Skip to main content
NCBI home page
Acta Pharmaceutica Sinica. B logoLink to Acta Pharmaceutica Sinica. B
. 2022 Jul 2;12(11):4224–4234. doi: 10.1016/j.apsb.2022.06.016

Tumor-microenvironment activated duplex genome-editing nanoprodrug for sensitized near-infrared titania phototherapy

Zekun Li a,†, Yongchun Pan b,†, Shiyu Du a, Yayao Li a, Chao Chen a, Hongxiu Song a, Yueyao Wu a, Xiaowei Luan b, Qin Xu b, Xiaoxiang Guan c,∗, Yujun Song b,∗, Xin Han a,∗
PMCID: PMC9643290  PMID: 36386466

Abstract

Near-infrared (NIR)-light-triggered nanomedicine, including photodynamic therapy (PDT) and photothermal therapy (PTT), is growing an attractive approach for cancer therapy due to its high spatiotemporal controllability and minimal invasion, but the tumor eradication is limited by the intrinsic anti-stress response of tumor cells. Herein, we fabricate a tumor-microenvironment responsive CRISPR nanoplatform based on oxygen-deficient titania (TiO2-x) for mild NIR-phototherapy. In tumor microenvironment, the overexpressed hyaluronidase (HAase) and glutathione (GSH) can readily destroy hyaluronic acid (HA) and disulfide bond and releases the Cas9/sgRNA from TiO2-x to target the stress alleviating regulators, i.e., nuclear factor E2-related factor 2 (NRF2) and heat shock protein 90α (HSP90α), thereby reducing the stress tolerance of tumor cells. Under subsequent NIR light illumination, the TiO2-x demonstrates a higher anticancer effect both in vitro and in vivo. This strategy not only provides a promising modality to kills cancer cells in a minimal side-effects manner by interrupting anti-stress pathways but also proposes a general approach to achieve controllable gene editing in tumor region without unwanted genetic mutation in normal environments.

Key words: Near-infrared phototherapy, Gene editing, Nuclear factor E2-related factor 2, Heat shock protein 90α, TiO2-x, Sensitized phototherapy, Nanoprodrug, Tumor microenvironment

Graphical abstract

A hyaluronidase and glutathione responsive platform was achieved for targeted delivery of CRISPR-Cas9 system to tumors. Both HSP90α and NRF2 were targeted to sensitize the photothermal and photodynamic therapy.

Image 1

Open in a new tab

1. Introduction

Near-infrared (NIR) photo-triggered cancer treatments (phototherapy), typically including photodynamic therapy (PDT) and photothermal therapy (PTT), have attracted extensive interest due to their remarkable effect on synergistic cancer therapy1, 2, 3, 4, 5. Compared with conventional strategies, for example, chemotherapy, near-infrared light-activated therapy demonstrates reduced side effects, minimally invasive nature, and higher spatiotemporal selectivity for precisely controlled promising oncotherapy6, 7, 8. However, phototherapy would trigger a stress response in living cells, which serves as a survival mechanism to relieve the induced oxidative/heat stress and damage for improving survival of cancer cells in harsh microenvironment. Such survival pathways are generally mediated by several proteins including nuclear factor E2-related factor 2 (NRF2), heat-shock protein 90 (HSP90), and hypoxia-inducible factor 1 (HIF-1)9, 10, 11, 12, 13, 14. Therefore, inhibition of such proteins offers a potential approach to achieve available therapy with low dosage in clinical application. Recently, molecularly targeted inhibitors of NRF2 or HSP90 have been developed to improve NIR light-activated nanomedicine by reducing the stress tolerance of cancer cells15, 16, 17. Nevertheless, most inhibitors suffer from drug resistance and repeated administration, which increases the risk of recurrence and treatment-related toxicity and severely influences the patient quality of life18. To reduce toxicity and adverse reactions, substantially effective therapeutic modalities are urgently needed.

As an emerging innovation, CRISPR-Cas9 mediated gene therapy is a promising approach to treat diseases by permanently altering gene of oncogenic or antioncogenic expression, which could overcome the repeated dosing limitations of traditional cancer therapies19,20. Unfortunately, efficient and accurate delivery of CRISPR remains a challenge, which severely influences gene-editing efficiency21. Currently, delivery strategies of CRISPR-Cas9 have been composed of two broad categories: viral and nonviral vectors. Since carcinogenesis, insertional mutagenesis, and immunogenicity of viral vectors limits its clinical application, nonviral vectors are growing an alternative strategy22, 23, 24, 25, 26, 27, 28. Several nanomaterials-based platforms have been developed to encapsulate Cas9/single-guide RNA (sgRNA) complexes into nanoparticles for delivery of CRISPR, including polymeric nanoparticles, metal–organic frameworks (MOFs), cationic liposomes, gold nanoparticles, and other nanomaterials29, 30, 31, 32, 33, 34, 35, 36, 37. Nevertheless, these vectors still face limitations including moderate transfection efficiencies or low targeting effect, which greatly prompts the need for improved CRISPR delivery systems38.

In this study, we designed a hyaluronidase (HAase) and glutathione (GSH) responsive platform for targeted delivery of CRISPR-Cas9 system to realize the double reinforced phototherapy (PTT and PDT). As shown in Fig. 1, the Cas9/single-guide RNA (sgRNA) complexes were covalently crosslinked on reduced TiO2-x nanoparticles by a GSH-responsive disulfide bond linker. For enhancing cellular uptake, hyaluronic acid (HA) was functionalized onto the resulting nanoparticle to form TiO2-x@Cas9-NH@HA. Once the nanoparticles got into tumor cells, the HA on the surface was degraded by HAase39, 40, 41, 42, and then the exposed disulfide bonds could be cut off by the overexpressed intracellular GSH, which thereby released Cas9 RNPs from TiO2-x NPs to knockout out anti-stress related proteins (HSP90α and NRF2), leading to the reduced tolerance of tumor cells to photothermal and reactive oxygen species (ROS). Therefore, local heat and oxidative stress subsequently generated by TiO2-x NPs under mild 808 nm laser irradiation can obtain desirable antitumor efficacy. This work provided a new method to improve the combination therapeutic effects of PTT and PDT against cancer, which had the great promising potential for further application in the field of synergetic therapy based on CRISPR-Cas9 gene editing system enhanced PTT/PDT.

Figure 1.

Figure 1

Open in a new tab

Schematic illustration of (A) the preparation of the TiO2-x@Cas9-NH@HA, and (B) its applications for the enhanced cancer PTT/PDT, and (C) elimination of therapeutic resistance. APTES, 3-aminopropyl) triethoxysilane. HA, hyaluronic acid; DSP, 3,3′-dithiodipropionic acid-di (N-succinimidyl ester); PTT, photothermal therapy; PDT, photodynamic therapy; HAase, hyaluronidase; GSH, glutathione; ROS, reactive oxygen species.

2. Materials and methods

2.1. Materials

Titanium butoxide (TBOT) was purchased from Macklin Biochemical Co., Ltd. (Shanghai, China). The acetone and ethanol were acquired from Sinopharm Group Chemical Reagent Co., Ltd. (Shanghai, China). Acetic acid, ethylene glycol, sodium borohydride (NaBH4), 3-aminopropyl triethoxysilane (APTES) were obtained from Aladdin Co., Ltd. (Shanghai, China). The 1,3-diphenylbenzofuran (DPBF) was purchased from Solarbio (Beijing, China). The sgRNA sequence, 3,3′-dithiodipropionic acid-di (N-succinimidyl ester) (DSP), and BCA protein assay kit were purchased from Sangon Biotech (Shanghai, China). HA was acquired from Shanghaiyuanye Bio-Technology Co., Ltd. (Shanghai, China). Calcein-AM and PI were obtained from Yeasen Biology (Shanghai, China). DMEM media were acquired from Gibco (New York, USA). Fetal bovine serum (FBS) was obtained from ExCell Bio (Shanghai, China). CCK-8 reagent, Hoechst, and dichlorodihydro fluorescein-acetoacetate (DCFH-DA) were acquired from Beyotime (Shanghai, China).

2.2. Characterization

The transmission electron microscope (TEM) images and high-resolution transmission electron microscopy (HRTEM) images of nanoparticles were detected by TEM (JEM-200CX; JEOL Ltd.). X-ray diffraction (XRD) patterns were obtained on XTRA from Thermal Scientific. X-ray photoelectron spectroscopy (XPS) was conducted on PHI5000 VersaProbe from ULVAC-PHI, Japan. Zeta potentials of all samples were conducted by electrophoretic light scattering (Brookhaven Instruments Corporation, Holtsville, NY, USA). The UV‒Vis‒NIR spectra were recorded using a UV3600 (SHIMADZU, Japan). FTIR spectrum was recorded by an FTIR spectrometer (NEXUS870; Nicolet). The UV–Vis spectra were carried out on a microplate photometer (Multiskan FC; Thermo Fisher Scientific Inc.). The electron paramagnetic resonance (EPR) spectra were detected with an EMXplus (Bruker, Germany).

2.3. Synthesis of TiO2 and TiO2-x

A mixture of 1 mL TBOT and 50 mL ethylene glycol was magnetically stirred for 8 h. Then, the resulting mixture was added to a mixture of 1 L acetone, 4 mL H2O, and 800 μL glacial acetic acid for a 2-h stirring. After that, the precipitates were rinsed several times with DI water and ethanol, and the precipitates were kept in an oven at 50 °C for overnight drying. The products were white TiO2 NPs.

200 mg TiO2 NPs powder and 200 mg NaBH4 were ground thoroughly in a mortar. The mixture was transferred into a tube furnace, and mild reduction progress was conducted at 350 °C (heating rate of 10 °C/min) for 90 min in a nitrogen atmosphere. Afterwards, the product was washed with the mixture of DI water and ethanol three times to remove unreacted NaBH4. At last, the desired TiO2-x NPs were synthesized successfully.

2.4. Construction of sgRNA

The sgRNA used in this research was prepared due to the sgRNA in vitro transcription kit (Inovogen). The necessary forward primer containing targeted genes was acquired from Sangon Biotech. The sgRNA sequences target sites were as follows: sgRNA (NRF2), 5′-TGGAGGCAAGATATAGATCT-3′; sgRNA (HSP90α), 5′-ATTCCCTGTCACTGCGTCAC-3′; scrambled sgRNA, 5’-GCACTACCAGAGCTAACTCA-3’.

2.5. Synthesis of TiO2-x@Cas9-NH@HA

TiO2-x NPs (10 mg) were mixed with APTES (200 μL) and stirred for 24 h. Then, the product was washed three times with DI water/ethanol mixture. After that, TiO2-x@APTES NPs were dispersed in an aqueous medium and were added dropwise to DSP solution (5 mmol/L) dissolved in DMSO. The mixture was stirred magnetically for 2 h and was washed with DI water. TiO2-x@DSP NPs were dispersed in 20 mmol/L HEPES Buffer and ready for use. The complexed sgRNA (1 μg sgRNA (NRF2) and 1 μg sgRNA (HSP90α) in 10 μL) was added to the Cas9 protein (8 μg in 10 μL) in 80 μL of nuclease-free Cas9 buffer (20 mmol/L HEPES, 150 mmol/L KCl, 10% glycerol, pH 7.5). The mixture was allowed to react for 10 min at room temperature. Cas9/sgRNA complex was added to the TiO2-x@DSP NPs solution for a 2h reaction, generating TiO2-x@ Cas9-NH NPs (100 μg/mL). Finally, 100 μg of HA was added to the TiO2-x@Cas9-NH solution, followed by stirring for half an hour. The TiO2-x@Cas9-NH@HA products were obtained by centrifugation.

2.6. Photothermal property

An infrared thermal image recorder (Testo 869) was employed to characterize the photothermal performance of TiO2-x by recording the temperature changes during 808 nm laser irradiation. TiO2-x aqueous solution at different concentrations (0, 25, 50, 100, and 200 μg/μL) were exposed to 808 pump laser irradiation at laser power densities of 1.5 W/cm2. Furthermore, the temperature elevation of TiO2-x dispersed in DI water at a concentration of 200 μg/μL as irradiated by an 808 nm laser at various power intensities (0.5, 0.75, 1.0, 1.25, and 1.5 W/cm2) was characterized. Photothermal stability of TiO2-x NPs was evaluated by periodic laser irradiation for four cycles (laser on for 10 min and off for 10 min).

2.7. Extracellular ROS detection

1,3-Diphenylisobenzofuran (DPBF) as a ROS molecular probe was used to detect the generation of singlet oxygen (1O2). DPBF dissolved in ethanol (0.5 mg/mL) was added into a TiO2 or TiO2-x aqueous solution (1 mL, 100 μg/mL). Next, the mixture was treated by 808 nm laser irradiation (1.5 W/cm2) for 4 min under stirring in the dark. The changes in DPBF were evaluated by measuring the absorption intensity at 410 nm in UV–Vis absorption spectra.

2.8. Cell culture and biocompatibility assay

Human melanoma cell line A375 was obtained from American Type Culture Collection. The A375 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin in a humidified atmosphere of 95% air and 5% CO2 with the temperature of 37 °C. To evaluate the in vitro biocompatibility of TiO2-x or TiO2-x@Cas9-NH@HA NPs, a typical CCK-8 viability assay was conducted. Different concentrations of TiO2-x or TiO2-x@Cas9-NH@HA (0, 25, 50, 100, 200, and 400 μg/μL) were coincubated with A375 cells seeded in 96-well plates for 24 h, and then CCK-8 reagent (10 μL/100 μL DMEM) was added into the plates to characterize the absorption at a wavelength of 450 nm after 2 h on a microplate photometer.

2.9. Surveyor assay

After being treated with various formulations, the DNA genomes of A375 cells were isolated and harvested with FastPure® Cell/Tissue DNA Isolation Mini Kit (Vazyme). The 2 × Phanta Max Master Mix (Vazyme) was applied to amplify sgNRF2-targeted DNA and sgHSP90α-targeted DNA fragments from genomic DNA of the above-mentioned cells using the following primers: HSP90α GGGCTGTCCAAGTTCATC and CCCACAGCACTTTGTCATATA; NRF2 CCCACTTCCCACCATCAACA and TCTTGGGAAAGTTATGGCAGGT. PCR program [(95 °C) for 3 min, (95 °C for 30 s; 60 °C for 30 s, 72 °C for 30 s) for 35 cycles and (72 °C for 5 min)] was used. Then, we purified the amplified product and used the T7 Endonuclease I Kit (Vazyme) to detect the frequency of indels. The digested DNA was analyzed using 2% agarose gel electrophoresis. Indel formation efficiencies were calculated by Image J.

2.10. Western bolt analysis

Whole-cell lysates were prepared from variously treated cells using RIPA buffer containing protease inhibitors. The whole cell lysates were collected and quantified by the BCA protein assay. The same quantity of protein lysates was separated by SDS-PAGE on 10% SDS acrylamide gels and transferred onto a PVDF membrane. The membranes were incubated with primary antibodies against NRF2 and HSP90α respectively (1:1000 diluted) overnight in a refrigerator at 4 °C. Then, the membranes were incubated with an HRP-conjugated secondary antibody for 1 h at room temperature. GAPDH (1:1000 dilution) was set as a loading control.

2.11. Intracellular ROS detection

A375 cells were plated into a 12-well plate at a density of 1 × 105 cells per well for 12 h and co-incubated with different formulations (100 μg/mL) at 37 °C for 6 h. After that, the cells were washed three times with PBS to remove noninternalized NPs. DCFH-DA (20 μmol/L) in DMEM was added to wells for a 30 min incubation in the dark. Then the A375 cells were irradiated with 808 nm light at the energy density of 1.5 W/cm2 for 5 min. The cells were then observed by a fluorescence microscope, and intracellular green fluorescence was examined and recorded.

2.12. In vitro cytotoxicity assays

(i) The A375 cells were preseeded in 96-well plates (8 × 103 per well) and treated in various formulations. After a-24 h incubation, the cells were treated with NIR (1.5 W/cm2, 5 min) or without NIR irradiation. Then cells were incubated in the incubator for another 24 h. We evaluated cell viability by the CCK-8 assay. (ii) The A375 cells were preseeded in 24-well plates (5 × 104 per well) and treated in various formulations. After a 24-h incubation, the cells were treated with NIR irradiation (1.5 W/cm2, 5 min) or without NIR irradiation. Then cells were incubated in the incubator for another 6 h. After that, the cells were washed three times with PBS and stained with Calcein-AM and PI. Then the cells were washed with PBS three times and observed under a fluorescence microscope. (iii) For apoptosis analysis by flow cytometry, A375 cells were seeded in 24-well plates for 24 h. The YF 488-annexin V and PI Apoptosis Kit were employed and the results were acquired by a flow cytometer.

2.13. Distribution of nanoparticles in vivo and antitumor assessment

All animal procedures were approved and compiled with the guidelines of the Institutional Animal Care and Ethics Committee of Nanjing University. A375 cells were injected subcutaneously into the flank region of male BALB/c nude mice (4–5 weeks old) which bought from GemPharmatech (Jiangsu, China). Then Cy7 covalently modified NPs were intravenously injected into the nude mice bearing A375 xenograft tumor. After anesthetized by isoflurane, images of the mice were captured with Near-infrared optical imaging technology at the time of 3, 6, 12, 24 and 48 h post injection, respectively. Meanwhile, the fluorescence intensity of major orangs (hearts, livers, spleens, lungs, and kidneys) and tumor issues ex vivo was observed with the imaging instrument at each time point. To evaluate the antitumor efficacy of TiO2-x@Cas9-NH@HA, A375 tumor xenograft bearing nude mice were randomly divided into seven groups (n = 4), which intravenous injection with PBS (with NIR), TiO2-x@Cas9-NH@HA (without NIR), TiO2-x (with NIR), TiO2-x@HA (with NIR), TiO2-x@Cas9-H@HA (with NIR), TiO2-x@Cas9-N@HA (with NIR), TiO2-x@Cas9-NH@HA (with NIR), respectively. After 24 h of injection, 808 nm laser irradiation (1.5 W/cm2 for 10 min) was exposed to tumor region. Tumor volume and weight of mice were recorded every other day. Tumor volume was calculated as Eq. (1):

Volume (mm3) = 0.5 × (Length × Width2) (1)

After the last treatment, the mice were euthanized and the tumors and major tissues were harvested. The resected tumors and major organs were fixed with 4% paraformaldehyde and prepared into tissue sections for hematoxylin and eosin (H&E) staining. The tumor slices were also for immunohistochemistry and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining with the manufacturer's instructions.

2.14. Statistical analysis

All results were expressed as mean ± standard deviation (SD). Analysis of variance (ANOVA) was used to analyze the data. The level of significance between two groups of the data was analyzed based on the Student's two-tailed t-test (∗P < 0.05; ∗∗P < 0.01; and ∗∗∗P < 0.001).

3. Results and discussion

The monodisperse white titania (TiO2) with the size of about 100 nm was synthesized via ethylene glycol-mediated control hydrolysis process of tetrabutyl titanate (TBOT) according to the previous report (Fig. 2A)43. After being reduced by NaBH4, the white titania can be converted into black titania (TiO2-x) with an anatase crystal phase (Fig. 2B and C). To endow GSH-stimulus responsibility, the TiO2-x was modified by (3-aminopropyl) triethoxysilane (APTES) to obtain amine groups (TiO2-x–NH2), and a disulfide bond containing linker [3,3-dithiodipropionic acid-di (N-succinimidyl ester), DSP] was employed to bridge the resulting TiO2-x-NH2 and Cas9 RNPs (TiO2-x@Cas9-NH). Finally, hyaluronic acid (HA) was functionalized onto TiO2-x@Cas9-NH for targeting tumor (Fig. 2D, and Supporting Information Fig. S1). Such titania exhibited a strong EPR signal at a g value of 2.003 (Fig. 2E), indicating the existence of oxygen vacancies. Besides, we examined the element-valence status before and after reduction by X-ray photoelectron spectroscopy (XPS). No significant signal was observed in the recorded spectra, and two intense peaks at ∼465 and ∼459 eV, assigned to Ti 2p1/2 and Ti 2p3/2 in both forms of titanium oxide (Fig. 2F‒H, Supporting Information Fig. S2). The zeta potential analysis confirmed the successful synthesis of products at each step (Fig. 2I). And the characteristic peak of polysaccharide at 1078 cm−1 in the Fourier transform infrared (FTIR) spectroscopy further suggested the coating of HA (Supporting Information Fig. S3).

Figure 2.

Figure 2

Open in a new tab

Design of TiO2-x@Cas9-NH@HA. TEM image of (A) TiO2, and (B) TiO2-x. (C) High-resolution TEM image of TiO2–x. 0.35 nm is the lattice fringe of the anatase [101] face. (D) TEM image of TiO2-x@Cas9-NH@HA. (E) EPR spectra of TiO2 and TiO2-x. (F) C, O, and Ti element contents of TiO2 and TiO2–x. (G) Core-level XPS spectrum of Ti in TiO2. Inset: photograph of TiO2 in the form of powder. (H) core-level XPS spectrum of Ti in TiO2-x. Inset: photograph of TiO2-x in the form of powder. (I) The zeta potentials of TiO2-x, TiO2-x-NH2, TiO2-x-DSP, TiO2-x@Cas9-NH, TiO2-x@Cas9-NH@HA.

Generally, strong absorption in the near infrared region is the key to therapeutic reagents for NIR-phototherapy. As shown in Fig. 3A and Supporting Information Fig. S4, TiO2-x@CasNH@HA NPs dispersed solution show strong absorption in the near infrared and visible regions. To clarify the high near infrared absorption, diffuse reflectance spectroscopy (DRS) was applied, and the results demonstrated that an enhanced absorbance in the Vis−NIR region was obtained in TiO2-x (Supporting Information Fig. S5). According to the calculation of Kubelka−Munk function44, the band gap values of TiO2 and TiO2-x were 3.40 and 1.80 eV, respectively (Supporting Information Figs. S6 and S7), which was a symbol of the red shift of absorbed light, and suggesting a higher photothermal conversion effect of TiO2-x. As anticipated, the solutions can readily be heated by TiO2-x exposed to 808 nm laser irradiation (Fig. 3B), while no obvious temperature change was obtained by TiO2 (Supporting Information Fig. S8). In addition, the temperature change was highly dependent on TiO2-x concentration and power density (Fig. 3C and D). To test the photothermal conversion efficiency, temperature change curve of TiO2-x solution was recorded under continuous irradiation. From Fig. 3E and F, the photothermal-conversion efficiency of TiO2-x was calculated to reach 40.1%. Moreover, the increase in temperature for the TiO2-x remained almost robust after 4 cycles (Fig. 3G), indicating a good stability of photothermal conversion.

Figure 3.

Figure 3

Open in a new tab

In vitro photothermal and photodynamic effects of TiO2-x. (A) UV‒Vis‒NIR absorption spectra of TiO2-x at different concentrations (B) photothermal images of water and TiO2-x (100 μg/mL) upon exposure to an 808 nm laser (1.5 W/cm2). (C) temperature increase of TiO2-x at various concentrations (DI Water, 25, 50, 100, and 200 μg/mL) under 808 nm laser (1.5 W/cm2) for 10 min. (D) temperature elevation of TiO2-x (200 μg/mL) at various power densities (0.5, 0.75, 1.0, 1.25 and 1.5 W/cm2) under 808 nm laser (1.5 W/cm2) for 10 min. (E) heating and cooling curve of the aqueous dispersion of TiO2-x (200 μg/mL) under 808 nm NIR irradiation (1.5 W/cm2) for periods. (F) Linear time data versus lnθ acquired from the cooling period of the TiO2-x aqueous dispersion. (G) Heating and cooling curve of the aqueous dispersion of TiO2-x (200 μg/mL) for four cycles under 808 nm laser irradiation at a power intensity of 1.5 W/cm2 (H) UV–Vis spectra of TiO2-x solution containing DPBF exposed to an 808 nm laser (1.5 W/cm2) for a different duration.

Importantly, oxygen-deficient of TiO2–x also endowed effective ROS generation ability in a broad range of light wavelengths. As shown in Fig. 3H, the absorption of 1,3-diphenylbenzofuran (DPBF, an ROS probe) significantly decreases after treatment of TiO2-x under NIR irradiation (1.5 W/cm2, 4 min), which implied that TiO2-x can effectively produce singlet oxygen (1O2) to oxidized DPBF. To highlight the superiority of TiO2–x, the ROS production abilities under 808 nm NIR laser irradiation were studied, as compared with that of TiO2. After 4 min of laser irradiation (1.5 W/cm2), a more significant amount of 1O2 in TiO2–x group was observed than that of TiO2, as expected (Supporting Information Figs. S9 and S10).

To examine the GSH-responsiveness of the nanoplatform, the in-vitro CRISPR release profiles were performed under exposure to different concentrations of GSH. Firstly, the protein on TiO2-x was labeled with FITC, and after incubating with 10, 1, and 0 mmol/L GSH, the releasing protein in the supernatant was recorded by a fluorescence spectrometer. As shown in Supporting Information Figs. S11–S13, with the increasing concentrations of GSH, the rate of change for fluorescence signal accelerates, suggesting the cleavage of the disulfide bond contributed to CRISPR release from TiO2-x. To further confirm the GSH-triggered RNP detachment, bicinchoninic acid (BCA) analysis was applied, and the results show that ca 80% of RNP was released from TiO2-x within 12 h incubation in 10 mmol/L GSH (Supporting Information Fig. S14).

Next, we investigated the targeted gene editing performance of TiO2-x@Cas9-NH@HA in vitro. First, the internalization of TiO2-x@Cas9-NH@HA in GFP stably expressing human melanoma cell line (A375 cells) was detected by confocal laser scanning microscopy (CLSM). With the high concentration of glutathione (GSH, 2–10 mmol/L) in tumor cells, the disulfide bonds connecting Cas9 RNPs and TiO2-x NPs could be cleaved, resulting in the release of Cas9 RNPs from TiO2-x and obvious signal (red) in the nuclei (Fig. 4A). Two days later, T7 Endonuclease I (T7E1) assay was performed to quantify the frequency of mutations. The results indicate that the HSP90α and NRF2 gene locus were successfully edited with a high mutation frequency in TiO2-x@Cas9-N@HA/NIR, TiO2-x@Cas9-H@HA/NIR, and TiO2-x@Cas9-NH@HA/NIR group (Fig. 4B). To further confirm the results, the protein levels of HSP90α and NRF2 were also evaluated in A375 cells treated with various formulations using Western blotting. As shown in Fig. 4C, HSP90α and NRF2 protein of the tumor cells (TiO2-x@Cas9-NH@HA/NIR) are lower than that of the control groups. DNA sequencing of the target also showed two representative indels and insertions nearing the protospacer adjacent motif (PAM, Fig. 4D), further confirming the CRISPR/Cas9-mediated HSP90α and NRF2 knockout.

Figure 4.

Figure 4

Open in a new tab

CRISPR/Cas9-based gene editing with TiO2-x@Cas9-NH@HA in vitro. (A) CLSM images of A375-EGFP cells incubated with Cy3-modified TiO2-x@Cas9-NH@HA for 0 and 6 h, respectively. Blue, Hoechst; green, GFP; red, Cy3-labeled Cas9 proteins. Scale bar = 50 μm. (B) T7EI cleavage assay for indels frequency analysis of A375 cells of HSP90α/NRF2 loci after transfection with the PBS/NIR, TiO2-x/NIR, TiO2-x@HA/NIR, TiO2-x@Cas9-H@HA/NIR, TiO2-x@Cas9-N@HA/NIR, and TiO2-x@Cas9-NH@HA/NIR. (C) Western blotting for HSP90α/NRF2 expression levels in A375 cells with different treatments. G1, PBS/NIR; G2, TiO2-x@Cas9-NH@HA; G3, TiO2-x/NIR; G4, TiO2-x@HA/NIR; G5, TiO2-x@Cas9-H@HA/NIR; G6, TiO2-x@Cas9-N@HA/NIR; G7, TiO2-x@Cas9-NH@HA/NIR. (D) Representative DNA sequences for indels of HSP90α/NRF2 detected in mutant colonies treated with TiO2-x@Cas9-NH@HA. (E) The representative fluorescent images of A375 cells were stained with DCFH-DA after various treatments. Scale bar = 200 μm.

To confirm the generating ROS in response to NIR irradiation in living cells, we employed 2,7-dichloroflfluorescein diacetate (DCFH-DA) to evaluate the level of intracellular ROS. As shown in Fig. 4E, no green signal was observed in A375 cells after being treated with NIR or TiO2-x@Cas9-NH@HA NPs only. By contrast, we can readily discover a green fluorescence in the cells after treatment with TiO2-x/NIR and TiO2-x@HA/NIR. Since more TiO2-x@HA can get in cells with the assistance of HA coating, fluorescence signals of TiO2-x@HA/NIR group were stronger than TiO2-x/NIR group. Notably, we have discovered that green fluorescence in TiO2-x@Cas9-N@HA/NIR and TiO2-x@Cas9-NH@HA groups were strongest among all groups, which probably resulted from the successful gene editing mediated by TiO2-x@Cas9-N@HA or TiO2-x@Cas9-NH@HA NPs and the edited NRF2 failed to regulate the intracellular ROS level of A375 cells.

Encouraged by the aforementioned results, we further evaluated the anticancer effect of our nanoplatform in vitro (Fig. 5A). The cytotoxicity of TiO2-x and TiO2-x@Cas9-NH@HA nanoparticles was tested by the standard cell counting kit 8 (CCK-8) assay. As shown in Fig. 5B, various concentrations of TiO2-x and TiO2-x@Cas9-NH@HA solution (0, 25, 50, 100, 200, and 400 μg/mL) without NIR irradiation show no obvious cytotoxicity, indicating that TiO2-x and TiO2-x@Cas9-NH@HA demonstrated favorable biocompatibility as therapeutic nanoagents and CRISPR-Cas9 delivery system. Next, we investigated the in vitro cytotoxicity of TiO2-x, TiO2-x@HA, TiO2-x@Cas9-H@HA, TiO2-x@Cas9-N@HA, TiO2-x@Cas9-NH@HA exposed to 808 laser (1.5 W/cm2, 5 min, Supporting Information Fig. S15). The results demonstrate low phototherapy efficiency could be achieved, i.e., about 70.5% and 63.6% cell viability were found in TiO2-x and TiO2-x@HA groups, respectively (Fig. 5C). After combining with CRISPR, TiO2-x@Cas9-H@HA (only targeting HSP90α) and TiO2-x@Cas9-N@HA (only targeting NRF2) groups enhanced the anticancer effect, and exhibited lower viability to A375 cells, about 40.1% and 36.4%, respectively. As anticipated, TiO2-x@Cas9-NH@HA group, which targeted HSP90α and NRF2 at the same time, showed a much higher cell-killing effect, indicating that our gene editing strategy had significantly improved the in vitro therapeutic effect of PTT and PDT. Besides, the gene editing-mediated PTT and PDT were analyzed by flow cytometry apoptosis protocol based on the AnnexinV-FITC and PI assay, as well as calcein-AM (stained live cells) and PI (stained dead cells) staining (Fig. 5D and E).

Figure 5.

Figure 5

Open in a new tab

In vitro PTT/PDT-based synergistic cancer therapy. (A) Schematic illustration for tumor cells with HSP90α and NRF2 depletion by TiO2-x@Cas9-NH@HA undergoing an NIR light irradiation and then the cell viability analysis was performed. (B) CCK-8 assay for the cytocompatibility assessment on A375 cells treated with TiO2-x and TiO2-x@Cas9-NH@HA at elevated concentrations (0, 25, 50, 100, 200, and 400 μg/mL) without NIR light irradiation. (C) CCK-8 assay for the cytotoxicity assessment on A375 cells treated with PBS/NIR, TiO2-x@Cas9-NH@HA, TiO2-x/NIR, TiO2-x@HA/NIR, TiO2-x@Cas9-H@HA/NIR, TiO2-x@Cas9-N@HA/NIR, and TiO2-x@Cas9-NH@HA/NIR. (D) Flow-cytometry apoptosis assay of A375 cells. Q1, dead cells; Q2, late apoptotic cells; Q3, early apoptotic cells; and Q4, normal cells. (E) The representative fluorescent images of A375 cells after different treatments. Green, calcein-AM; Red, PI. Scale bar = 400 μm. The mean value was analyzed using t-test (n = 3). ∗∗∗P < 0.001; ns, not significant.

Finally, we built xenograft model of A375 tumor-bearing BALB/c mice to evaluate the synergistic therapeutic effect of the resulting nanoplatform in vivo (Fig. 6A). First, the biodistribution of TiO2-x@Cas9-NH@HA was evaluated. With increasing time, TiO2-x@Cas9-NH@HA progressively accumulated in the tumor tissues, the highest fluorescence signal appeared at 12 h and was still detained after 48 h (Fig. 6B). As shown in Fig. 6C, a much stronger fluorescence was detected in the tumor tissues after intravenous injection (i.v.), which laid a foundation for the following therapy. Notably, an enhanced significant Cy7 fluorescence intensity was observed in the tumor after intravenous administration of TiO2-x@Cas-NH@HA, indicating the relatively higher tumor-targeted delivery after HA coating (Supporting Information Fig. S16). Next, the mice were randomly divided into seven groups via intravenous injection of different drugs after the tumors grew to ca. 80 mm3. Drawing on previous experiment results in vitro, NIR laser light (1.5 W/cm2) for 10 min was used to achieve desired temperature changes of mild-PTT (43 °C)/PDT every two days (Supporting Information Fig. S17). As provided in Fig. 5D, the tumor volumes in both control groups (PBS/NIR and TiO2-x@Cas9-NH@HA without NIR) show a tendency of rapid increase, indicating the limited suppression efficacy of these treatments in vivo. In contrast, TiO2-x@Cas9-NH@HA/NIR displayed the strongest inhibition of tumor growth among all groups, and almost eliminated tumor in mice, which benefited from the synergistic gene editing/photodynamic/photothermal effect. Similar results were obtained via tumor weight and the photograph of isolated tumors collected from the euthanized mice (Fig. 6E and F). Importantly, the mice body weight of TiO2-x@Cas9-NH@HA/NIR treatment was not observed any abnormal changes (Fig. 6G), and the H&E staining of major organs tissue slices were observed no obvious abnormality nor appreciable organ damage (Supporting Information Fig. S18), demonstrating the low toxicity of various treatments. In addition, the tumors were collected and sliced for further analysis. As shown in H&E staining (Supporting Information Fig. S19), a remarkable inhibition of tumor growth was observed in TiO2-x@Cas9-NH@HA group from the highly decreased cell density in the tumor tissues. We can obtain a similar phenomenon from TdT-mediated dUTP nickend labeling (TUNEL) analysis (Supporting Information Fig. S20) and Ki67 antibody staining, as well (Supporting Information Fig. S21). These results demonstrate that the combination involving both TiO2-x-based PDT/PTT and gene editing gained a greater therapeutic effect than other single strategies alone. To further study the combined therapy, HSP90α and NRF2 immunohistochemistry (IHC) staining of tumoral tissue sections were monitored, and the group with the treatment of TiO2-x@Cas9-NH@HA/NIR exhibited the lower expression of HSP90α and NRF2, which indicated its effective disruption of HSP90α and NRF2 (Fig. 6H), confirming successful gene editing in vivo. Furthermore, the mutation analysis showed similar results (Supporting Information Figs. S22–S24). Furthermore, we introduced the addition of another comparison group which used scrambled sgRNA to support the conclusion (Supporting Information Fig. S25). Compared with the TiO2-x@Cas9-S@HA/NIR (scrambled sgRNA only) group, the TiO2-x@Cas9-SH@HA/NIR and TiO2-x@Cas9-SN@HA/NIR groups (HSP90α or NRF2 + scrambled sgRNA, respectively) displayed an obvious suppressive effect on tumor development. Notably, the TiO2-x@Cas9-NH@HA/NIR group indicated the strongest tumor suppressive effect, which strengthened our previous conclusion that duplex genome-editing sensitized phototherapy can kill cancer cells most effectively.

Figure 6.

Figure 6

Open in a new tab

In-vivo study of TiO2-x@Cas9-NH@HA for tumor synergistic combination therapy. (A) Schematic diagram of the treatment process in nude mice bearing A375 tumor. (B) Fluorescence signal distribution of TiO2-x@Cas9-NH@HA in vivo after intravenous administration. (C) Distribution of TiO2-x@Cas9-NH@HA in different major organs at 0, 3, 6, 12, 24, and 48 h. The organs in the Figure were the heart, spleen, liver, lung, kidney, and tumor (from left to right). (D) Tumor-volume curves of A375 xenograft tumor-bearing mice after different treatments. (E) Weight of isolated tumors after different treatments. (F) The photograph of isolated tumors treated with (Ⅰ) PBS/NIR, (Ⅱ) TiO2-x@Cas9-NH@HA, (Ⅲ) TiO2-x/NIR, (Ⅳ) TiO2-x@HA/NIR, (Ⅴ) TiO2-x@Cas9-H@HA/NIR, (Ⅵ) TiO2-x@Cas9-N@HA/NIR, and (Ⅶ) TiO2-x@Cas9-NH@HA/NIR on Day 18. (G) The time-dependent mouse body–weight curves in different treatment groups. (H) Immunohistochemical analysis in tumor region stained with HSP90α and NRF2. Scale bar = 50 μm, ∗∗∗P < 0.001, n = 4.

4. Conclusions

In summary, we developed a tumor-microenvironment responsive nanotherapeutic platform for mild PTT/PDT. In the system, CRISPR system was covalently linked on TiO2-x by a GSH-responsive disulfide bond, and HSP90α and NRF2 genes were chosen to edit by Cas9 for sensitizing tumor cells to heat and ROS. Our results demonstrated significant synergistic therapy efficacy that have been achieved both in vitro and in vivo under 808 nm laser irradiation, and no need to maintain hyperthermia temperature (>50 °C) and high ROS generation level. This method provides a versatile strategy for gene editing-mediated synergistic therapy with maximizing efficacy and minimizing side-effects, which displayed great potential for clinical translation in the future.

Acknowledgments

This study was supported by the National Key R&D Program of China (2019YFA0709200), the financial support from the National Natural Science Foundation of China (21874066, 81601632, and 31901010), the Natural Science Foundation of Jiangsu Province (BK20160616, China), the Fundamental Research Funds for Central Universities, the Priority Academic Program Development of Jiangsu Higher Education Institutions (Integration of Chinese and Western Medicine, China), the Key International Cooperation of the National Natural Science Foundation of China (No.81920108029), the Key Foundation for Social Development Project of the Jiangsu Province, China (BE2021741) and Jiangsu Specially Appointed Professorship Foundation (China).

Footnotes

Peer review under responsibility of Chinese Pharmaceutical Association and Institute of Materia Medica, Chinese Academy of Medical Sciences.

Appendix A

Supporting data to this article can be found online at https://doi.org/10.1016/j.apsb.2022.06.016.

Contributor Information

Xiaoxiang Guan, Email: xguan@njmu.edu.cn.

Yujun Song, Email: ysong@nju.edu.cn.

Xin Han, Email: xhan0220@njucm.edu.cn.

Author contributions

Zekun Li and Yongchun Pan contributed equally to this work. Xin Han and Yujun Song conceived the idea and designed the experiments. Zekun Li and Yongchun Pan performed the majority of experimental work. Xiaowei Luan performed TEM characterization of materials. Zekun Li, Shiyu Du, Yayao Li, Chao Chen, Hongxiu Song, Yueyao Wu and Qin Xu performed the in vivo experiments. Zekun Li and Yongchun Pan wrote the manuscript with feedback from all the authors. Xiaoxiang Guan, Yujun Song and Xin Han supervised the project.

Conflicts of interest

The authors declare no conflicts of interest.

Appendix A. Supplementary data

The following is the Supplementary data to this article:

Multimedia component 1
mmc1.pdf (2.9MB, pdf)

References

  • 1.Luan X., Pan Y., Gao Y., Song Y. Recent near-infrared light-activated nanomedicine toward precision cancer therapy. J Mater Chem B. 2021;9:7076–7099. doi: 10.1039/d1tb00671a. [DOI] [PubMed] [Google Scholar]
  • 2.Zhou L., Wang H., Li Y. Stimuli-responsive nanomedicines for overcoming cancer multidrug resistance. Theranostics. 2018;8:1059–1074. doi: 10.7150/thno.22679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wang H., Yu D., Fang J., Cao C., Liu Z., Ren J., et al. Renal-clearable porphyrinic metal-organic framework nanodots for enhanced photodynamic therapy. ACS Nano. 2019;13:9206–9217. doi: 10.1021/acsnano.9b03531. [DOI] [PubMed] [Google Scholar]
  • 4.Zhang Y., Wang F., Liu C., Wang Z., Kang L., Huang Y., et al. Nanozyme decorated metal-organic frameworks for enhanced photodynamic therapy. ACS Nano. 2018;12:651–661. doi: 10.1021/acsnano.7b07746. [DOI] [PubMed] [Google Scholar]
  • 5.Li J., Huang J., Ao Y., Li S., Miao Y., Yu Z., et al. Synergizing upconversion nanophotosensitizers with hyperbaric oxygen to remodel the extracellular matrix for enhanced photodynamic cancer therapy. ACS Appl Mater Interfaces. 2018;10:22985–22996. doi: 10.1021/acsami.8b07090. [DOI] [PubMed] [Google Scholar]
  • 6.Li X., Lovell J.F., Yoon J., Chen X. Clinical development and potential of photothermal and photodynamic therapies for cancer. Nat Rev Clin Oncol. 2020;17:657–674. doi: 10.1038/s41571-020-0410-2. [DOI] [PubMed] [Google Scholar]
  • 7.Qiao Y., Wan J., Zhou L., Ma W., Yang Y., Luo W., et al. Stimuli-responsive nanotherapeutics for precision drug delivery and cancer therapy. WIREs Nanomed Nanobiotechnol. 2019;11:e1527. doi: 10.1002/wnan.1527. [DOI] [PubMed] [Google Scholar]
  • 8.Xiong X., Tang Y., Xu C., Huang Y., Wang Y., Fu L., et al. High carbonization temperature to trigger enzyme mimicking activities of silk-derived nanosheets. Small. 2020;16 doi: 10.1002/smll.202004129. [DOI] [PubMed] [Google Scholar]
  • 9.Wu J., Liu T., Rios Z., Mei Q., Lin X., Cao S. Heat shock proteins and cancer. Trends Pharmacol Sci. 2017;38:226–256. doi: 10.1016/j.tips.2016.11.009. [DOI] [PubMed] [Google Scholar]
  • 10.Deng S., Li X., Liu S., Chen J., Li M., Chew S.Y., et al. Codelivery of CRISPR-Cas9 and chlorin e6 for spatially controlled tumor-specific gene editing with synergistic drug effects. Sci Adv. 2020;6 doi: 10.1126/sciadv.abb4005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.DeNicola G.M., Karreth F.A., Humpton T.J., Gopinathan A., Wei C., Frese K., et al. Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature. 2011;475:106–109. doi: 10.1038/nature10189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Meng L., Cheng Y., Tong X., Gan S., Ding Y., Zhang Y., et al. Tumor oxygenation and hypoxia inducible factor-1 functional inhibition via a reactive oxygen species responsive nanoplatform for enhancing radiation therapy and abscopal effects. ACS Nano. 2018;12:8308–8322. doi: 10.1021/acsnano.8b03590. [DOI] [PubMed] [Google Scholar]
  • 13.Gao G., Jiang Y.W., Sun W., Guo Y., Jia H.R., Yu X.W., et al. Molecular targeting-mediated mild-temperature photothermal therapy with a smart albumin-based nanodrug. Small. 2019;15 doi: 10.1002/smll.201900501. [DOI] [PubMed] [Google Scholar]
  • 14.Zorov D.B., Juhaszova M., Sollott S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev. 2014;94:909–950. doi: 10.1152/physrev.00026.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Liu H.J., Wang M., Hu X., Shi S., Xu P. Enhanced photothermal therapy through the in situ activation of a temperature and redox dual-sensitive nanoreservoir of triptolide. Small. 2020;16 doi: 10.1002/smll.202003398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Suzuki T., Motohashi H., Yamamoto M. Toward clinical application of the Keap1-Nrf2 pathway. Trends Pharmacol Sci. 2013;34:340–346. doi: 10.1016/j.tips.2013.04.005. [DOI] [PubMed] [Google Scholar]
  • 17.Tang X., Tan L., Shi K., Peng J., Xiao Y., Li W., et al. Gold nanorods together with HSP inhibitor-VER-155008 micelles for colon cancer mild-temperature photothermal therapy. Acta Pharm Sin B. 2018;8:587–601. doi: 10.1016/j.apsb.2018.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hoey T. Drug resistance epigenetics and tumor cell heterogeneity. Sci Transl Med. 2010;2:8–19. doi: 10.1126/scitranslmed.3001056. [DOI] [PubMed] [Google Scholar]
  • 19.Dunbar C.E., High K.A., Joung J.K., Kohn D.B., Ozawa K., Sadelain M. Gene therapy comes of age. Science. 2018;359 doi: 10.1126/science.aan4672. [DOI] [PubMed] [Google Scholar]
  • 20.Kong H., Ju E., Yi K., Xu W., Lao Y.H., Cheng D., et al. Advanced nanotheranostics of CRISPR/Cas for viral hepatitis and hepatocellular carcinoma. Adv Sci. 2021;8 doi: 10.1002/advs.202102051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Guo J., Wan T., Li B., Pan Q., Xin H., Qiu Y., et al. Rational design of poly(disulfide)s as a universal platform for delivery of CRISPR-Cas9 machineries toward therapeutic genome editing. ACS Cent Sci. 2021;7:990–1000. doi: 10.1021/acscentsci.0c01648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Chen Z., Liu F., Chen Y., Liu J., Wang X., Chen A.T., et al. Targeted delivery of CRISPR/Cas9-mediated cancer gene therapy via liposome-templated hydrogel nanoparticles. Adv Funct Mater. 2017;27 doi: 10.1002/adfm.201703036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.NguyenDN RothTL., Li P.J., Chen P.A., Apathy R., Mamedov M.R., et al. Polymer-stabilized Cas9 nanoparticles and modified repair templates increase genome editing efficiency. Nat Biotechnol. 2020;38:44–49. doi: 10.1038/s41587-019-0325-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang P., Zhang L., Zheng W., Cong L., Guo Z., Xie Y., et al. Thermo-triggered release of CRISPR-Cas9 system by lipid-encapsulated gold nanoparticles for tumor therapy. Angew Chem Int Ed. 2018;57:1491–1496. doi: 10.1002/anie.201708689. [DOI] [PubMed] [Google Scholar]
  • 25.Tang H., Xu X., Chen Y., Xin H., Wan T., Li B., et al. Reprogramming the tumor microenvironment through second-near-infrared-window photothermal genome editing of PD-L1 mediated by supramolecular gold nanorods for enhanced cancer immunotherapy. Proc Natl Acad Sci U S A. 2021;33 doi: 10.1002/adma.202006003. [DOI] [PubMed] [Google Scholar]
  • 26.Li Y., Ye Z., Yang H., Xu Q. Tailoring combinatorial lipid nanoparticles for intracellular delivery of nucleic acids, proteins, and drugs. Acta Pharm Sin B. 2022;12:2624–2639. doi: 10.1016/j.apsb.2022.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Behr M., Zhou J., Xu B., Zhang H. In vivo delivery of CRISPR-Cas9 therapeutics: progress and challenges. Acta Pharm Sin B. 2021;11:2150–2171. doi: 10.1016/j.apsb.2021.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pan Y., Luan X., Zeng F., Xu Q., Li Z., Gao Y., et al. Hollow covalent organic framework-sheltering CRISPR/Cas12a as an in-vivo nanosensor for ATP imaging. Biosens Bioelectron. 2022;209 doi: 10.1016/j.bios.2022.114239. [DOI] [PubMed] [Google Scholar]
  • 29.Chen C., Ma Y., Du S., Wu Y., Shen P., Yan T., et al. Controlled CRISPR-Cas9 ribonucleoprotein delivery for sensitized photothermal therapy. Small. 2021;17 doi: 10.1002/smll.202101155. [DOI] [PubMed] [Google Scholar]
  • 30.Li X., Pan Y., Chen C., Gao Y., Liu X., Yang K., et al. Hypoxia-responsive gene editing to reduce tumor thermal tolerance for mild-photothermal therapy. Angew Chem Int Ed. 2021;60:21200–21204. doi: 10.1002/anie.202107036. [DOI] [PubMed] [Google Scholar]
  • 31.Luo Y.L., Xu C.F., Li H.J., Cao Z.T., Liu J., Wang J.L., et al. Macrophage-specific in vivo gene editing using cationic lipid-assisted polymeric nanoparticles. ACS Nano. 2018;12:994–1005. doi: 10.1021/acsnano.7b07874. [DOI] [PubMed] [Google Scholar]
  • 32.Pan Y., Yang J., Luan X., Liu X., Li X., Yang J., et al. Near-infrared upconversion-activated CRISPR-Cas9 system: a remote-controlled gene editing platform. Sci Adv. 2019;5 doi: 10.1126/sciadv.aav7199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sun W., Ji W., Hall J.M., Hu Q., Wang C., Beisel C.L., et al. Self-assembled DNA nanoclews for the efficient delivery of CRISPR-Cas9 for genome editing. Angew Chem Int Ed. 2015;54:12029–12033. doi: 10.1002/anie.201506030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang P., Zhang L., Xie Y., Wang N., Tang R., Zheng W., et al. Genome editing for cancer therapy: delivery of Cas9 protein/sgrna plasmid via a gold nanocluster/lipid core-shell nanocarrier. Adv Sci. 2017;4 doi: 10.1002/advs.201700175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zuris J.A., Thompson D.B., Shu Y., Guilinger J.P., Bessen J.L., Hu J.H., et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015;33:73–80. doi: 10.1038/nbt.3081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhang L., Wang L., Xie Y., Wang P., Deng S., Qin A., et al. Triple-targeting delivery of CRISPR/Cas9 to reduce the risk of cardiovascular diseases. Angew Chem Int Ed. 2019;58:12404–12408. doi: 10.1002/anie.201903618. [DOI] [PubMed] [Google Scholar]
  • 37.Wan T., Pan Q., Liu C., Guo J., Li B., Yan X., et al. A duplex CRISPR-Cas9 ribonucleoprotein nanomedicine for colorectal cancer gene therapy. Nano Lett. 2021;21:9761–9771. doi: 10.1021/acs.nanolett.1c03708. [DOI] [PubMed] [Google Scholar]
  • 38.Zhuo C., Zhang J., Lee J.H., Jiao J., Cheng D., Liu L., et al. Spatiotemporal control of CRISPR/Cas9 gene editing. Signal Transduct Targeted Ther. 2021;6:238. doi: 10.1038/s41392-021-00645-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ming J., Zhu T., Yang W., Shi Y., Huang D., Li J., et al. Pd@Pt-GOx/HA as a novel enzymatic cascade nanoreactor for high-efficiency starving-enhanced chemodynamic cancer therapy. ACS Appl Mater Interfaces. 2020;12:51249–51262. doi: 10.1021/acsami.0c15211. [DOI] [PubMed] [Google Scholar]
  • 40.Yang C., Fu Y., Huang C., Hu D., Zhou K., Hao Y., et al. Chlorin e6 and CRISPR-Cas9 dual-loading system with deep penetration for a synergistic tumoral photodynamic-immunotherapy. Biomaterials. 2020;255 doi: 10.1016/j.biomaterials.2020.120194. [DOI] [PubMed] [Google Scholar]
  • 41.Yang J., Li Z., Shen M., Wang Y., Wang L., Li J., et al. Programmable unlocking nano-matryoshka-CRISPR precisely reverses immunosuppression to unleash cascade amplified adaptive immune response. Adv Sci. 2021;8 doi: 10.1002/advs.202100292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Peng T., Huang Y., Feng X., Zhu C., Yin S., Wang X., et al. TPGS/hyaluronic acid dual-functionalized PLGA nanoparticles delivered through dissolving microneedles for markedly improved chemo-photothermal combined therapy of superficial tumor. Acta Pharm Sin B. 2021;11:3297–3309. doi: 10.1016/j.apsb.2020.11.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang M., Zhao Y., Chang M., Ding B., Deng X., Cui S., et al. Azo initiator loaded black mesoporous titania with multiple optical energy conversion for synergetic photo-thermal-dynamic therapy. ACS Appl Mater Interfaces. 2019;11:47730–47738. doi: 10.1021/acsami.9b17375. [DOI] [PubMed] [Google Scholar]
  • 44.Song Y., Fang K., Bukhari M.N., Ren Y., Zhang K., Tang Z. Green and efficient inkjet printing of cotton fabrics using reactive dye@copolymer nanospheres. ACS Appl Mater Interfaces. 2020;12:45281–45295. doi: 10.1021/acsami.0c12899. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.pdf (2.9MB, pdf)

Articles from Acta Pharmaceutica Sinica. B are provided here courtesy of Elsevier

RESOURCES