Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Nov 7.
Published in final edited form as: Curr Biol. 2022 Sep 21;32(21):4719–4726.e4. doi: 10.1016/j.cub.2022.08.081

ATM/ATR kinases link the synaptonemal complex and DNA double-strand break repair pathway choice

Laura I Láscarez-Lagunas 1,†, Saravanapriah Nadarajan 1,†, Marina Martinez-Garcia 1,§, Julianna Nicole Quinn 1, Elena Todisco 1, Tanuj Thakkar 1, Elizaveta Berson 1, Don Eaford 1, Oliver Crawley 2, Alex Montoya 2, Peter Faull 2, Nuria Ferrandiz 2, Consuelo Barroso 2, Sara Labella 3, Emily Koury 4, Sarit Smolikove 4, Monique Zetka 3, Enrique Martinez-Perez 2, Monica P Colaiácovo 1,*
PMCID: PMC9643613  NIHMSID: NIHMS1835622  PMID: 36137547

SUMMARY

DNA double-strand breaks (DSBs) are deleterious lesions which must be repaired precisely to maintain genomic stability. During meiosis, programmed DSBs are repaired via homologous recombination (HR) while repair using the nonhomologous end joining (NHEJ) pathway is inhibited, thereby ensuring crossover formation and accurate chromosome segregation1,2. How DSB repair pathway choice is implemented during meiosis is unknown. In C. elegans, meiotic DSB repair takes place in the context of the fully formed, highly dynamic zipper-like structure present between homologous chromosomes called the synaptonemal complex (SC)3–9. The SC consists of a pair of lateral elements bridged by a central region composed by the SYP proteins in C. elegans. How the structural components of the SC are regulated to maintain the architectural integrity of the assembled SC around DSB repair sites, remained unclear. Here, we show that SYP-4, a central region component of the SC, is phosphorylated at Serine 447 in a manner dependent on DSBs and the ATM/ATR DNA damage response kinases. We show that this SYP-4 phosphorylation is critical for preserving the SC structure following exogenous (γ-IR-induced) DSB formation and for promoting normal DSB repair progression and crossover patterning following SPO-11-dependent and exogenous DSBs. We propose a model in which ATM/ATR-dependent phosphorylation of SYP-4 at the S447 site plays important roles both in maintaining the architectural integrity of the SC following DSB formation and in warding off repair via the NHEJ repair pathway, thereby preventing aneuploidy.

Keywords: ATM/ATR, DSB, NHEJ, SYP-4, synaptonemal complex, meiosis, C. elegans

Graphical Abstract

graphic file with name nihms-1835622-f0005.jpg

eTOC Blurb

Lascarez-Lagunas et al. show DSB- and ATM/ATR-dependent phosphorylation of the SC structural component SYP-4 at S447 during meiosis. SYP-4 phosphorylation is important for maintaining the architectural integrity of the SC following exogenous DSBs, regulating CO patterning, and warding off repair via the NHEJ repair pathway to prevent aneuploidy.

RESULTS

SYP-4 is phosphorylated at the S447 site

Central region components of the SC undergo a wide range of regulatory inputs including post-translational modifications that promote changes in the SC and in key meiotic events, such as DSB formation and repair, taking place within the context of this scaffold8,10,11. To determine how post-translational regulation of the SC plays a role in regulating chromosome synapsis and DSB repair we set out to identify potential phosphorylation sites in the central region proteins SYP-1/2/3/4 using the programs GPS 2.0, NetPhos 3.1, and PHOSIDA12–15. These programs identified the amino acid S447 within an S/TQ site on SYP-4 as a potential/predicted phosphorylation site for the DNA damage response (DDR) kinases ATM/ATM-1 and ATR/ATL-1 (Figure 1A). In vivo phosphorylation of SYP-4 at S447 was confirmed by phosphoproteomic analysis (Figure 1B and Figure S1A–B) and with a phospho-specific antibody against the SYP-4 S447 (pSYP-4 (S447)) site (Figure 1C and Figure S2A). In wild-type worms, the SYP proteins are first observed in the leptotene/zygotene region forming foci and short tracks on the chromosomes. In pachytene, the SYP proteins are detected along the full length of the chromosomes specifically at the interface between the homologs. Starting in late pachytene and early diplotene, the SYP proteins disassemble from the long arms of the chromosomes and are observed only on the short arms of the bivalents where they persist through early diakinesis (Figure S2B and 3,16,17). Immunostaining of wild-type gonads revealed a unique localization pattern with the pSYP-4 (S447) antibody. In leptotene/zygotene stage nuclei, few pSYP-4 (S447) foci are observed on chromosomes (Figure S2A). In pachytene, pSYP-4 (S447) is detected as foci and short tracks on the chromosomes unlike the continuous tracks running along the full length of the chromosomes observed for the SYP-4 protein (Figure 1C and Figure S2B). In late pachytene, diplotene, and diakinesis stage nuclei, pSYP-4 (S447) is no longer detected on the chromosomes (Figure S2A). pSYP-4 (S447) localization is specific, given that pSYP-4 signal is absent from chromosomes in germlines from syp-4 null mutants (Figure 1C). Moreover, the phospho-specificity of pSYP-4 (S447) was confirmed by the absence of detectable signal in germlines of syp-4(S447A) phosphodead mutants (herein referred to as syp-4pd) (Figure 1C). Altogether, our data show that S447 on the SYP-4 protein is phosphorylated and that this phosphorylated form of SYP-4 exhibits a unique localization pattern during meiosis.

Figure 1. SYP-4 is phosphorylated at the S447 site in a DSB-dependent manner.

Figure 1.

(A) Schematic representation of the SYP-4 protein with the predicted ATM/ATR kinase phosphorylation site (S447) indicated. CC indicates the coiled-coil domains and aa indicates amino acids. (B) MS/MS fragmentation spectrum for SYP-4 phosphopeptide DILATEQAALSQEQEPEIVEK in the range 125–1900m/z. The annotated spectrum shows fragment ion species matched between theoretical and measured values. ‘b ions’ are generated through fragmentation of the peptide bond from the N-terminus, whereas ‘y ions’ are generated through fragmentation from the C-terminus. Ion species detected with a mass or neutral loss of 98 (phosphoric acid - H3PO4) are indicated in yellow; those ions without phospho-loss are annotated in red. Analysis of ‘y’ and ‘b’ ions with neutral loss is consistent with phosphorylation of serine 447 of the SYP-4 protein (DILATEQAALpSQEQEPEIVEK). Peptide sequence identification meets confidence criteria (expectation value = 0.00019). (C) High-resolution images of pachytene stage nuclei from wild type, syp-4pd (syp-4 phosphodead), and syp-4 null mutant gonads stained with anti-pSYP-4 (magenta) and DAPI (blue). Phosphorylated SYP-4 signal is detected forming foci and discontinuous tracks at the interface between synapsed chromosomes during pachytene. Phosphorylated SYP-4 signal is absent in syp-4pd mutants and syp-4 null mutants, indicating specificity of the antibody. 18 to 24 hours post-L4 stage gonads were used for immunostaining. 15, 12, and 11 gonad arms from two separate experiments were analyzed for wild type, syp-4pd, and syp-4 null mutants, respectively. Scale bars, 3 μm. (D) High-resolution images of pachytene nuclei stained with anti-pSYP-4 (magenta) and DAPI (blue) in wild type, wild type + IR (60Gy), spo-11, and spo-11 + IR (60Gy). Instead of the discontinuous pSYP-4 tracks and foci observed on pachytene chromosomes in wild type, pSYP-4 forms continuous and brighter tracks following γ-IR treatment. pSYP-4 signal in pachytene nuclei is absent in spo-11 mutants but can be rescued following exogenous DSB formation via γ-IR (60Gy). 24 hrs post-L4 worms were exposed to IR and immunostaining was performed 2 hours post-IR. 15, 15, 17, and 16 gonad arms from two separate experiments were analyzed for each respective genotype/condition. Scale bar, 3 μm. See also Figures S1 and S2A–C.

SYP-4 phosphorylation is dependent on exogenous and endogenous DSBs

Since the S447 site on SYP-4 is predicted to be phosphorylated by DDR kinases, we tested the role of DNA damage in this modification. We introduced exogenous DSBs into wild-type worms by exposing them to 60 Gy of γ-IR and immunostained their gonads using the pSYP-4 (S447) antibody. Instead of the discontinuous and shorter tracks observed without IR, pSYP-4 (S447) localized along the length of the chromosomes (Figure 1D). To test whether pSYP-4 localization is also dependent on endogenous DSBs, we immunostained gonads from spo-11 mutants, which lack the topoisomerase-like protein required for the formation of programmed meiotic DSBs and have normal SC formation18. We found that pSYP-4 (S447) signal is absent from the gonads in spo-11 mutants but can be rescued by introduction of exogenous DSBs with γ-IR (Figure 1D). In contrast to wild type, where pSYP-4 (S447) signal is primarily detected on chromosomes in pachytene nuclei (likely due to its manifestation downstream of SPO-11-dependent DSB formation), in irradiated spo-11 germlines pSYP-4 signal is also detected along chromosomes in leptotene/zygotene and late pachytene stage nuclei (Figure S2C). Additionally, phospho-enrichment mass spectrometry analysis comparing nuclei isolated from untreated (control) and irradiated worms revealed a significant increase in phosphorylated S447 on SYP-4 after IR treatment (P=0.0008 by a two-tailed unpaired t-test; Figure S1C). Taken together, our data suggest that phosphorylation of S447 on SYP-4 is dependent on the formation of exogenous and endogenous DSBs.

SYP-4 phosphorylation is dependent on the ATM/ATR DDR kinases

To determine whether phosphorylation of the S447 site in SYP-4 is dependent on ATM-1 and ATR/ATL-1, we immunostained gonads from atm-1 and atl-1 single mutants with the pSYP-4 (S447) antibody (Figure 2A). Although pSYP-4 (S447) signal intensity is reduced in atm-1 and atl-1 single mutants compared to wild type, pSYP-4 localization on the chromosomes is not completely abolished. However, analysis of the atm-1; atl-1 double mutants revealed a further reduction of pSYP-4 signal on meiotic chromosomes. Importantly, this reduction is not due to absence of the SC as revealed by analysis of pachytene nuclei co-stained for SYP-1 and pSYP-4 in atm-1;atl-1 mutants (Figure 2B). These observations suggest that phosphorylation of S447 in SYP-4 is dependent on both ATM-1 and ATL-1.

Figure 2. Phosphorylation of SYP-4 at S447 is dependent on both ATM-1 and ATL-1 and is required for normal DSB repair progression.

Figure 2.

(A) High-resolution images of pachytene stage nuclei stained with anti-pSYP-4 (magenta) and DAPI (blue) for the indicated genotypes. pSYP-4 signal is partially reduced in atl-1 and atm-1 single mutants and further decreased in atm-1;atl-1 double mutants. 15, 13, 12, and 10 gonad arms from two separate experiments were analyzed for wild type, atl-1, atm-1, and atm-1;atl-1, respectively. Scale bar, 3 μm. (B) High-resolution images of pachytene stage nuclei co-stained with anti-pSYP-4 (magenta), SYP-1 (green) and DAPI (blue) in atm-1;atl-1 double mutants showing nuclei with apparently normal SC and very reduced pSYP-4 signal. (C) Graph shows the increase in the mean number of germ cell corpses detected in syp-4pd mutants compared to wild type. ****P<0.0001 by the two-tailed Mann-Whitney test, 95% C.I. (D) High-resolution images of mid-pachytene nuclei (zone 5) stained with anti-RAD-51 (magenta) and DAPI (blue) for the indicated genotypes. Histogram shows increased levels of RAD-51 foci in pachytene nuclei (zones 5–7) in syp-4pd mutants compared to wild type. Schematic representation of the C. elegans hermaphrodite germline shows the seven zones scored for RAD-51 foci/nucleus. PMT- premeiotic tip, L/Z-leptotene/zygotene, EP- early pachytene, MP- mid-pachytene, and LP- late pachytene. Six gonad arms were analyzed for each genotype. ** Indicates P<0.01 by the two-tailed Mann-Whitney test, 95% C.I. (E) High-resolution images of late-pachytene stage nuclei stained with anti-ZHP-3 (magenta) and DAPI (blue) for the indicated genotypes. Total numbers of ZHP-3 foci detected on each nucleus are shown. Histogram shows elevated levels of ZHP-3/RNF212 foci observed in syp-4pd mutants (-IR) compared to wild type, which are further increased following γ-IR treatment (+IR). Colors indicate # of ZHP-3 foci scored in late pachytene nuclei for wild type and syp-4pd mutants +/− IR (60 Gy). 50 nuclei were analyzed for each genotype. *** Indicates P<0.001 by the two-tailed Mann-Whitney test, 95% C.I. See also Data S1B–D.

SYP-4 phosphorylation is required for regulation of DSB repair and CO patterning

To understand the role of phosphorylation at S447 on SYP-4 during meiosis, we analyzed syp-4pd worms for alterations in fertility, germ cell apoptosis levels, DSB repair progression, and CO formation. Analysis of syp-4pd mutants revealed a mild but significant reduction in brood size (194±34 eggs laid per adult compared to 224±32 in wild type, P<0.05 by the two-tailed Mann-Whitney test, 95% C.I.) and 7% embryonic lethality (n=140/1944, P<0.0001 by Fischer’s exact test, Data S1A) compared to wild type. Moreover, germ cell apoptosis levels were significantly increased at late pachytene in the syp-4pd mutant compared to wild type (P<0.0001 by the two-tailed Mann-Whitney test, 95% C.I.; Figure 2C and Data S1B), which can be due to impaired DSB repair progression19. In comparison, syp-4 null mutants, which completely lack an SC, also exhibit a mild reduction in brood size (185.5 eggs laid per adult), 97.5% embryonic lethality, and a further increase in germ cell apoptosis (7.89±0.83 corpses)20.

To assess DSB repair progression, we quantified the levels of the strand invasion/exchange factor RAD-51 in whole-mounted gonads (Figure 2D and Data S1C). This revealed significantly elevated levels of RAD-51 foci from mid to late pachytene in syp-4pd mutants compared to wild type, suggesting either elevated levels of DSB formation and/or impaired DSB repair. For example, a mean of 4.2 foci were observed in wild type mid-pachytene nuclei (zone 5) compared to 6.8 in syp-4pd mutants and 10.2 in syp-4 null mutants (Figure 2D and 20). Since the central region of the SC has been implicated in the regulation of CO frequency in worms21, we assessed the levels of ZHP-3/Zip3/RNF212, a marker of CO sites, in syp-4pd mutants. Importantly, due to CO interference only 6 ZHP-3 foci per late pachytene nucleus (one for each of the six pairs of homologs) are detected in wild type22. However, we observed a significant increase in the number of ZHP-3 foci in syp-4pd mutants compared to wild type, suggesting that CO control may be impaired (P<0.001 by the two-tailed Mann-Whitney test, 95% C.I.; Figure 2E and Data S1D). Since the ATM/ATR kinases are involved in DDR, we also examined ZHP-3 following IR treatment. This revealed a further significant increase in the levels of ZHP-3 foci in syp-4pd mutants compared to wild type +IR (P<0.001). Altogether our data suggest that phosphorylation of SYP-4 at S447 plays an important role in proper meiotic DSB repair progression and CO patterning in the worms.

SC architectural integrity following exogenous DSBs requires SYP-4 phosphorylation

To determine the role of phosphorylation of SYP-4 at S447 in SC formation we examined the localization of the central region component SYP-1 in whole-mounted gonads from syp-4pd mutants. The syp-4pd mutants did not exhibit overt defects in SC assembly, maintenance, or disassembly during meiosis (Figure 3 and Figure S2D). However, analysis of the SC following exposure to γ-IR, revealed discontinuous SC tracks in mid-pachytene nuclei in the syp-4pd mutants (Figure 3). Moreover, this was distinct from the SC rearrangement defect detected around DSB sites only in late pachytene and as a result of alterations in chromosome axes4. Axis morphogenesis was normal in syp-4pd mutants, as exemplified by the continuous tracks observed for the HORMA domain-containing protein HTP-3. Instead, only the SC’s central region was impaired, as indicated by the discontinuous tracks observed for SYP-1. Taken together, our data shows that phosphorylation of SYP-4 at S447 is required for the architectural integrity of the central region of the SC during mid-pachytene following exogenous DSB formation.

Figure 3. SYP-1 localization is affected after IR in the absence of SYP-4 phosphorylation at S447.

Figure 3.

High-resolution images showing the immunolocalization of axial element protein HTP-3 (green), SYP-1 (red) and DAPI (blue) in mid-pachytene stage nuclei in wild type, wild type + IR (60Gy), syp-4pd, and syp-4 pd + IR (60Gy). Exogenous DSBs induced by γ-IR result in discontinuous tracks and weaker signal for SYP-1 (indicated by yellow arrows), but not HTP-3, in syp-4 pd pachytene nuclei, revealing an effect on either re-assembling or maintaining the SC central region following exogenous DSBs. 15, 18, 21, and 17 gonad arms from two biological repeats were analyzed for wild type, wild type + IR (60Gy), syp-4pd, and syp-4pd + IR (60Gy). Scale bar, 3 μm. See also Figure S2D.

SYP-4 S447 phosphorylation plays a role in DSB repair pathway choice

To further analyze the role of SYP-4 S447 phosphorylation in DSB repair we assessed wild-type and syp-4pd mutant worms exposed to γ-IR and scored the number of eggs laid in 48 hours as a readout of sterility and the levels of embryonic lethality and males as a readout for increased meiotic chromosome nondisjunction (Supplemental Table 1 and Data S1E). The analysis was not extended beyond 48 hrs because most of the eggs laid by adults older than 3 days are unfertilized. IR treatment significantly increased the level of embryonic lethality detected in syp-4pd mutants compared to wild type (P<0.0001 by the Fisher’s exact test). Moreover, syp-4pd mutants segregated significant numbers of Dumpy (Dpy) animals after irradiation (P<0.0001 by the Fisher’s exact test), which can be a consequence of chromosome non-disjunction (Figure 4A and Data S1F;23,24). Indeed, analysis of DAPI-stained chromosomes in oocytes at diakinesis from syp-4pd mutants revealed an increase in the levels of chromosomes with morphological abnormalities (Figure S3A–B and Data S1G). This included an increase in the number of aberrant attachments (fusions) between chromosomes (Figure 4B and Figure S3) that correlated with a significant decrease in the number of DAPI-stained bodies detected (Figure 4C and Data S1H). Analysis of lig-4 single and syp-4pd;lig-4 double mutants lacking DNA ligase IV that is required for NHEJ repair25, revealed that both the levels of Dpy progeny and the chromosome fusions were dependent on LIG-4 (Figure 4A–C, Figure S3, Data S1E–H). This change in DSB repair pathway choice may not stem indirectly from the absence of a full SC, but likely from lack of phosphorylated SYP-4, as determined by analysis of the levels of Dpy progeny and chromosome fusions in wild type and lig-4 worms undergoing partial SYP-1 depletion by RNAi21 (Figure 4A–C and Figure S3A–B). RNAi conditions resulting in a 56% reduction in SYP-1 levels and a discontinuous SC (Figure S3C) in either a wild type or lig-4 mutant background resulted in similar levels of Dpy progeny (0.5 % and 0.6%, respectively, P=0.7820 by Fisher’s exact test) and chromosome fusions (1.1% and 1.6%, respectively, P>0.999) after IR treatment. These data support a role for phosphorylation of SYP-4 at S447 in DSB repair pathway choice by promoting repair via the HR pathway and/or warding off repair via the NHEJ pathway.

Figure 4. SYP-4 phosphorylation at S447 maintains CO patterning and prevents repair by NHEJ.

Figure 4.

(A) Histogram showing an increase in the percentage of Dpy animals seen among the offspring of syp-4pd mutants following exposure to 60 Gy of γ-IR (+IR) compared to wild type, lig-4, and syp-4pd;lig-4 (+/−IR). **** Indicates P<0.0001 by the Fischer’s exact test. No significant difference observed comparing the number of Dpy offspring from WT;syp-1(RNAi) and lig-4;syp-1(RNAi) animals following exposure to IR (P=0.7820). (B) Histogram shows an increase in the percentage of chromosome fusions detected in diakinesis oocytes in syp-4pd mutants + IR (indicated with yellow arrow in inset), which is significantly decreased in syp-4pd;lig-4 double mutants. No significant difference observed comparing the number of chromosome fusions detected in WT and lig-4 worms treated with syp-1(RNAi) + IR (P>0.9999 by Fisher’s exact test). DAPI morphology 6 hours post-IR (60Gy) in wild type, syp-4 pd, lig-4, syp-4 pd;lig-4, WT;EV (empty vector), lig-4;EV, WT;syp-1(RNAi), and lig-4;syp-1(RNAi). **** Indicates P<0.0001 by the Fisher’s exact test. At least 30 oocytes were scored for each genotype/condition from at least two biological repeats. (C) Histogram shows the number of DAPI-stained bodies observed in diakinesis oocytes for the indicated genotypes. Wild-type, lig-4, syp-4pd;lig-4, WT;EV, lig-4;EV, WT;syp-1(RNAi), and lig-4;syp-1(RNAi) worms show 6 DAPI-stained bodies that correspond to 6 pairs of attached homologs. In contrast, oocytes with either 5 or 4 DAPI-stained bodies were detected in syp-4pd mutant worms + or − IR. At least 30 oocytes were scored for each genotype from at least two biological repeats. ****Indicates P<0.0001 by the two tailed Mann-Whitney test, 95% C.I. (D) Diagram depicting pachytene nuclei with synapsed chromosomes (magenta tracks) following DSB formation. We propose that ATM-1/ATL-1-dependent phosphorylation of SYP-4 at S447, in response to endogenous (SPO-11-dependent) DSBs and either exogenous (IR-induced) or elevated levels of SPO-11-dependent DSBs, is required for the architectural integrity of the central region of the SC following DSB formation and ensuring repair by homologous recombination and subsequent accurate chromosome segregation. While a discontinuous SC was only observed following IR treatment, increased crossovers (COs) have been linked to attenuated CO interference following partial depletion of SC central region proteins resulting in SC discontinuities21. Therefore, the elevated COs observed following SPO-11-dependent DSBs in syp-4pd mutants could be due to a cytologically undetectable loss of SC integrity. Regardless, phosphorylated SYP-4 at S447 ensures maintenance of crossover interference and wards off repair via NHEJ. Failure to phosphorylate SYP-4 results in increased COs and NHEJ resulting in abnormal chromosome morphology and increased chromosome nondisjunction. See also Figure S3 and Data S1E–H.

DISCUSSION

Transmission of accurate genetic information relies on the precise repair of DNA damage within the germline. HR is favored during meiosis, while alternate DSB repair pathways that use sister chromatids as repair templates or NHEJ are suppressed1. However, in the absence of synapsis, in case of impaired HR, or in response to unscheduled or excessive damage, alternate DSB repair pathways can be activated26–30. In this study, we have found a DNA damage-dependent phosphorylation site on the SYP-4 protein that participates in a novel regulatory mechanism required for the architectural integrity of the SC by either reassembling or maintaining an assembled central region of the SC following DSB formation and ensuring DSB repair via HR to prevent repair by the NHEJ pathway (Figure 4D). A similar mechanism may also be present in humans. Since a coiled-coil domain is located 37 amino acids upstream of the phosphorylation site at the C-terminal end of SYP-420, we examined whether the position of predicted phosphorylation sites is conserved relative to the position of the coiled-coil domains found near the C-terminal end in the potential human orthologs of SYP-4. Using PHOSIDA, GPS 3.0, NetPhos 3.1, and PPSP, we analyzed SYCP1, SYCE1, SYCE2, SYCE3, TEX12, and SIX6OS130,31. SYCP1 showed the highest prediction score for phosphorylation by ATM kinase at Serine 817 (S817), which is near a coiled-coil domain proximal to the C-terminal end spanning amino acids 662–80132. A genetic variation exists in the human population at position 819 (T819A), adjacent to the S/TQ site, which is preferentially phosphorylated by the ATM/ATR kinases33.

DSBs activate DNA damage checkpoint pathways, which are dependent on ATM/Tel1 and ATR/Mec1 in mammals and S. cerevisiae, respectively34,35. Checkpoint kinases have been implicated in controlling CO formation and distribution, synapsis checkpoints, homolog pairing, and meiotic chromosome segregation36,37. Here we show that the S447 site in SYP-4 is phosphorylated in response to IR-induced DSBs and that this phosphorylation is substantially reduced by the removal of both ATM-1/ATM and ATL-1/ATR checkpoint kinases.

The SC is a dynamic structure that ensures CO formation3,38. Phosphorylation of central region components of the SC in C. elegans has been recently reported to influence changes in SC dynamics and recombination during meiosis8,39. Furthermore, both in worms and plants central region components of the SC can impose CO interference which limits the formation of closely spaced COs 21,40,41. We found a significant difference in CO number in syp-4pd mutants compared to wild type, suggesting that phosphorylation of SYP-4 at S477 may play a role in the regulation of CO interference.

Unlike in many other organisms SC assembly is DSB-independent in C. elegans18,42. Surprisingly, we found that DSB formation is required for phosphorylation of SYP-4. In spo-11 mutants that are defective in DSB formation, SYP-4 is no longer phosphorylated at the S477 site. However, it remains to be determined if DSB formation is sufficient to achieve SYP-4 phosphorylation or whether progression through the repair pathway is a trigger for this post-translational regulation. Exogenous breaks generated by γ-IR could induce SYP-4 phosphorylation at S477 and we found that the integrity of the central region of the SC was impaired in syp-4pd mutants only after γ-IR exposure. The lower levels of endogenous DSBs produced by SPO-11 compared to the elevated levels of DSBs generated by γ-IR exposure may explain the lack of obvious SC architectural integrity defects in syp-4pd mutants -IR.

The SC has been proposed to locally disassemble in the vicinity of IR-induced DSB sites to accommodate HR-mediated repair using the sister chromatid, followed by resynapsis4. However, this SC rearrangement was only detected in late pachytene and resulted from alterations at the chromosome axes. In contrast, our results show that axis morphogenesis is normal in syp-4pd mutants although the integrity of the SC’s central region was impaired in mid-pachytene after γ-IR-treatment. This suggests that phosphorylation of SYP-4 at S447 plays an important role either in the rearrangement (reassembly) or in the maintenance of the assembled central region of the SC following DSB formation and may involve a different mechanism than previously described. After IR-induced DNA damage, pSYP-4 signal extends along most of the length of the SC. Therefore, it is unlikely that the phosphorylation itself is directly implicated in the localized de-synapsis observed by Couteau and Zetka (2011) as it is not restricted to the DSB sites. It is possible that phosphorylated SYP-4 acts as a licensing factor for SC reassembly. Alternatively, SYP-4 phosphorylation may act to preserve the architectural integrity of the assembled SC at and around DSB sites to tolerate and/or accommodate recombination complexes without the need for SC disassembly. We also cannot rule out the possibility that regulation of the chromatin environment contributes to this process. In fact, Couteau and Zetka (2011) demonstrated that the germlines from irradiated wild-type worms show reduction of H2AK5ac and axis separation at late pachytene and that restoration of H2AK5ac levels requires ATM-1 and correlates with resynapsis.

SYP-4 is likely one of several targets for DDR kinases, which could result in functional redundancy. A recent study found that ATM/ATR-dependent regulation of SYP-1 only affects nuclei in very late pachytene11. Moreover, syp-1pd mutants exhibited phenotypes distinct from those we observe in syp-4pd mutants, suggesting separate functions resulting from ATM/ATR-dependent post-translational modification of these different SC central region components.

Meiotic DSBs are repaired preferentially by HR because it is the only repair pathway that forms COs to guarantee genomic integrity in the resulting gametes. While many factors promoting HR have been described, how alternative repair pathways are suppressed in the germline remains incompletely understood1. When HR is impaired, canonical NHEJ (c-NHEJ) has a well-demonstrated role in meiotic DSB repair2. However, it remains unclear whether c-NHEJ competes with HR, coordinates with the HR machinery, or simply operates when HR is compromised. Our data suggest that phosphorylation of SYP-4 at S447 participates in DSB repair pathway choice. Phosphorylation of SYP-4 may act as a signal to establish/reinforce the HR repair bias operating during meiosis. Alternatively, this post-translational modification may change the chromatin environment, which can influence repair pathway choice 43. We propose that when phosphorylation of S447 in SYP-4 is abrogated, repair of meiotic DSBs is driven toward the NHEJ pathway, which explains the reduction in aberrant chromosome morphology and rates of aneuploidy observed in the syp-4pd;lig-4 mutant (Figure 4D).

We hypothesize that ATM-1/ATL-1-dependent phosphorylation of SYP-4, in response to both exogenous and programmed meiotic DSBs, is a new and possibly conserved regulatory mechanism that promotes: 1) architectural integrity of the central region of the SC to accommodate the DSB repair process, and 2) DNA repair pathway choice.

STAR METHODS

LEAD CONTACT

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Monica P. Colaiacovo (mcolaiacovo@genetics.med.harvard.edu).

MATERIALS AVAILABILITY

Worm strains and the pSYP-4 (S447) antibody are available for sharing.

DATA AND CODE AVAILABILITY

This study did not generate/analyze datasets/code.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

C. elegans strains

C. elegans strains were cultured at 20°C under standard conditions and the N2 Bristol strain was used as the wild-type background. The following mutations and chromosome rearrangements were used: LG I: syp-4(rj53 (S447A) I/ hT2 [bli-4(e937) let-?(q782) qIs48] (I;III), syp-4(rj53 (S447A) I; lig-4(ok716) III, syp-4(tm2713) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III), atm-1(gk186), atm-1(gk186) I;atl-1(tm183)V, LG III: lig-4(ok716) III, LG IV: spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). LG V: atl-1(tm183).

METHODS DETAILS

Antibodies

Phospho-specific antibodies against S447 in SYP-4 were produced by injecting rabbits with the synthetic peptide AALpSQEQEPEIVEKC (GenScript). Polyclonal pS447 antibodies were affinity purified by binding to a column containing the phospho-peptide. Specificity of the antibodies was validated by absence of staining in germlines of worms carrying the S447A mutation in SYP-4.

Primary antibodies were used at the following dilutions for immunofluorescence: rabbit α-pSYP-4(S447) (1:100), rabbit α-SYP-1 (1:200; 16), guinea pig α-HTP-3 (1:400; 44), rabbit α-RAD-51 (1:10,000; Novus Biological SDI), guinea pig α-ZHP-3 (1:500; 45), and rabbit α-SYP-4 (1:100; 20). The following secondary antibodies from Jackson ImmunoResearch were used: α-rabbit Cy3 (1:200) and α-guinea pig Alexa 488 (1:500). Vectashield containing 1μg/μl of DAPI from Vector Laboratories was used as a mounting media and anti-fading agent.

Immunofluorescence and imaging

Whole-mount preparation of dissected gonads and immunostaining procedures were performed as in46. Immunofluorescence images were captured with an IX-70 microscope (Olympus) fitted with a cooled CCD camera (CH350; Roper Scientific) driven by the Delta Vision system (Applied Precision). 60X and 100X lenses were used for images in this study. Optical sections were collected at 0.20 μm increments and deconvolved using the SoftWorx 3.0 deconvolution software from Applied Precision.

Irradiation experiments

Wild type, syp-4pd and spo-11 mutant adult animals (~18 to 24 hours post-L4 stage) were irradiated with 60 Gy from a Cs137 source. Irradiated and untreated control worms were dissected 2 hours post-irradiation for immunostaining. For the DAPI morphology analysis, the gonads were dissected 6 hours post irradiation.

For mass spectrometry, young adult worms were irradiated with 15 Gy using an IBL 637 cell irradiator. Nuclei were isolated from untreated controls and irradiated worms 15 minutes after IR exposure.

Germ cell apoptosis

Adult hermaphrodite (~18 hours post-L4) animals were scored for germ cell apoptotic bodies using Acridine Orange as in47. Statistical comparisons were conducted using the two-tailed Mann-Whitney test, 95% C.I.

Generation of syp-4 phosphodead mutants by CRISPR/Cas9 genome editing

To generate a phosphodead syp-4 mutant, serine 447 (S447A) was mutated to alanine. syp-4(S447A) mutant worms were generated by CRISPR/Cas9 as in48 with the only exception being that Cas9 protein was purchased from PNA Bio (CP01–200) and used in the injection mix at a final concentration of 1.25 µg/µl. We used the sgRNA recognition site GATCTCTGGTTCTTGTTCCT and the following repair template: AAATTGAGCAACCATCTGTATTCAAGGACATTCTAGCCACGGAGCAaGCTGC ACTCgCtCAGGAACAAGAACCAGAGATCGTTGAGAAGCAGGCAGACAATGAT GTTCAGTTTGT (lower case letters correspond to the changes made).

Partial RNA interference (RNAi) by feeding

Partial RNAi was carried out as previously described21 with syp-1 and pL4440 (empty vector, EV, control) clones from the Ahringer library49. Synchronized L1-stage larvae were placed on NGM+Carb+IPTG plates freshly seeded with E. coli HT115 cells containing either a fragment of the syp-1/F26D2.2 gene in the L4440 vector, or the empty vector. Worms were grown at 20 °C and were irradiated (60 Gy) 24 hours post-L4 stage. Dissections for DAPI morphology analysis were performed 6 hours after IR and evaluation of Dpy progeny was assessed 24 and 48 hours after IR.

Phospho-enrichment mass spectrometry

Frozen nuclear pellets from irradiated (one pellet) and non-irradiated (one pellet) worms were solubilized in 250µL of 8M urea, 20mM HEPES containing phosphatase inhibitors (sodium orthovanadate 100mM, sodium fluoride 500mM, glycerol phosphate 1M, disodium pyrophosphate 250mM). Total protein concentration was determined by Qubit Technology to be 5.2 µg/µL irradiated sample; 6.0µg/µL non-irradiated sample.

Samples were thawed at room temperature on an Eppendorf mixer. Protein amount was normalized to 500µg and made up to 1mL in 8M urea, 20mM HEPES. Sample disulfide bridges were reduced by addition of 10mM dithiothreitol and incubated for 15 minutes at room temperature in the dark with mixing. Reduced cysteine residues were capped by addition of 25mM iodoacetamide and incubated for 15 minutes at room temperature in the dark. Addition of 3mL of 20mM HEPES reduced the urea concentration to below 2M, thereby permitting trypsin digestion. 320µL of immobilized TPCK trypsin bead slurry (P/N 20230 Thermo Scientific) was washed three times with 20mM HEPES to remove storage buffers then split evenly between the two samples. Samples were incubated for 18 hours at 37°C with mixing. Digestion was halted by acidifying the samples with pH <4 by addition of 1% trifluoroacetic acid (TFA). Samples were centrifuged to pellet the trypsin beads and the supernatant, containing peptides, was recovered.

Peptides were desalted by reversed-phase chromatographic cartridges (Oasis HLB, Waters Corporation). Cartridges were activated in neat acetonitrile (MeCN) then washed twice with 2% MeCN containing 0.1% TFA. Samples were loaded and permitted to bind to the column slowly under vacuum. Bound peptides were washed twice with 2% MeCN containing 0.1% TFA and then eluted with 1mL of 1M glycolic acid in 50% MeCN, 5% TFA.

Phosphopeptides were enriched from the eluted peptide solution through use of titanium dioxide beads (TiO2, Titansphere, 5µm, GL Sciences Inc.) as previously described50. Briefly, 50µL of titanium dioxide beads in 1% TFA was added to each sample then incubated for 5 minutes with agitation. Glygen filter-tips were washed with neat MeCN then the sample was loaded into the tips. The tips were centrifuged and flow-through was discarded leaving the titanium beads with bound peptides above the filter. Samples were washed with 1M glycolic acid in 80% MeCN, 5% TFA to remove non-phosphorylated peptides (discarded) and then washed with 100mM ammonium acetate in 25% MeCN to remove acidic non-phosphorylated peptides (discarded). Any remaining salts or non-phosphorylated peptides were removed by washing with 10% MeCN in triplicate. Phosphorylated peptides were eluted by four successive 50µL volumes of 10% MeCN, 5% ammonium hydroxide solution into a 1.5mL Protein Lo-bind Eppendorf. Eluted phosphopeptides were dried under vacuum in a speed vac concentrator.

Dried phosphopeptides were solubilized in 25µL of 0.1% TFA and transferred to a hydrophobic insert tube within an autosampler vial. Both samples were loaded into a temperature controlled autosampler within an UltiMate 3000 RSLC nanoLC instrument coupled online to an LTQ-Orbitrap Velos mass spectrometer (Thermo Scientific). Sample loading was achieved with a flow of 8µL/min onto a trap column (Thermo Scientific Acclaim Pepmap 100; 100µm internal diameter, 2cm length, C18 reversed-phase material, 5µm diameter beads, 100Å pore size) in 98% water, 2% MeCN, 0.1% TFA. Peptides were then eluted on-line to an analytical column (Thermo Scientific Acclaim Pepmap RSLC; 75µm internal diameter, 25cm length, C18 reversed-phase material, 2µm diameter beads, 100Å pore size) and separated using a gradient with conditions: initial 5 minutes with 4% B (96% A), then 120 minute gradient 4–45% B, then 10 minute isocratic at 100% B, then 5 minute isocratic at 4% B (solvent A: 98% water, 2% MeCN, 0.1% formic acid; solvent B: 20% water, 80% MeCN, 0.1% formic acid). The LTQ-Orbitrap Velos system acquired full scan survey spectra (m/z 350 to 1500) with a 15,000 resolution at m/z 400. A maximum of the 10 most abundant multiple charged ions registered in each survey spectrum were selected in a data-dependent manner, fragmented by collision induced dissociation (multistage activation enabled for neutral loss of phosphate group) with a normalized collision energy of 35% and scan in the LTQ ion trap (m/z 50 to 2000). In the data-dependent acquisition, a dynamic exclusion was enabled (exclusion list restricted to 500 entries, 60 second duration and 10 ppm mass window). Both samples were injected in technical triplicate on the mass spectrometer.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analyses were performed using Prim 8.0 (Graphpad). The statistical analysis details (statistical test used, n value, mean, SD, SEM, and confidence intervals) for each experiment are described in the figure legends and Data S1. No data were excluded from analysis and the experiments were not randomized. Statistical significance was determined using P values.

RAD-51 Time Course Analysis

Quantitative analysis of RAD-51 foci/nucleus was performed as in3. The number of nuclei scored per zone (n) for a given genotype is indicated in Data S1C. Statistical comparisons between genotypes were conducted using the two-tailed Mann-Whitney test, 95% C.I.

Phospho-enrichment mass spectrometry analysis

Data was processed using the MaxQuant51 software platform (v1.6.10.43), with database searches carried out by the in-built Andromeda search engine against the Uniprot C. elegans database (version 20210628, number of entries: 26,621). A reverse decoy search approach was used at a 1% false discovery rate (FDR) for both peptide spectrum matches and protein groups. Search parameters included: maximum missed cleavages set to 3, fixed modification of cysteine carbamidomethylation and variable modifications of methionine oxidation, protein N-terminal acetylation and serine, threonine, tyrosine phosphorylation. Label-free quantification was enabled with an LFQ minimum ratio count of 2. ‘Match between runs’ function was used with match and alignment time limits of 0.7 and 20 minutes respectively. Site intensity output table further processed in Perseus52 for data transformation and statistical testing. Normalized intensity was calculated as site intensity divided by median of per sample intensity.

Evaluation of SYP-1 partial depletion

Normalized fluorescence levels were evaluated from SYP-1 and HTP-3 co-immunostained slides of control (EV) and syp-1 partial RNAi gonads imaged with the Delta Vision system (Applied Precision). For image acquisition, exposure time for SYP-1 and HTP-3 channels were kept the same for both EV and syp-1(RNAi). Quantification of fluorescence was performed in full projected deconvolved images using Fiji (Image J)53. Fluorescence was measured in individual nuclei traced using the Polygon tool in Fiji. Nuclei were assessed only if they did not overlap with any other nuclei in the projected image. The SYP-1:HTP-3 ratio was calculated for every nucleus and then averaged.

Data S1. Raw data and statistics. Related to Figures 2C–E, 4A–C and S3A,B.

(A) Total brood size counting. The total number of eggs laid as well as the percentage of embryonic lethality are shown for wild-type and the syp-4pd mutant (n=15 and 10, respectively, number of late-L4 worms for which entire brood sizes were assessed). (B) Apoptosis analysis. Number of acridine orange-stained nuclei detected in wild-type and syp-4pd gonads (n=59 and 65, respectively) is shown. (C) RAD-51 foci counting analysis. The number of RAD-51 foci per nucleus quantified in each zone (Z1 to Z7) of the gonad is shown as well as the mean, SEM, and n values. Z1-Z2= premeiotic tip, Z3= leptotene/zygotene, Z4= early pachytene, Z5-Z6= mid-pachytene, and Z7= late pachytene. (D) ZHP-3 analysis. The number of ZHP-3 foci detected per nucleus is shown as well as the mean, SEM, and n values. (E) Number of fertilized eggs laid, hatched, the number of progeny that reached adulthood, and the frequency of male progeny laid by the indicated genotypes and conditions in a 48-hour window following IR treatment. Mean, SEM, and n values are indicated for each genotype and condition. (F) Number of Dpy progeny observed in the 48-hour window for the indicated genotypes and conditions. (G) Analysis of the morphology of DAPI-stained bodies. Table showing the different categories of chromosomal abnormalities observed in the indicated genotypes and conditions. Number of oocytes analyzed from at least three biological replicates are indicated. (H) Number of DAPI-stained bodies observed per oocyte in each genotype and condition. Mean, n values and statistics are shown.

Supplementary Material

1
2

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit anti-pSYP-4(S447) This paper N/A
Rabbit anti-SYP-1 [16] N/A
Guinea pig anti-HTP-3 [44] N/A
Rabbit anti-RAD-51 Novus Biological (SDI) Cat# 29480002; RRID:AB_2616441
Guinea pig anti-ZHP-3 [45] N/A
Rabbit anti-SYP-4 [46] N/A
Donkey anti-guinea pig Alexa488 Jackson Immunoresearch Cat# 706-545-148; RRID: AB_2340472
Donkey anti-rabbit Cy3 Jackson Immunoresearch Cat# 711-165-152; RRID: AB_2307443
Bacterial and virus strains
E. coli: Strain OP50-1 Caenorhaditis Genetics Center WormBase: OP50-1
E. coli: Strain HT115 Caenorhaditis Genetics Center WormBase: HT115
Ahringer RNAi library clone: pL4440-F26D2.2 Source Bioscience N/A
Ahringer RNAi library clone: pL4440 Source Bioscience N/A
Biological samples
Chemicals, peptides, and recombinant proteins
Cas9 protein PNA Bio Cat#CP01-200
4,6-Diamidino-2-phenylindole dihydrochloride DAPI Thermo Fisher Scientific Cat# D1306
VectaShield Vector Laboratories Cat# H-1000
Critical commercial assays
Deposited data
Experimental models: Cell lines
Experimental models: Organisms/strains
N2 (wild type) https://cgc.umn.edu/strain/N2 WB ID: WBStrain00000001
CV837: syp-4(rj53 (S447A)I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) This study N/A
CV847:syp-4(rj53 (S447A)I;lig-4(ok716)III This paper N/A
CV87:syp-4(tm2713) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III) [46] WormBase ID: WBStrain00005203
VC381:atm-1(gk186) https://cgc.umn.edu/strain/VC381 WB Strain: VC381; WormBase: WBVar00145593
DW101:atl-1(tm853) IV/ nT1[qls50] (IV;V) https://cgc.umn.edu/strain/DW101 WB Strain: DW101; WormBase: WBVar00249879
GIN105: atm-1(gk186) I; atl-1(tm853) IV/ nT1[qls50] (IV;V) [11] N/A
lig-4(ok716) III
AV106:spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V) [18] WB strain: AV106; WB ID:  WBVar00091464
Oligonucleotides
Genotyping primer: lig-4ok716_F:TGCAAATGTGAGTTTTGGAATTCAG This paper N/A
Genotyping primer: lig-4ok716_R:GCGATGGCTTGAGCTGTTTT This paper N/A
Genotyping primer: syp-4S447_F:AACCGCGAAATCTTCCTTCT This paper N/A
Genotyping primer: syp-4S447_R:ACCGTTTTCGCTCATCACTT This paper N/A
Recombinant DNA
Software and algorithms
SoftWorRx GE Healthcare Life Sciences N/A
ImageJ Fiji [54] https://imagej.net/Fiji
Prism 8 GraphPad https://graphpad.com/scientific-software/prism/
 
Other

HIGHLIGHTS.

  • Phosphorylation at S447 on SC component SYP-4 is DSB- and ATM/ATR-dependent

  • SYP-4 phosphorylation at S447 regulates DSB repair and CO patterning

  • SC architectural integrity after exogenous DSBs requires SYP-4 phosphorylation

  • SYP-4 phosphorylation acts in DSB repair pathway choice by warding off NHEJ repair

ACKNOWLEDGEMENTS

We are grateful to the Caenorhabditis Genetics Center for providing strains. We thank members of the Colaiácovo lab for critical reading of this manuscript. This work was supported by grant CIHR 119468 to MZ, a MRC core-funded grant to EM-P, and by National Institutes of Health grant R01GM072551 to MPC.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

DECLARATION OF INTERESTS

The authors declare no competing interests.

INCLUSION AND DIVERSITY

We support inclusive, diverse, and equitable conduct of research.

REFERENCES

  • 1.Ranjha L, Howard SM, and Cejka P (2018). Main steps in DNA double-strand break repair: an introduction to homologous recombination and related processes. Chromosoma 127, 187–214. [DOI] [PubMed] [Google Scholar]
  • 2.Clejan I, Boerckel J, and Ahmed S (2006). Developmental modulation of nonhomologous end joining in Caenorhabditis elegans. Genetics 173, 1301–1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Colaiácovo MP, MacQueen AJ, Martinez-Perez E, McDonald K, Adamo A, La Volpe A, and Villeneuve AM (2003). Synaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination. Developmental Cell 5, 463–474. [DOI] [PubMed] [Google Scholar]
  • 4.Couteau F, and Zetka M (2011). DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly. Dev Cell 20, 353–363. [DOI] [PubMed] [Google Scholar]
  • 5.Voelkel-Meiman K, Moustafa SS, Lefrançois P, Villeneuve AM, and MacQueen AJ (2012). Full-length synaptonemal complex grows continuously during meiotic prophase in budding yeast. PLoS Genet 8, e1002993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Machovina TS, Mainpal R, Daryabeigi A, McGovern O, Paouneskou D, Labella S, Zetka M, Jantsch V, and Yanowitz JL (2016). A surveillance system ensures crossover formation in C. elegans. Current Biology 26, 2873–2884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rog O, Köhler S, and Dernburg AF (2017). The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors. Elife 6, e21455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nadarajan S, Lambert TJ, Altendorfer E, Gao J, Blower MD, Waters JC, and Colaiácovo MP (2017). Polo-like kinase-dependent phosphorylation of the synaptonemal complex protein SYP-4 regulates double-strand break formation through a negative feedback loop. eLife 6, e23437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pattabiraman D, Roelens B, Woglar A, and Villeneuve AM (2017). Meiotic recombination modulates the structure and dynamics of the synaptonemal complex during C. elegans meiosis. PLOS Genetics 13, e1006670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gao J, and Colaiácovo MP (2018). Zipping and unzipping: protein modifications regulating synaptonemal complex dynamics. Trends in Genetics 34, 232–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Garcia-Muse T, Galindo-Diaz U, Garcia-Rubio M, Martin JS, Polanowska J, O’Reilly N, Aguilera A, and Boulton SJ (2019). A meiotic checkpoint alters repair partner bias to permit inter-sister repair of persistent DSBs. Cell Rep 26, 775–787.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xue Y, Ren J, Gao X, Jin C, Wen L, and Yao X (2008). GPS 2.0, a tool to predict kinase-specific phosphorylation sites in hierarchy. Mol Cell Proteomics 7, 1598–1608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Blom N, Sicheritz-Pontén T, Gupta R, Gammeltoft S, and Brunak S (2004). Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 4, 1633–1649. [DOI] [PubMed] [Google Scholar]
  • 14.Gnad F, Gunawardena J, and Mann M (2011). PHOSIDA 2011: the posttranslational modification database. Nucleic Acids Res 39, D253–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gnad F, Young A, Zhou W, Lyle K, Ong CC, Stokes MP, Silva JC, Belvin M, Friedman LS, Koeppen H, et al. (2013). Systems-wide analysis of K-Ras, Cdc42, and PAK4 signaling by quantitative phosphoproteomics. Mol Cell Proteomics 12, 2070–2080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.MacQueen AJ, Colaiácovo MP, McDonald K, and Villeneuve AM (2002). Synapsis-dependent and -independent mechanisms stabilize homolog pairing during meiotic prophase in C. elegans. Genes Dev 16, 2428–2442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Smolikov S, Eizinger A, Schild-Prufert K, Hurlburt A, McDonald K, Engebrecht J, Villeneuve AM, and Colaiácovo MP (2007). SYP-3 restricts synaptonemal complex assembly to bridge paired chromosome axes during meiosis in Caenorhabditis elegans. Genetics 176, 2015–2025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Dernburg AF, McDonald K, Moulder G, Barstead R, Dresser M, and Villeneuve AM (1998). Meiotic recombination in C. elegans initiates by a conserved mechanism and is dispensable for homologous chromosome synapsis. Cell 94, 387–398. [DOI] [PubMed] [Google Scholar]
  • 19.Schumacher B, Hofmann K, Boulton S, and Gartner A (2001). The C. elegans homolog of the p53 tumor suppressor is required for DNA damage-induced apoptosis. Curr Biol 11, 1722–1727. [DOI] [PubMed] [Google Scholar]
  • 20.Smolikov S, Schild-Prüfert K, and Colaiácovo MP (2009). A yeast two-hybrid screen for SYP-3 interactors identifies SYP-4, a component required for synaptonemal complex assembly and chiasma formation in Caenorhabditis elegans meiosis. PLoS Genet 5, e1000669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Libuda DE, Uzawa S, Meyer BJ, and Villeneuve AM (2013). Meiotic chromosome structures constrain and respond to designation of crossover sites. Nature 502, 703–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hillers KJ, and Villeneuve AM (2003). Chromosome-wide control of meiotic crossing over in C. elegans. Current Biology 13, 1641–1647. [DOI] [PubMed] [Google Scholar]
  • 23.Hodgkin J, Horvitz HR, and Brenner S (1979). Nondisjunction mutants of the nematode Caenorhabditis elegans. Genetics 91, 67–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Meneely PM, and Wood WB (1984). An autosomal gene that affects X chromosome expression and sex determination in Caenorhabditis elegans. Genetics 106, 29–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lieber MR, Ma Y, Pannicke U, and Schwarz K (2003). Mechanism and regulation of human non-homologous DNA end-joining. Nat Rev Mol Cell Biol 4, 712–720. [DOI] [PubMed] [Google Scholar]
  • 26.Nairz K, and Klein F (1997). mre11S--a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis. Genes Dev 11, 2272–2290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Smolikov S, Eizinger A, Hurlburt A, Rogers E, Villeneuve AM, and Colaiácovo MP (2007). Synapsis-defective mutants reveal a correlation between chromosome conformation and the mode of double-strand break repair during Caenorhabditis elegans meiosis. Genetics 176, 2027–2033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lemmens BBLG, Johnson NM, and Tijsterman M (2013). COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining. PLoS Genet 9, e1003276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yin Y, and Smolikove S (2013). Impaired resection of meiotic double-strand breaks channels repair to nonhomologous end joining in Caenorhabditis elegans. Mol Cell Biol 33, 2732–2747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Macaisne N, Kessler Z, and Yanowitz JL (2018). Meiotic double-strand break proteins influence repair pathway utilization. Genetics 210, 843–856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Dunne OM, and Davies OR (2019). A molecular model for self-assembly of the synaptonemal complex protein SYCE3. J Biol Chem 294, 9260–9275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Seo EK, Choi JY, Jeong J-H, Kim Y-G, and Park HH (2016). Crystal structure of C-Terminal coiled-coil domain of SYCP1 reveals non-canonical anti-parallel dimeric structure of transverse filament at the synaptonemal complex. PLoS One 11, e0161379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Traven A, and Heierhorst J (2005). SQ/TQ cluster domains: concentrated ATM/ATR kinase phosphorylation site regions in DNA-damage-response proteins. BioEssays 27, 397–407. [DOI] [PubMed] [Google Scholar]
  • 34.Aguilera A, and García-Muse T (2013). Causes of genome instability. Annu Rev Genet 47, 1–32. [DOI] [PubMed] [Google Scholar]
  • 35.Ciccia A, and Elledge SJ (2010). The DNA damage response: making it safe to play with knives. Mol Cell 40, 179–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.MacQueen AJ, and Hochwagen A (2011). Checkpoint mechanisms: the puppet masters of meiotic prophase. Trends Cell Biol 21, 393–400. [DOI] [PubMed] [Google Scholar]
  • 37.Lemmens BBLG, and Tijsterman M (2011). DNA double-strand break repair in Caenorhabditis elegans. Chromosoma 120, 1–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Saito TT, and Colaiácovo MP (2017). Regulation of crossover frequency and distribution during meiotic recombination. Cold Spring Harbor Symposia on Quantitative Biology 82, 223–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Sato-Carlton A, Nakamura-Tabuchi C, Chartrand SK, Uchino T, and Carlton PM (2018). Phosphorylation of the synaptonemal complex protein SYP-1 promotes meiotic chromosome segregation. The Journal of Cell Biology 217, 555–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Capilla-Pérez L, Durand S, Hurel A, Lian Q, Chambon A, Taochy C, Solier V, Grelon M, and Mercier R (2021). The synaptonemal complex imposes crossover interference and heterochiasmy in Arabidopsis. Proc Natl Acad Sci U S A 118, e2023613118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.France MG, Enderle J, Röhrig S, Puchta H, Franklin FCH, and Higgins JD (2021). ZYP1 is required for obligate cross-over formation and cross-over interference in Arabidopsis. Proc Natl Acad Sci U S A 118, e2021671118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Baudat F, and de Massy B (2007). Regulating double-stranded DNA break repair towards crossover or non-crossover during mammalian meiosis. Chromosome Res 15, 565–577. [DOI] [PubMed] [Google Scholar]
  • 43.Kalousi A, and Soutoglou E (2016). Nuclear compartmentalization of DNA repair. Curr Opin Genet Dev 37, 148–157. [DOI] [PubMed] [Google Scholar]
  • 44.Goodyer W, Kaitna S, Couteau F, Ward JD, Boulton SJ, and Zetka M (2008). HTP-3 links DSB formation with homolog pairing and crossing over during C. elegans meiosis. Developmental Cell 14, 263–274. [DOI] [PubMed] [Google Scholar]
  • 45.Bhalla N, Wynne DJ, Jantsch V, and Dernburg AF (2008). ZHP-3 acts at crossovers to couple meiotic recombination with synaptonemal complex disassembly and bivalent formation in C. elegans. PLoS Genet 4, e1000235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lascarez-Lagunas LI, Herruzo E, Grishok A, San-Segundo PA, and Colaiacovo MP (2020). DOT-1.1-dependent H3K79 methylation promotes normal meiotic progression and meiotic checkpoint function in C. elegans. PLOS Genetics [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kelly KO, Dernburg AF, Stanfield GM, and Villeneuve AM (2000). Caenorhabditis elegans msh-5 is required for both normal and radiation-induced meiotic crossing over but not for completion of meiosis. Genetics 156, 617–630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Paix A, Folkmann A, Rasoloson D, and Seydoux G (2015). High efficiency, homology-directed genome editing in Caenorhabditis elegans using CRISPR-Cas9 ribonucleoprotein complexes. Genetics 201, 47–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, Kanapin A, Le Bot N, Moreno S, Sohrmann M, et al. (2003). Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. [DOI] [PubMed] [Google Scholar]
  • 50.Casado P, Bilanges B, Rajeeve V, Vanhaesebroeck B, and Cutillas PR (2014). Environmental stress affects the activity of metabolic and growth factor signaling networks and induces autophagy markers in MCF7 breast cancer cells. Mol Cell Proteomics 13, 836–848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tyanova S, Temu T, and Cox J (2016). The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat Protoc 11, 2301–2319. [DOI] [PubMed] [Google Scholar]
  • 52.Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, and Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods 13, 731–740. [DOI] [PubMed] [Google Scholar]
  • 53.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

Data Availability Statement

This study did not generate/analyze datasets/code.

RESOURCES