigeons of two different species (C. palumbus and C. oenas).

Figure 3.

Figure 3

Phylogenetic tree of APMV species based on RdRp-gene partial sequences (649–686 bp). Squares (■) indicate the APMV strains obtained in this study (Chokpak-2020 location). The scale bar corresponds to 0.2 substitutions per nucleotide position. GenBank accession numbers are indicated in parentheses. The hosts of APMV strains identified in this study are indicated in square brackets.

3.3. Detection and genetic characterization of AstroVs

Screening for AstroVs demonstrated an overall prevalence of 2.9% (7/242; 95% CI = 1.2–5.9%). Seven AstroV strains were detected in six species (Table 2). These viruses were more frequently detected in the order Coraciiformes (8%; 1/13; 95% CI = 0.2–36.0%), followed by the orders Columbiformes (7%; 1/14; 95% CI = 0.2–33.9%), Passeriformes (3.7%; 4/107; 95% CI = 1.0–9.3%), and Charadriiformes (2%; 1/49; 95% CI = 0.1–10.9%). Most of the AstroV-positive birds belonged to the family Corvidae of the order Passeriformes (Table 2). One AstroV-positive sample was collected at the Maykamys location, while six AstroV-positive samples were collected at the Chokpak-2020 location. We found no difference in the AstroV prevalence between terrestrial (3.4%, 6/175; 95% CI = 1.3–7.3%) and aquatic birds (2%, 1/67; 95% CI = 0.01–8.0%; χ2 = 0.14; p = 0.7073). Six of seven AstroV-positive samples were found in migratory avian species.

Phylogenetic analysis showed that all seven AstroV strains belonged to the genus Avastrovirus (Figure 4). The analysis revealed genetic diversity among AstroV strains originating from the same geographical area (Chokpak Pass) and clustering based on host species (families Corvidae, Columbidae, Laridae and Meropidae) (Figure 4, Table 2).

Figure 4.

Figure 4

Phylogenetic tree of AstroVs based on RdRp-gene partial sequences (417–447 bp). Sites of AstroV sample collection are indicated as follows: Chokpak-2020 – square (■), Maykamys – asterisk (∗). The scale bar corresponds to 0.1 substitutions per nucleotide position. GenBank accession numbers are indicated in parentheses. The hosts of AstroV strains identified in this study are indicated in square brackets.

4. Discussion

The current study is the first to describe the presence of CoVs and AstroVs in wild migratory and resident birds in southeastern Kazakhstan. The study also describes the prevalence of APMVs circulating in wild birds in this region, Across 51 avian species tested, APMVs were found in only two pigeon species captured at migratory bird resting and feeding areas representing an overall APMV prevalence of 0.8%. The obtained data are consistent with a previous study analyzing samples collected in Kazakhstan between 2002 and 2013, which showed that the prevalence of APMVs in wild birds ranged between 0.15% and 2.73% (Karamendin et al., 2016). These data suggest that APMVs spread in the studied bird species with relatively low efficiency.

Gamma-CoVs were detected in wild birds more frequently with an overall prevalence of 4.1%. Despite the use of a screening method capable of detecting both gamma- and delta-CoVs (Chu et al., 2011), we were unable to detect the latter in our study. Consistent with a number of previously reported studies, the frequency of gamma-CoVs was significantly higher in waterfowl as compared to terrestrial birds, indicating their role as important natural reservoirs or intermediate hosts of gamma-CoVs in the region (Chamings et al., 2018; Chu et al., 2011; Miłek and Blicharz-Domańska, 2018; Paim et al., 2019; Wille et al., 2015). Gamma-CoVs were more frequently detected in Pelecaniformes followed by Anseriformes.

The prevalence of AstroVs was 2.9%, which can be considered relatively low. AstroVs were detected in apparently healthy birds representing six different avian species. The data confirm a relatively broad avian host range of AstroVs described previously (Pantin-Jackwood et al., 2012; Fernández-Correa et al., 2019; Chu et al., 2012). Interesting enough, there was a notable difference in the proportion of AstroV-positive samples among the studied areas. Six of seven PCR-positive samples were detected at Chokpak-2020. Although the obtained results can be explained by a considerably lower number of birds sampled at other locations in 2020 as compared to the Chokpak location, they may also indicate a higher importance of some flyways for the AstroV transmission.

We observed seasonal fluctuations in the prevalence of CoVs, AstroVs and APMVs in wild birds sampled at the same location (Chokpak Pass). All 83 samples collected in the spring season at Chokpak Pass (Chokpak-2021 location) were negative for all viruses examined, whereas we found CoV-, AstroV- and APMV-positive samples among the 90 samples collected in the fall season at the same location (Chokpak-2020 location). Similar seasonality is frequently described for avian influenza A virus (Wille et al., 2015; Xu et al., 2016). The observed fluctuations could be related to a number of factors, including ambient temperature and humidity, which may affect the period of virus survival in bird secretions and aerosols, as well as the direction of migration. Infected birds are less likely to successfully complete the long flights over the ridges of Pamir and Tien Shan during spring migration from wintering to breeding grounds. Infected birds are also more likely to die during wintering due to a general weakening of the body. Alternatively, the difference could be explained by a different composition of avian species sampled in the spring and fall seasons. In particular, there were no representatives of the order Columbiformes in the spring collection, which showed a relatively high virus prevalence in the fall collection.

Although the number of samples for phylogenetic analysis was limited, we identified three different AstroV clades, two CoV clades, and one APMV clade. We showed that at least one strain of gamma-CoV is quite widespread in southeastern Kazakhstan. It was detected in several bird species (pelicans, gulls, waders, pigeons) in both Almaty and Zhambyl oblasts of Kazakhstan suggesting that it is capable of wide transmission between different bird species. This CoV clade is closely related to the pigeon-dominant CoV, which is common in neighboring China (Zhuang et al., 2020).

We then showed that the two APMV strains detected in pigeons shared over 70% nucleotide identity with APMV-21 and APMV-7. The distribution of APMV-1 (Karamendin et al., 2016), APMV-2 (Saiatov et al., 1992), APMV-4, APMV-6, APMV-8 (Bogoyavlenskiy et al., 2009) APMV-15 (Karamendin et al., 2017) and APMV-20 (Karamendin et al., 2017) in Kazakhstan have been previously described. Neither APMV-7 nor APMV-22 strains have yet been identified in Kazakhstan. APMV-7 is mainly found in North America (Xiao et al., 2012) and it is highly unlikely to enter Kazakhstan with migratory birds. APMV-21 has been detected in Taiwan (Liu et al., 2019). APMV-22 strains may have entered Kazakhstan with migratory waders travelling along the East Asian/Australasian flyway. It is also possible that the APMV strains identified in this study belong to a new, as yet uncharacterized species.

Four of the seven detected AstroV strains (GenBank: OM047211 to OM047214) clustered into a clade that may be a new species of the genus Astrovirus. All four samples were collected from birds belonging to the order Passeriformes. These genetically related strains originated from different geographical regions, the south of Zhambyl oblast and the Alakol-Balkhash region of Almaty oblast. The absence of serious geographical obstacles may facilitate virus transmission between these two regions of Kazakhstan. One AstroV strain (GenBank: OM047210) was obtained from Merops apiaster and showed the highest identity to Astroviridae sp. (GenBank: MT138001). The results of the phylogenetic analysis also support the possibility that the other two AstroV strains collected from Hydroprogne caspia (GenBank: OM047208) and Columba livia (GenBank: OM047209) are distinct species, as the evolutionary distance between these strains is as much as 35%.

This study has several limitations. The main limitation is the small number of samples. For future work, samples should be collected throughout the year to evaluate seasonality. Another limitation is that the phylogenetic analysis was performed with very short genome fragments. Complete genome sequencing is needed to verify whether the identified divergent AMPV and AstroV strains belong to new species.

5. Conclusion

This is the first study describing the prevalence and genetic diversity of avian CoVs and AstroVs in southeastern Kazakhstan. Phylogenetic analysis of partial viral genome sequences revealed three major AstroV clades and two CoV clades. In addition, we described APMVs that had not previously been detected in Kazakhstan. Further studies are needed to describe the full picture of the ecology of CoVs, AstroVs and APMVs in Kazakhstan.

Declarations

Author contribution statement

Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Andrey V. Zhigailov: Performed the experiments; Analyzed and interpreted the data; Wrote the paper.

Elina R. Maltseva: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data.

Yuliya V. Perfilyeva and Yekaterina O. Ostapchuk: Analyzed and interpreted the data; Wrote the paper.

Andrey E. Gavrilov and Seidigapbar M. Mamadaliyev: Conceived and designed the experiments.

Yuriy A. Skiba: Analyzed and interpreted the data.

Zhanna A. Berdygulova, Akzhigit Mashzhan and Almat Zh. Abayev: Performed the experiments.

Dinara A. Naizabayeva, Saltanat A. Kuatbekova, Anna S. Nizkorodova and Ilyas A. Akhmetollayev: Contributed reagents, materials, analysis tools or data.

Funding statement

Andrey E. Gavrilov, Seidigapbar M. Mamadaliyev and Yuriy A. Skiba were supported by Ministry of Education and Science of the Republic of Kazakhstan [АР08855831, AP09259102 & AP09259103].

Data availability statement

Data associated with this study has been deposited at GenBank under the accession number OL912934 to OL912942 (CoVs), OM047208 to OM047214 (AstroVs), OL912934 and OL912935 (APMVs).

Declaration of interest’s statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.

Acknowledgements

Authors are grateful to everyone who submitted viral sequence data to public databases for making phylogenetic analyses possible.

References

  1. BirdLife International The flyways concept can help coordinate global efforts to conserve migratory birds. 2022. http://datazone.birdlife.org/sowb/casestudy/the-flyways-concept-can-help-coordinate-global-efforts-to-conserve-migratory-birds (Accessed January 26, 2022)
  2. Bogoyavlenskiy A., Berezin V., Prilipov A., Usachev E., Lyapina O., Korotetskiy I., Zaitceva I., Asanova S., Kydyrmanov A., Daulbaeva K., Shakhvorostova L., Sayatov M., King D. Newcastle disease outbreaks in Kazakhstan and Kyrgyzstan in 1998, 2000, 2001, 2003, 2004, and 2005 were caused by viruses of the genotypes VIIb and VIId. Virus Gene. 2009;39(1):94–101. doi: 10.1007/s11262-009-0370-1. [DOI] [PubMed] [Google Scholar]
  3. Chamings A., Nelson T.M., Vibin J., Wille M., Klaassen M., Alexandersen S. Detection and characterisation of coronaviruses in migratory and non-migratory Australian wild birds. Sci. Rep. 2018;8(1):5980. doi: 10.1038/s41598-018-24407-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chu D.K., Leung C.Y., Gilbert M., Joyner P.H., Ng E.M., Tse T.M., Guan Y., Peiris J.S., Poon L.L. Avian coronavirus in wild aquatic birds. J. Virol. 2011;85(23):12815–12820. doi: 10.1128/JVI.05838-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chu D.K., Leung C.Y., Perera H.K., Ng E.M., Gilbert M., Joyner P.H., Grioni A., Ades G., Guan Y., Peiris J.S., Poon L.L. A novel group of avian astroviruses in wild aquatic birds. J. Virol. 2012;86(24):13772–13778. doi: 10.1128/JVI.02105-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cortez V., Meliopoulos V.A., Karlsson E.A., Hargest V., Johnson C., Schultz-Cherry S. Astrovirus biology and pathogenesis. Annu Rev. Virol. 2017;4(1):327–348. doi: 10.1146/annurev-virology-101416-041742. [DOI] [PubMed] [Google Scholar]
  7. Fernández-Correa I., Truchado D.A., Gomez-Lucia E., Doménech A., Pérez-Tris J., Schmidt-Chanasit J., Cadar D., Benítez L. A novel group of avian astroviruses from Neotropical passerine birds broaden the diversity and host range of Astroviridae. Sci. Rep. 2019;9:9513. doi: 10.1038/s41598-019-45889-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gavrin V.Ph., Dolgushin I.A., Korelov M.N., Kuzmina M.A. vol. 2. Academy of Sciences of the Kazakh SSR. Almaty; 1962. pp. 40–246. (Birds of Kazakhstan). (in Russian) [Google Scholar]
  9. Karamendin K., Kydyrmanov A., Seidalina A., Asanova S.E., Daulbayeva K.D., Kasymbekov Y., Khan E.Y., Fereidouni S., Starick E., Zhumatov K.Kh., Sayatov M. Kh. Circulation of avian paramyxoviruses in wild birds of Kazakhstan in 2002–2013. Virol. J. 2016;13:23. doi: 10.1186/s12985-016-0476-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Karamendin K., Kydyrmanov A., Kasymbekov Y., Asanova S., Daulbayeva K., Seidalina A., Khan E., Harrison S.M., Carr I.M., Goodman S.J., Moldakozhayev A., Sayatov M. Novel avian paramyxovirus isolated from gulls in Caspian seashore, Kazakhstan. PLoS One. 2017;12 doi: 10.1371/journal.pone.0190339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lau S., Wong E., Tsang C.C., Ahmed S.S., Au-Yeung R., Yuen K.Y., Wernery U., Woo P. Discovery and sequence analysis of four deltacoronaviruses from birds in the Middle East reveal interspecies jumping with recombination as a potential mechanism for avian-to-avian and avian-to-mammalian transmission. J. Virol. 2018;92 doi: 10.1128/JVI.00265-18. e00265-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lewis N.S., Banyard A.C., Whittard E., Karibayev T., Kafagi T.A., Chvala I., Byrne A., Saduakassova M., King J., Harder T., Grund Ch., Essen S., Reid S.M., Brouwer A., Zinyakov N.G., Tegzhanov A., Irza V., Pohlmann A., Beer M., Fouchier R.A.M., Sultanov A., Brown I.H. Emergence and spread of novel H5N8, H5N5 and H5N1 clade 2.3.4.4 highly pathogenic avian influenza in 2020. Emerg. Microb. Infect. 2021;10:148–151. doi: 10.1080/22221751.2021.1872355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Liu Y.P., Kuo S.T., Chiou C.J., Terregino C., Tsai H.J. Novel avian metaavulavirus isolated from birds of the family Columbidae in Taiwan. Vet. Microbiol. 2019;236 doi: 10.1016/j.vetmic.2019.07.029. [DOI] [PubMed] [Google Scholar]
  14. Łukaszuk E., Stenzel T. Occurrence and Role of selected RNA-viruses as potential causative agents of watery droppings in pigeons. Pathogens. 2020;9:1025. doi: 10.3390/pathogens9121025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Miłek J., Blicharz-Domańska K. Coronaviruses in avian species - review with focus on epidemiology and diagnosis in wild birds. J. Virol Res. 2018;62(3):249–255. doi: 10.2478/jvetres-2018-0035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Paim F.C., Bowman A.S., Miller L., Feehan B.J., Marthaler D., Saif L.J., Vlasova A.N. Epidemiology of deltacoronaviruses (δ-CoV) and gammacoronaviruses (γ-CoV) in wild birds in the United States. Viruses. 2019;11(10):897. doi: 10.3390/v11100897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pantin-Jackwood M., Todd D., Koci M.D. Avian Astroviruses. Astrovirus Res. 2012;2012:151–180. [Google Scholar]
  18. Rao P.L., Gandham R.K., Subbiah M. Molecular evolution and genetic variations of V and W proteins derived by RNA editing in Avian Paramyxoviruses. Sci. Rep. 2020;10:9532. doi: 10.1038/s41598-020-66252-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Rima B., Balkema-Buschmann A., Dundon W.G., Duprex P., Easton A., Fouchier R., Kurath G., Lamb R., Lee B., Rota P., Wang L., ICTV Report Consortium ICTV virus Taxonomy profile: Paramyxoviridae. J. Gen. Virol. 2019;100:1593–1594. doi: 10.1099/jgv.0.001328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Saiatov M.K., Ter-Pogosian V.E., Daulbaev K.D., Dmitriev G.A., Iamnikova S.S., Zhumatov K.K. Yucaipa-like viruses isolated in Kazakhstan in 1987–1989. Vopr. Virusol. 1992;37(2):116–118. PMID: 1441429 (in Russian) [PubMed] [Google Scholar]
  21. Todd D., Smyth V.J., Ball N.W., Donnelly B.M., Wylie M., Knowles N.J., Adair B.M. Identification of chicken enterovirus-like viruses, duck hepatitis virus type 2 and duck hepatitis virus type 3 as astroviruses. Avian Pathol. 2009;38:21–29. doi: 10.1080/03079450802632056. [DOI] [PubMed] [Google Scholar]
  22. Tong S., Shur-Wern W.C., Li Y., Pallansch M., Anderson L.J. Sensitive and broadly reactive reverse transcription-PCR assays to detect novel paramyxoviruses. J. Clin. Microbiol. 2008;46(8):2652–2658. doi: 10.1128/JCM.00192-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Wille M., Avril A., Tolf C., Schager A., Larsson S., Borg O., Olsen B. Temporal dynamics, diversity, and interplay in three components of the viriodiversity of a Mallard population: influenza A virus, avian paramyxovirus and avian coronavirus. Infect. Genet. Evol. 2015;29:129–137. doi: 10.1016/j.meegid.2014.11.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Woo P.C., Lau S.K., Lam C.S., Lau C.C., Tsang A.K., Lau J.H., Bai R., Teng J.L., Tsang C.C., Wang M., Zheng B.J., Chan K.H., Yuen K.Y. Discovery of seven novel mammalian and avian coronaviruses in the genus Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. J. Virol. 2012;86:3995–4008. doi: 10.1128/JVI.06540-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Xiao S., Khattar S.K., Subbiah M., Collins P.L., Samal S.K. Mutation of the f-protein cleavage site of avian paramyxovirus type 7 results in furin cleavage, fusion promotion, and increased replication in vitro but not increased replication, tissue tropism, or virulence in chickens. J. Virol. 2012;86(7):3828–3838. doi: 10.1128/JVI.06765-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Xiu L., Binder R.A., Alarja N.A., Kochek K., Coleman K.K., Than S.T., Bailey E.S., Bui V.N., Toh T.H., Erdman D.D., Gray G.C. A RT-PCR assay for the detection of coronaviruses from four genera. J. Clin. Virol. 2020;128 doi: 10.1016/j.jcv.2020.104391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Xu Y., Gong P., Wielstra B., Si Y. Southward autumn migration of waterfowl facilitates cross-continental transmission of the highly pathogenic avian influenza H5N1 virus. Sci. Rep. 2016;6 doi: 10.1038/srep30262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Zhuang Q., Liu S., Zhang X., Jiang W., Wang K., Wang S., Peng C., Hou G., Li J., Yu X., Yuan L., Wang J., Li Y., Liu H., Chen J. Surveillance and taxonomic analysis of the coronavirus dominant in pigeons in China. Transbound Emerg, Dis. 2020;2020 doi: 10.1111/tbed.13541. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data associated with this study has been deposited at GenBank under the accession number OL912934 to OL912942 (CoVs), OM047208 to OM047214 (AstroVs), OL912934 and OL912935 (APMVs).


Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES