Skip to main content
NCBI home page
Bioactive Materials logoLink to Bioactive Materials
. 2022 Nov 9;23:45–52. doi: 10.1016/j.bioactmat.2022.10.002

Evaluation of DNA adduct damage using G-quadruplex-based DNAzyme

Yi Xiao a,b,c,∗, Haomin Yi b, Jingzhi Zhu b, Suhua Chen d, Guofang Wang b, Yilong Liao b, Yuanyuan Lei b, Liyin Chen a, Xingcai Zhang a,f,∗∗, Fangfu Ye c,e,∗∗∗
PMCID: PMC9650010  PMID: 36406255

Abstract

Toxicity assessment is a major problem in pharmaceutical candidates and industry chemicals development. However, due to the lack of practical analytical methods for DNA adduct analysis, the safety evaluation of drug and industry chemicals was severely limited. Here, we develop a DNAzyme-based method to detect DNA adduct damage for toxicity assessment of drugs and chemicals. Among 18 structural variants of G4 DNAzyme, EA2 DNAzyme exhibits an obvious DNA damaging effect of styrene oxide (SO) due to its unstable structure. The covalent binding of SO to DNAzyme disrupts the Hoogsteen hydrogen bonding sites of G-plane guanines and affects the formation of the G4 quadruplex. DNA damage chemicals reduce the peroxidase activity of the G4 DNAzyme to monitor the DNA adduct damage by disrupting the structural integrity of the G4 DNAzyme. Our method for genotoxic assessment of pharmaceutical candidates and industrial chemicals can elucidate the complex chemical pathways leading to toxicity, predict toxic effects of chemicals, and evaluate possible risks to human health.

Keywords: Toxicity assessment, DNAzyme, DNA adduct Damage, Styrene oxide, Pharmaceutical candidates

Graphical abstract

Image 1

Open in a new tab

Highlights

  • •

    We develop a DNAzyme-based method to detect DNA adduct damage for toxicity assessment of drugs and chemicals.

  • •

    Among 18 structural variants of G4 DNAzyme, EA2 DNAzyme exhibits obvious DNA damaging effect of styrene oxide (SO) due to its unstable structure. The covalent binding of SO to DNAzyme disrupts the Hoogsteen hydrogen bonding sites of G-plane guanines and affects the formation of G4 quadruplex.

  • •

    DNA damage chemicals reduce the peroxidase activity of G4 DNAzyme by disrupting the structural integrity of the G4 DNAzyme.

  • •

    Our method can predict toxic effects of chemicals, and evaluate possible risks to human health.

1. Introduction

Toxicity assessment is a major problem in pharmaceutical candidates and industry chemical development [[1], [2], [3]]. 1/3 of drug candidates fail due to toxicity issues until clinical testing, which gives rise to huge drug costs and human safety. Development of new chemicals for industries such as agriculture, cosmetics, or food processing have similar testing protocols. Toxicity bioassays or animal tests are commonly performed for toxicity assessment, but they rarely address specific chemical pathways of toxicity [6]. In vitro toxicity screening bioassays, such as cell-based toxicity assays, high-throughput screening approaches [7], and organ modeling approaches [[4], [5], [6]], supplement tools for predicting drug and chemical toxicity.

Toxic effects related to the DNA damages are referred to as genotoxicity, including oxidative damage and DNA adduct damage. DNA adducts could be considered as a biomarker of exposure, which leads to mutations and carcinogenesis [7]. Therefore, quantifying DNA adducts is valuable for assessing and evaluating the safety of exposure to drugs and industrial chemicals. Liquid chromatography-mass spectrometry (LC-MS) [8,9], immunoassay [10,11], radiolabeling techniques, and genomic sequencing [12] are widely used for DNA adduct analysis. However, they have some limitations, such as requirement for cumbersome sample preparation in LC-MS, the limited availability of antibodies in immunoassays, the risk of exposure to high radioactivity in radiolabeling techniques, and the limitation to certain lesions in sequencing-based analysis. A variety of electrochemiluminescence (ECL) [13,14], electrochemical (EC) [15] sensors, and LC−MS [[16], [17], [18]] methods were developed to screen and establish pathways of toxicity chemistry. However, there are multiple DNA adducts with trace amounts, which makes it difficult to quantify the total toxicity. Due to the lack of practical analytical methods for DNA adduct analysis, the safety evaluation of drug and industry chemicals was severely limited. Therefore, there remains an unmet need to develop new toxicity tests and to fully elucidate the pathways leading to toxicity.

G-quadruplexes (G4) are non-canonical nucleic acid structures, which are stabilized by Hoogsteen hydrogen bonds, G-stacking, and cation coordination [19]. Oxidative damage of guanine to 8-oxoguanine by reactive oxygen species in genomic DNA has been implicated with various human diseases [[20], [21], [22], [23], [24], [25]]. DNAzymes, which are DNA molecules with enzymatic activities [26], have emerged as an important class of sensors for metal ions. DNAzymes have attracted recent research efforts as catalytic labels for amplifying sensing events, as catalysts for the activation of DNA machines, and as building blocks for the assembly of nanostructures, and hemin/G-quadruplex as mimicking horseradish peroxidase [27,28]. The G-quadruplex/hemin DNAzyme exhibits superior peroxidase-like activity [29] and catalyzes the oxidation of ABTS, amplex red or luminol with H2O2. The G-quadruplex/hemin horseradish peroxidase mimicking DNAzyme is widely used in biosensors. Oxidative damage of guanine to 8-oxoguanine results in a partial and variable loss of peroxidase-like activity [30]. However, G-quadruplex DNAzyme has not been used in DNA adduct damage analysis for toxicity assessment of drugs and industrial chemicals.

Here, we develop a DNAzyme-based method to detect DNA adduct damage for toxicity assessment of drug and industrial chemicals. We investigate the mechanism of evaluation of DNAzyme-based DNA adduct damage system. As a proof of concept, we use styrene oxide (SO) as a model for DNA damage analysis based on the G4 DNAzyme-catalyzed peroxidation system. The covalent binding of SO to DNA disrupts the Hoogsteen hydrogen bonding sites of G-plane guanines and affects the formation of G4 structure. The change of G4 structure leads to the inhibition of DNAzyme peroxidase activity. G4 DNAzyme-catalyzed peroxidation system is feasible for DNA damage analysis, and applicable for a variety of methods. This methodology will provide a promising tool for genotoxic assessments of pharmaceutical candidates and industrial chemicals.

2. Materials and methods

2.1. Chemicals and materials

Styrene oxide (SO, 98%) is from Macklin. N-Nitrosodiethylamine (ND, 99.0%), atropine sulfate monohydrate (AS, 98.5%), chloramphenicol (CP, 98.0%), N, N′-Dicyclohexylcarbodiimide (DCC, 99.0%), selenium dioxide (SD, 99.0%), 2-Hydroxypyridine (2-HP, 97.0%), hexadecyltrimethylammonium chloride (CTAC, 97%), 1,10-Phenanthroline Monohydrate (1,10-PM, 98.0%), Mechlorethamine hydrochloride (HN2, 98%), Cyclophosphamide monohydrate (CTX, 97%), Busulfan (BU, 98%), cls-Dlammlneplatlnum dlchlorlde (DDP, 65%), Carboplatin (CBP, 98%), and Carmustine (BCNU, 98%) are from Aladdin. N-Bromosuccinimide (NBS, 97.0%) is from Bidepharm. Methyl sulfide (MS, 99.0%) is from damas-beta. 3-Aminobenzonitrile (3-AB, 98.0%) is from Energy Chemical. Coumarin (Co, 99%). Sodium chloride (NaCl, 99.5%), magnesium chloride hexahydrate (MgCl2·6H2O), 4-Morpholineethanesulfonic acid (MES, 99%), thioflavin T (ThT), 2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) ammonium salt (ABTS, 98%) and hemin are from Aladdin. Styrene (ST, 99.5%), sodium phosphate monobasic dihydrate (NaH2PO4·2H2O, 99.0%), sodium phosphate dibasic dodecahydrate (Na2HPO4·12H2O, 99.0%), potassium chloride (KCl, 99.5%), sodium acetate trihydrate (C2H3NaO2·3H2O, 99%), acetic acid (C3H6O2, 99.5%), and H2O2 (30%, v/v) are from Sinopharm Chemical Reagent Co., Ltd. Triton X-100, and 1 M Tris-HCl solution (pH 7.0 and 9.0) are from Sangon Biotech (Shanghai). Creatinine (Cr, 99%) is from Yuanye Bio-Technology Co., Ltd (Shanghai). Sterilized water is purchased from Hunan Kellen Pharmaceutical Co. Ultrapure water (>18.2 MΩ/cm) is prepared by a Milli-Q system (Millipore, Milford, MA, USA). DNAzyme sequences are from Sangon Biotech Co., Ltd (Shanghai), and their sequences are shown in Table 1. All DNAzyme samples are dissolved in Milli-Q water and quantified using the molar extinction coefficient value OD260 nm.

Table 1.

Sequences of different G4-DNAzyme variants.

Name Sequence (5′ to 3′)
T30695 GGGTGGGTGGGTGGGT
17-DNAzyme GGGTAGGGCGGGTTGGG
PS2.M GTGGGTAGGGCGGGTTGG
PS5.M GTGGGTCATTGTGGGTGGGTGTGG
AGRO100 GGTGGTGGTGGTTGTGGTGGTGGTGG
EA2 CGAGGTGGGTGGGTGGGA
EAD CTGGGTGGGTGGGTGGGA
EAD2 CTGGGAGGGAGGGAGGGA
EAD3 CTGGGCGGGCGGGCGGGA
EAD4 CTGGGTTGGGTTGGGTTGGGA
EAD6 CTGGGGTGGGGTGGGGTGGGGA
VEGF GGGCGGGCCGGGGGCGGG
c-Myc TGAGGGTGGGGAGGGTGGGGAA
c-Kit21 CGGGCGGGCGGCGGAGGGAGGGG
Cat TGGGTAGGGCGGGTTGGGAAA
T223 GGGTTGGGTTGGGTTTGGG
Telomere-G4 GGGTTAGGGTTAGGGTTAGGG
JF-G4 GGGTTAGGGACCTTCCTCCGCAATACTCCGGGTTAGGG
EA2-2 CGGGTGAGGTGGGTGGGA
EA2-3 CGGGTGGGTGAGGTGGGA
EA2-4 CGGGTGGGTGGGTGAGGA
EA2-T CGTGGTGGGTGGGTGGGA
EA2-C CGCGGTGGGTGGGTGGGA
EA2-G CGGGGTGGGTGGGTGGGA
EA2-2A CAAGGTGGGTGGGTGGGA
EA2-2C CCAGGTGGGTGGGTGGGA
EA2-2T CTAGGTGGGTGGGTGGGA
Open in a new tab

2.2. G4 DNAzyme-catalyzed peroxidation

Hemin is dissolved in DMSO (10 μM), and stored at −20 °C before use. DNA is dissolved in sterilized water and stored at 4 °C. Different concentrations of SO are dispersed in water before use. 5 × HEPES buffer solution (pH 7.4) contains 125 mM HEPES, 1 M NaCl, 250 mM KCl, and 62.5 mM MgCl2. 5 × PBS solution (pH 7.4) contains 25 mM PO43−, 50 mM KCl, 200 mM NaCl, and 12.5 mM MgCl2). 5 × MES solution (pH 7.4) contains 25 mM MES, 50 mM KCl, 200 mM NaCl, and 12.5 mM MgCl2).

5 μL different DNAzyme sequences (10 μM) and different concentrations of SO are mixed in 20 μL 5 × HEPES buffer. After incubation at 37 °C for 1 h, 10 μL hemin (10 μM) is added, and react for 0.5 h. The total amount of the system volume is 100 μL. The final concentration of G4 and hemin are 0.5 μM and 1 μM, respectively. The final concentrations of SO are 0, 0.1, 1, 5, 20, 50, 80, 100 mM, respectively. 10 μL ABTS (20 mM) and 2 μL H2O2 (0.1 M) are mixed in 88 μL NaAc/HAc solution (0.05 M, pH 5.0, containing 200 mM NaCl, 50 mM KCl, and 12.5 mM MgCl2), and bathed for 5 min to initiate the ABTS+. reaction. The absorbance at 415 nm is recorded by a Synergy HTX multifunctional enzyme marker at room temperature.

5 μL different DNAzyme sequences (10 μM) and 50 μL SO (100 mM) in 20 μL 5 × HEPES solution react for different time (0, 15, 30, 60, 90, 120, 180, 240 min) at 37 °C, then 10 μL hemin (10 μM) is added. The total amount of the system volume is 100 μL. The final concentration of G4 is 0.5 μM, hemin is 1 μM, and SO is 50 mM. Peroxidation reaction is performed after half an hour. 10 μL ABTS (20 mM), 2 μL H2O2 (0.1 M) and 88 μL NaAc/HAc solution (0.05 M) are mixed in the system, and bathed for 5 min. The absorbance at 415 nm is measured.

2.3. Spectroscopic characterization

15 μL different DNAzyme sequences (100 μM) and different concentrations of SO are mixed in 60 μL 5 × HEPES buffer. After incubation at 37 °C for 1 h, 30 μL hemin (100 μM) is added. Half an hour after the reaction, the absorption spectra are measured at 300–500 nm by a Shimadzu UV-2501PC UV–Vis spectrophotometer. The total amount of the system volume is 300 μL. The final concentration of G4 is 5 μM, and hemin is 10 μM. The final concentrations of SO are 0, 0.1, 1,5, 20, 50, 80, and 100 mM respectively.

Similarly, 15 μL different DNAzyme sequences (100 μM) and 150 μL SO (100 mM) in 60 μL 5 × HEPES solution react for different time (0, 15, 30, 60, 90, 120, 180, and 240 min) at 37 °C, then 30 μL hemin (100 μM) is added. The total amount of the system volume is 300 μL. The final concentration of G4 is 5 μM, hemin is 10 μM, and SO is 50 mM.

2.4. Fluorescence measurement

15 μL EA2 DNAzyme (100 mM) and 150 μL SO (1 M) are added in 600 μL 5 × HEPES buffer, and incubated at 37 °C for different time (0, 15, 30, 60, 90, 120, 180, 240 min). Then 30 μL ThT (10 μM) is added to the mixture, and react for 20 min. Emission spectra at 450–600 nm are measured. The total amount of the system volume is 300 μL. The final concentration of G4 is 0.5 μM, and SO is 50 mM.

2.5. Circular dichroism (CD) spectroscopy

30 μL EA2 DNAzyme (100 μM) and 15 μL SO (1 M) are added in 60 μL 5 × HEPES buffer solution, and incubated at 37 °C for different time (0, 15, 30, 60, 90, 120, 180, and 240 min). After the incubation, the samples are measured by a MOS-500 circular dichroism spectrometer at 50 nm/min from 230 to 320 nm with a slit width of 1 nm. Each spectrum obtained is corrected by subtracting the CD data of buffer. The total amount of the system volume is 300 μL. The final concentration of G4 is 10 μM, and SO is 50 mM.

3. Results and discussion

3.1. Activity analysis of structural variants of G-quadruplex DNAzyme

To investigate the mechanism of DNA damage, we use 18 structural variants of G4 DNAzyme (Table 1), which are widely used in previous work [31], to detect DNA damage. SO is the secondary metabolite, which is generated after styrene's metabolization by the cytochrome P450 enzyme system [32]. As an active electrophilic reagent, it is carcinogenic to animals and humans [33], and binds covalently to DNA (Fig. 1). As a proof of concept, we use SO as a model for DNA damage analysis based on the G4 DNAzyme-catalyzed peroxidation system. The catalytic activity of G4 DNAzyme decreases with the increasing SO concentration and reaction time (Fig. 2 A and B), which indicates that G4 DNAzyme is applicable for DNA damage analysis.

Fig. 1.

Fig. 1

Open in a new tab

Mechanism of toxicity assessment by DNAzyme-based DNA adduct damage system.

Fig. 2.

Fig. 2

Open in a new tab

A. Effect of different SO concentration on the activity of different G-quadruplex-hemin complexes. 0, 0.1, 1, 5, 20, 50, 80, 100 mM SO, 0.5 μM G-quadruplex, and 1 μM hemin in 5 × HEPES solution. Chromogenic conditions: 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2, 1 mM ABTS, and 1 mM H2O2 in NaAc/HAc solution. B. Effect of different reaction time on the activity of different G-quadruplexes. 0, 15, 30, 60, 90, 120, 180, 240 min. 50 mM SO, 0.5 μM G-quadruplex, and 1 μM hemin in 5 × HEPES solution. Chromogenic conditions: 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2, 1 mM ABTS, and 1 mM H2O2 in NaAc/HAc solution. C. Effect of different SO concentration on the activity of different structural variants of EA2 DNAzyme. 0, 0.1, 1, 5, 20, 50, 80, 100 mM SO, 0.5 μM G-quadruplex, and 1 μM hemin in 5 × HEPES solution. Chromogenic conditions: 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2, 1 mM ABTS, and 1 mM H2O2 in NaAc/HAc solution. D. Effect of different reaction time on absorbance of different structural variants of EA2. 0, 15, 30, 60, 90, 120, 180, 240 min. 50 mM SO, 0.5 μM G-quadruplex, and 1 μM hemin in 5 × HEPES solution. Chromogenic conditions: 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2, 1 mM ABTS, and 1 mM H2O2 in NaAc/HAc solution.

Different G4 sequences exhibit different peroxidase catalytic activity to SO. We select sequence variants mentioned in previous literature [[34], [35], [36]]. Our strategy for designing sequence variants is illustrated as follows. The common feature of G-quadruplex sequences are guanine-rich single-stranded oligonucleotides. We make some hypotheses: does the guanine tetrad have to be exactly three guanines in a row? Could a random array of guanine-rich single-stranded DNA also form G-quadruplexes? If these G-quadruplexes can be formed, can these structures also be peroxidase-like normal G-quadruplexes? By summarizing the sequences of DNAzyme reported in the literature, we find that guanine accounted for more than 50% of the DNA strand of G-quadruplexes, and most of them take three consecutive guanines as the basic unit, separated by one or several other bases. Based on this, we would like to study randomly arranged guanine-rich DNA to investigate whether it has the DNAzyme property of fixed guanine quadruplexes. Firstly, we explore the activity of 18 structural variants without adding SO. It shows that the initial activities of these 18 structural variants were different, due to their different structures. EA2, EAD3, EAD2, EAD, Cat, and EAD4 exhibit significant activity of DNAzyme.

Among 18 structural variants of G4 DNAzymes, EA2 DNAzyme [37] exhibits the most obvious DNA damage effect of SO (Fig. 1A, Tables S1 and S2). Because EA2 with three quartets isn't as stable as G4 sequences with four quartets. The unstable EA2 is easily affected by SO, and results in a more obvious DNA damage effect. As shown in Fig. 2 A and B, the activity of EA2 DNAzyme correlates well with SO concentration of and reaction time.

We design different structural variants of EA2 DNAzyme. As shown in Fig. 2C and D, DNA damage effect increases with the increasing concentration and reaction time, indicating that SO affects the activity of DNAzyme. SO concentration correlates well with the reaction time and the absorbance intensity at 415 nm. As shown in Fig. 2 A and Table S2, we calculate the ratio of the absorbance difference and the maximum absorbance of different variants after reaction at different concentrations. The results show that the ratio of EA2 is the biggest, indicating that EA2 exhibits a significant DNA damage effect. Therefore, we select EA2 sequence for the subsequent experiments. As shown in Fig. 2C and 2 D, we calculate the ratio of the absorbance difference to the maximum absorbance after the reaction. Although EA2 does not exhibit the most obvious DNA damage effect, EA2 is a great choice with basic sequence structure. Thus, we select EA2 for the following experiments. As shown in Fig. 2C, Fig. 2 D, Table S3, and Table S4, different structural variants of EA2 have different effects to DNA damage analysis. G4 DNAzyme-based peroxide-catalyzed system is suitable for DNA damage analysis.

3.2. Toxicity assessment by DNAzyme-based DNA adduct damage system

To investigate the possibility of G4 system for toxicity assessment, we investigate DNA damage of different chemicals [[38], [39], [40], [41], [42], [43], [44], [45]]. As shown in Fig. 3 A, 18 different chemicals (including 3-AB, 1,10-PM, ND, CP, AS, CTAC, SD, 2-HP, NBS, DCC, HN2, CTX, BU, BCNU, DDP, CBP, MS and SO) exhibit different degrees of DNA damage effects.

Fig. 3.

Fig. 3

Open in a new tab

A. Absorbance of 18 structural variants without adding SO. G-quadruplex, 0.5 μM; 5 × HEPES buffer (pH 7.4, final concentration: 25 mM HEPES, 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2); hemin, 1 μM. Chromogenic conditions: NaAc/HAc buffer (0.05 M, pH 5.0) with 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2; ABTS, 1 mM; H2O2, 1 mM. B. Absorbance of different drugs with an increasing concentration (0, 0.1, 1, 5, 20, 50, 80, 100 mM) on the catalysis of G-quadruplex peroxidase. Experimental conditions: G-quadruplex (EA2), 0.5 μM; 5 × HEPES buffer (pH 7.4, final concentration: 25 mM HEPES, 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2); hemin, 1 μM. Chromogenic conditions: NaAc/HAc buffer (0.05 M, pH 5.0) with 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2; ABTS, 1 mM; H2O2, 1 mM. C. Calibration curves for different SO concentration. D. Effect of SO on EA2 catalytic activity in different temperatures (0, 4, 37, 60, 80 °C). Experimental conditions: SO, 50 mM; G-quadruplex (EA2), 0.5 μM; 5 × HEPES buffer (pH 7.4, final concentration: 25 mM HEPES, 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2); hemin, 1 μM. Chromogenic conditions: NaAc/HAc buffer (0.05 M, pH 5.0) with 50 mM KCl, 200 mM NaCl, 12.5 mM MgCl2; ABTS, 1 mM; H2O2, 1 mM.

The chemicals can be divided into 9 types: (1) Alkylating agent: HN2, CTX, BU, and BCNU. (2) Platinum complexes: DDP, and CBP. (3) Antibiotic: CP. (4) Catalyzer: 2-HP, SD, CTAC, and MS. (5) Oxidant: 3-AB. (6) Antioxidant: ND. (7) Antagonist: AS. (8) Dehydrating agent: DCC. (9) Brominating agent: NBS. (9) Redox indicator: 1,10-PM. (10) Ultraviolet absorbing agent: SO.

SO exhibits the most significant toxicity. CTX, HN2, 1,10-PM, AS, 3-AB, CBP, BCNU, BU, and CTAC exhibit obvious toxicity, while SD, ND, 2-HP, DDP, CP, CBP, and MS exhibit unobvious toxicity. The results consistent with the previous references, indicating that G4 DNAzyme system is successful for toxicity assessment of unknown chemicals. As shown in Fig. S4, the significant decrease of absorbance of DCC and CTAC is because they can react with substrate. It seems further to inhibit the activity of DNAzyme. 1 mM H2O2, 1 mM ABTS, and a small amount of HRP are added to the 0.05 M NaAc/HAc buffer solution. After the reaction, we add different concentrations of CTAC (0.1, 1, 5, 20, 50, 80, and 100 mM) and DCC (0, 0.1, 1, 5, 20, 50, 80, and 100 mM). The total volume is 200 μL, and the absorbance at 415 nm is measured.

The degrees of inhibition of peroxidase activity vary depending on the structure, molecular weight and plane structures of chemicals. It will affect the formation of DNA adduct. As shown in Fig. S5, we select AS as a proof of concept to investigate its inhibition mechanism. As shown in Fig. S5, the titration experiments indicate that AS affects the affinity of hemin to G4. With the addition of AS, the absorption of EA2-AS is lower than that of EA2. The binding of AS to G4-hemin affect the catalytic activity. The change of G4 structure leads to the inhibition of DNAzyme peroxidase activity. Fig. S5 shows the Soret band decreases with increasing SO concentrations and reaction times. It indicates that AS might occupy the position of H2O at lower concentration, which increases the absorbance intensity at first. The results show that its inhibition mechanism is similar to that of SO. The results show that its inhibition mechanism is similar to that of SO. The results consistent with previous reference, indicating that G4 DNAzyme system is successful for toxicity assessment of chemicals.

As a proof of concept, we measure the absorbance at different SO concentration. As shown in Fig. 3 B, the absorbance displays an excellent linear relationship with the SO concentration in the range of 0.1–100 μM, where a linear regression equation is Y = −0.0175 X + 2.0896, R2 = 0.9624. The detection limit (LOD) of SO is defined as 3.21 mM with 3 σ/k (k is the slope of fitting lines).

3.3. Inhibition of DNAzyme activity with DNA adduct damage

To understand the mechanism of DNAzyme-based DNA adduct damage system, we study the topology, thermal stability, and heme binding affinity of DNAzyme. Different topologies of G4 have different characteristic peaks in CD spectra [46]. According to the orientation of the 5′ to 3′ ends, the topology of G4 can be divided into two types of structures, parallel and antiparallel. The parallel G4 structure exhibits a negative absorption peak at 240 nm and a positive absorption peak at 260 nm. And the anti-parallel structure of G4 exhibits a negative peak at 260 nm and a positive peak at 290 nm. The parallel G4 exhibits stronger peroxidase activity than anti-parallel G4. As shown in Fig. 4 A, EA2 DNAzyme exhibits a positive peak at 266 nm and a negative peak at 244 nm, which corresponds to the parallel G4 structure. CD spectra of EA2 exhibits a slight change with the reaction time from 0–180 min, indicating that the parallel structure of EA2 DNAzyme didn't change when expose to SO. The peak intensity exhibits an obvious decrease up to 240 min, indicating that SO affects the folding of EA2 DNAzyme after a long incubation time.

Fig. 4.

Fig. 4

Open in a new tab

A. CD spectra of EA2 DNA with different reaction time. B. Effect of SO on EA2 catalytic activity in different buffers (5 × HEPES, 5 × PBS, and 5 × MES solution, respectively). C. Spectrophotometric titration of hemin with different concentration of G4 DNAzyme. D. Spectrophotometric titration of DNA with different concentration of hemin. E. UV spectrum of different SO concentration in solution containing 10 μM hemin, 5 μM EA2 DNAzyme. F. UV spectrum of different reaction times between SO and EA2.

We investigate the effect of different buffers on G4 DNAzyme-based DNA damage system. As shown in Fig. 4 B, the buffer solutions can affect the catalytic activity of G4, with the order of HEPES > MES > PBS. As shown in Fig. 4 B, nitrogenous buffers can facilitate peroxidation reactions via exogenous general acid–base catalysis, and lead to more severe DNA damage [47,48].

As shown in Fig. 4C and D, the titration experiments indicate that SO affect the affinity of hemin to G4. With the addition of SO, the absorption of EA2-SO is lower than that of EA2. We conduct DNA damage detection at different temperatures. As shown in Fig. 3 D, the results show that the low temperature will inhibit the DNA damage of SO, while high temperature will damage the DNA structure, resulting in the failure of formation of a complex with heme.

E and D bands of hemin are observed in the high spin state of Fe (III) center [49]. As shown in Fig. 4 E and F, a strong Soret band is observed at 404 nm in hemin-EA2 complex, which is a characteristic absorption peak of hemin (εM > 1.2 × 105 M−1 cm−11) [50]. Fig. 4 E and F shows the effect of different concentrations and reaction time on the activity of G4 DNAzyme. When SO concentration and reaction time are up to 5 mM and 30 min, respectively, the Soret band decreases with the increasing SO concentration and reaction time. It indicates that SO might occupy the position of H2O at lower concentration, which increases the absorbance intensity at first. When SO replaces G4, and binds to hemin directly at high SO concentration or long reaction time, the absorbance decreases.

3.4. Potential mechanism of DNAzyme-based DNA damage analysis

The DNAzyme sequence folds to form the G4 structure in the presence of cations, which forms Hoogsteen hydrogen bonds between the guanines [51]. When SO binds covalently to DNA, it disrupts the Hoogsteen hydrogen bonding sites of G-plane guanines and affects the formation of G4 structure (Fig. 1). SO is one of the most versatile DNA binding agents, which binds to at least nine nucleic acid bases. The most common binding site is with guanine, mainly concentrated on the N7, N2 and O6 atoms of guanine [52] (Fig. 1).

As shown in Fig. 1, the activity of G4 DNAzyme depends on three factors: topology, thermal stability, and affinity to heme [48,53]. Two longitudinal coordination bonds of hemin exhibit a significant effect to the G4-hemin catalytic peroxidation [54]. One binds to the G plane of G4, and the other one binds to H2O/H2O2 to provide acid-base catalysis. The binding of SO with hemin occupies the H2O2 binding catalytic site, which leads to reduced catalytic activity. As shown in Fig. 4 E and F, Soret band of hemin exhibits a decrease after the addition of SO, which indicates that SO occupies the H2O2 binding catalytic site of hemin, and inhibits the peroxidase activity of DNAzyme [55].

To investigate the effect of uncombined SO, we used a biotin-labeled DNAzyme sequence (EA2-bio, 0.5 μM) for DNA damage analysis. EA2-bio folds into G4 structure, and binds with hemin tο form a G4-complex, After the reaction with SO, the G4-complex is removed by streptavidin-modified magnetic beads. As shown in Fig. S1, the presence of SO results in the decrease of absorption, indicating that uncombined SO will react with ABTS.

3.5. The generality of DNAzyme-based DNA-adduct damage system

To test the generality of G4 system, UV, FL, CL and ECL are used for DNA damage analysis. We use ABTS, TMB, and OPD as substrates for G4 DNA adduct damage analysis. As shown in Fig. 5, different substrates exhibit different absorption intensities. The characteristic UV peaks for ABTS, TMB, and OPD are located at 415 nm, 650 nm, and 405 nm, respectively. The absorption intensity of ABTS is higher than TMB and OPD, which might be due to high affinity of the ABTS with the active site of hemin. UV spectra of different substrates depend on the conjugated structure and the rigid plane. The rigid structure of ABTS and G4 leads to a higher affinity and a higher absorption (Fig. 5 A). Firstly, the molar absorption coefficient of ABTS at 415 nm is ε = 3.6 × 104 L mol−1 cm−1, and the molar absorption coefficient of TMB at 652 nm is 3.9 × 104 L mol−1 cm−1. OPD can generate the colored DAP in the peroxide reaction with ε 418nm of 1.67 × 104 L mol−1 cm−1 [56,57]. According to Beer-Lambert Law (A = ε cl), the absorbance of ABTS and TMB with bigger ε will exhibit obvious change, which is more convenient for detection. Secondly, the hydrophilicity of three substrates is in the order of ABTS > OPD > TMB. The more hydrophobic of the substrate, the easier it is to attract the background molecules, which will reduce the chemical activity of the substrate and affect the enzyme activity [58]. Thirdly, cations can enhance the peroxidation reaction of G4, while ABTS is more sensitive to cations than TMB. Therefore, we chose ABTS as the hydrogen donor of our method [59].

Fig. 5.

Fig. 5

Open in a new tab

Effects of different substrates on DNA damage. A. ABTS; B. TMB; C. OPD. D. Histogram of different substrates effects on DNA damage.

The FL intensity of ThT greatly enhances when it binds to G4 [60]. We measure the FL spectra of different structural variants of G4 with SO (Fig. S3 A). FL of ThT greatly enhances with the addition of G4. As shown in Fig. S3 B, cations (such as K+, Mg2+, and Na+) inhibit the FL intensity of G4-ThT complex, which lead to different degrees of reduction of FL intensity. We also investigate the effect of reaction time on G4-ThT without cations (Fig. S3 C). FL of the complex decreases with the increase of reaction time indicating that the binding of SO to G4 will affect the binding of THT and G4 [61]. DNAzyme-based DNA adduct damage system can be used for FL analysis.

We investigate the effect of SO on luminol ECL. Nano-Au is used to catalyze H2O2, which reacts with luminol to emit light. As shown in Fig. S2, the ECL intensity decreases with the increase of SO concentrations, and exhibits a good linear relationship (Y = -28.9338 X+8491.6336, R2 = 0.9586) with the SO concentration. G4 DNAzyme-based DNA adduct damage system is generally applicable for a variety of methods, such as CL, UV, FL, and ECL.

As shown in Fig. S6, we observe obvious inhibition effect to the activity of the DNAzyme of SO, indicating the method can be used to monitor the genotoxicity in cells. Proof-of-concept of our method provides an early screening tool for on-site environmental monitoring that specifically monitors the genotoxic reactivity of unknown chemicals and drug candidates.

4. Conclusion

We develop a DNAzyme-based method to detect DNA adduct damage for toxicity assessment of drug and chemical. Among 18 structural variants of G4 DNAzyme, EA2 DNAzyme exhibits obvious DNA damage effect of SO due to its unstable structure. As a proof of concept, we use SO as a model for DNA damage analysis based on the G4 DNAzyme-catalyzed peroxidation system, which exhibits pronounced effect due to its toxicity. The formation of G4 structure by SO leads to the inhibition of G4 DNAzyme peroxidase activity. The covalent binding of SO to DNA disrupts the Hoogsteen hydrogen bonding sites of G-plane guanines and affects the formation of G4 structure. The DNA damage chemicals affect the G4 DNAzyme peroxidase activity by disrupting the structural integrity of the G4 DNAzyme sequence. G4 DNAzyme-catalyzed peroxidation system is feasible for DNA damage analysis, and applicable for a variety of methods. This attributes to the assessment of possible genotoxicity of pharmaceutical candidates and industry chemicals. This methodology will provide a promising tool for genotoxic assessment of pharmaceutical candidates and industry chemicals. Proof-of-concept of this measurement provides an early screening tool for on-site environmental monitoring that specifically monitors the genotoxic reactivity of unknown chemicals and drug candidates. These features suggest future applications for toxicity screening as well as clinical and research measurements. Future progress would also benefit from miniaturization and simplification of the method and new protocols for faster, more convenient screening. These goals are currently being pursued in our laboratory.

Declaration of competing interest

All authors declared no competing interests.

Ethics approval and consent to participate

This manuscript reporting study does not involving human participants, human data or human tissues.

CRediT authorship contribution statement

Yi Xiao: Conceptualization, Methodology, Investigation, Writing – original draft, Writing – review & editing, Funding acquisition. Haomin Yi: Conceptualization, Methodology. Jingzhi Zhu: Conceptualization, Methodology. Suhua Chen: Conceptualization, Methodology, Resources, Data curation, Writing – review & editing. Guofang Wang: Visualization, Software. Yilong Liao: Visualization, Software. Yuanyuan Lei: Software. Liyin Chen: Writing – review & editing. Xingcai Zhang: Conceptualization, Supervision, Writing – review & editing. Fangfu Ye: Conceptualization, Supervision, Funding acquisition.

Acknowledgments

This work was supported by National Natural Science Foundation of China (81803720), Natural Science Foundation of Hunan Province (2019JJ50383), Natural Science Foundation of Changsha (kq2202256), Huxiang High-Level Talent Innovation Team (2018RS3072), Scientific and Technological Projects for Collaborative Prevention and Control of Birth Defect in Hunan Province (2019SK1012), and Key Grant of Research and Development in Hunan Province (2020DK2002). Dr. Zhang acknowledges the support from Harvard/MIT.

Footnotes

Peer review under responsibility of KeAi Communications Co., Ltd.

Appendix A

Supplementary data to this article can be found online at https://doi.org/10.1016/j.bioactmat.2022.10.002.

Contributor Information

Yi Xiao, Email: yixiao1@g.harvard.edu.

Xingcai Zhang, Email: xingcai@mit.edu.

Fangfu Ye, Email: fye@iphy.ac.cn.

Appendix A. Supplementary data

The following is the supplementary data to this article:

Multimedia component 1
mmc1.pdf (711.3KB, pdf)

References

  • 1.Kwon S.J., Lee D.W., Shah D.A., Ku B., Jeon S.Y., Solanki K., Ryan J.D., Clark D.S., Dordick J.S., Lee M.-Y. High-throughput and combinatorial gene expression on a chip for metabolism-induced toxicology screening. Nat. Commun. 2014;5(1):3739. doi: 10.1038/ncomms4739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Umansky C., Morellato A.E., Rieckher M., Scheidegger M.A., Martinefski M.R., Fernández G.A., Pak O., Kolesnikova K., Reingruber H., Bollini M., Crossan G.P., Sommer N., Monge M.E., Schumacher B., Pontel L.B. Endogenous formaldehyde scavenges cellular glutathione resulting in redox disruption and cytotoxicity. Nat. Commun. 2022;13(1):745. doi: 10.1038/s41467-022-28242-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cohen A.A.-O.X., Ioannidis K.A.-O., Ehrlich A.A.-O., Regenbaum S.A.-O.X., Cohen M.A.-O., Ayyash M., Tikva S.S., Nahmias Y.A.-O.X. Mechanism and reversal of drug-induced nephrotoxicity on a chip. Sci. Transl. Med. 2021;13(582):1–11. doi: 10.1126/scitranslmed.abd6299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.McAleer C.A.-O., Long C.A.-O., Elbrecht D.A.-O.X., Sasserath T., Bridges L.A.-O., Rumsey J.A.-O., Martin C., Schnepper M., Wang Y.A.-O., Schuler F., Roth A.A.-O., Funk C., Shuler M.A.-O.X., Hickman J.A.-O. Multi-organ system for the evaluation of efficacy and off-target toxicity of anticancer therapeutics. Sci. Transl. Med. 2019;11(eaav1386) doi: 10.1126/scitranslmed.aav1386. [DOI] [PubMed] [Google Scholar]
  • 5.Jang K.-J., Otieno Monicah A., Ronxhi J., Lim H.-K., Ewart L., Kodella Konstantia R., Petropolis Debora B., Kulkarni G., Rubins Jonathan E., Conegliano D., Nawroth J., Simic D., Lam W., Singer M., Barale E., Singh B., Sonee M., Streeter Anthony J., Manthey C., Jones B., Srivastava A., Andersson Linda C., Williams D., Park H., Barrile R., Sliz J., Herland A., Haney S., Karalis K., Ingber Donald E., Hamilton Geraldine A. Reproducing human and cross-species drug toxicities using a Liver-Chip. Sci. Transl. Med. 2019;11(517) doi: 10.1126/scitranslmed.aax5516. eaax5516. [DOI] [PubMed] [Google Scholar]
  • 6.Huh D., Leslie Dc Fau - Matthews B.D., Matthews Bd Fau - Fraser J.P., Fraser Jp Fau - Jurek S., Jurek S Fau - Hamilton G.A., Hamilton Ga Fau - Thorneloe K.S., Thorneloe Ks Fau - McAlexander M.A., McAlexander Ma Fau - Ingber D.E., Ingber D.E. A human disease model of drug toxicity-induced pulmonary edema in a lung-on-a-chip microdevice. Sci. Transl. Med. 2012;4(159):1–8. doi: 10.1126/scitranslmed.3004249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Jangili P., Kong N., Kim J.H., Zhou J., Liu H., Zhang X., Tao W., Kim J.S. DNA-damage-response-targeting mitochondria-activated multifunctional prodrug strategy for self-defensive tumor therapy. Angew. Chem. 2012;134(16) doi: 10.1002/anie.202117075. [DOI] [PubMed] [Google Scholar]
  • 8.Helbock Harold J., Beckman Kenneth B., Shigenaga Mark K., Walter Patrick B., Woodall Alan A., Yeo Helen C., Ames Bruce N. DNA oxidation matters: the HPLC–electrochemical detection assay of 8-oxo-deoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. USA. 1998;95(1):288–293. doi: 10.1073/pnas.95.1.288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Taghizadeh K., McFaline J.L., Pang B., Sullivan M., Dong M., Plummer E., Dedon P.C. Quantification of DNA damage products resulting from deamination, oxidation and reaction with products of lipid peroxidation by liquid chromatography isotope dilution tandem mass spectrometry. Nat. Protoc. 2008;3(8):1287–1298. doi: 10.1038/nprot.2008.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ji X., Ge L., Liu C., Tang Z., Xiao Y., Chen W., Lei Z., Gao W., Blake S., De D., Shi B. Capturing functional two-dimensional nanosheets from sandwich-structure vermiculite for cancer theranostics. Nat. Commun. 2021;12:1124. doi: 10.1038/s41467-021-21436-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu C., Sun S., Feng Q., Wu G., Wu Y., Kong N., Yu Z., Yao J., Zhang X., Chen W., Tang Z. Arsenene nanodots with selective killing effects and their low-dose combination with ß-elemene for cancer therapy. Adv. Mater. 2021;33(37) doi: 10.1002/adma.202102054. [DOI] [PubMed] [Google Scholar]
  • 12.Ding Y., Fleming A.M., Burrows C.J. Sequencing the mouse genome for the oxidatively modified base 8-Oxo-7,8-dihydroguanine by OG-seq. J. Am. Chem. Soc. 2017;139:2569–2572. doi: 10.1021/jacs.6b12604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bist I., Song B., Mosa I.M., Keyes T.E., Martin A., Forster R.J., Rusling J.F. Electrochemiluminescent array to detect oxidative damage in ds-DNA using [Os(bpy)(2)(phen-benz-COOH)](2+)/Nafion/Graphene films. ACS Sens. 2016;1:272–278. doi: 10.1021/acssensors.5b00189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wasalathanthri D.P., Li D., Song D., Zheng Z., Choudhary D., Jansson I., Lu X., Schenkman J.B., Rusling J.F. Elucidating organ-specific metabolic toxicity chemistry from electrochemiluminescent enzyme/DNA arrays and bioreactor bead-LC-MS/MS. Chem. Sci. 2015;6(4):2457–2468. doi: 10.1039/c4sc03401e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wasalathanthri D.P., Mani V., Tang C.K., Rusling J.F. Microfluidic electrochemical array for detection of reactive metabolites formed by cytochrome P450 enzymes. Anal. Chem. 2011;83(24):9499–9506. doi: 10.1021/ac202269t. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Jiang D., Shen M., Ahiadu B., Rusling J.F. Organ-specific screening for protein damage using magnetic bead bioreactors and LC–MS/MS. Anal. Chem. 2020;92(7):5337–5345. doi: 10.1021/acs.analchem.9b05871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jiang D., Malla S., Fu Y.-j., Choudhary D., Rusling J.F. Direct LC-MS/MS detection of guanine oxidations in exon 7 of the p53 tumor suppressor gene. Anal. Chem. 2017;89(23):12872–12879. doi: 10.1021/acs.analchem.7b03487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Malla S., Kadimisetty K., Fu Y.-J., Choudhary D., Jansson I., Schenkman J.B., Rusling J.F. Chemical selectivity of nucleobase adduction relative to in vivo mutation sites on exon 7 fragment of p53 tumor suppressor gene. Chem. Sci. 2015;6(10):5554–5563. doi: 10.1039/c5sc01403d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mergny J.-L., Sen D. DNA quadruple helices in nanotechnology. Chem. Rev. 2019;119(10):6290–6325. doi: 10.1021/acs.chemrev.8b00629. [DOI] [PubMed] [Google Scholar]
  • 20.Fleming A.M., Burrows C.J. Interplay of guanine oxidation and G-quadruplex folding in gene promoters. J. Am. Chem. Soc. 2019;142(3):1115–1136. doi: 10.1021/jacs.9b11050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bielskutė S., Plavec J., Podbevšek P. Impact of oxidative lesions on the human telomeric G-quadruplex. J. Am. Chem. Soc. 2019;141(6):2594–2603. doi: 10.1021/jacs.8b12748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang K.-B., Liu Y., Li Y., Dickerhoff J., Li J., Yang M.-H., Yang D., Kong L.-Y. Oxidative damage induces a vacancy G-quadruplex that binds guanine metabolites: solution structure of a cGMP fill-in vacancy G-quadruplex in the oxidized BLM gene promoter. J. Am. Chem. Soc. 2022;144(14):6361–6372. doi: 10.1021/jacs.2c00435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.De Magis A., Manzo Stefano G., Russo M., Marinello J., Morigi R., Sordet O., Capranico G. DNA damage and genome instability by G-quadruplex ligands are mediated by R loops in human cancer cells. Proc. Natl. Acad. Sci. USA. 2019;116(3):816–825. doi: 10.1073/pnas.1810409116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Fedeles B.I. G-quadruplex-forming promoter sequences enable transcriptional activation in response to oxidative stress. Proc. Natl. Acad. Sci. USA. 2017;114(11):2788–2790. doi: 10.1073/pnas.1701244114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fleming Aaron M., Ding Y., Burrows Cynthia J. Oxidative DNA damage is epigenetic by regulating gene transcription via base excision repair. Proc. Natl. Acad. Sci. USA. 2017;114(10):2604–2609. doi: 10.1073/pnas.1619809114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Willner I., Shlyahovsky B., Zayats M., Willner B. DNAzymes for sensing, nanobiotechnology and logic gate applications. Chem. Soc. Rev. 2008;37(6):1153–1165. doi: 10.1039/b718428j. [DOI] [PubMed] [Google Scholar]
  • 27.Albada H.Bauke, Golub Eyal, Willner Itamar. Rational design of supramolecular hemin/G-quadruplex-dopamine aptamer nucleoapzyme systems with superior catalytic performance. Chem. Sci. 2016;7(5):3092–3101. doi: 10.1039/c5sc04832j. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Freage Lina, McCaskill John S., Eyal Golub, Tel-Vered Ran, Wang F. Addressing, amplifying and switching DNAzyme functions by electrochemically-triggered release of metal ions. Chem. Sci. 2015;6:3544–3549. doi: 10.1039/c5sc00744e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.McConnell E.M., Cozma I., Mou Q., Brennan J.D., Lu Y., Li Y. Biosensing with DNAzymes. Chem. Soc. Rev. 2021;50(16):8954–8994. doi: 10.1039/d1cs00240f. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang J., Cheng M., Chen J., Ju H., Monchaud D., Mergny J.-L., Zhou J. An oxidatively damaged G-quadruplex/hemin DNAzyme. Chem. Commun. 2020;56(12):1839–1842. doi: 10.1039/c9cc09237d. [DOI] [PubMed] [Google Scholar]
  • 31.Zhang H., Li M., Li C., Guo Z., Dong H., Wu P., Cai C. G-quadruplex DNAzyme-based electrochemiluminescence biosensing strategy for VEGF165 detection: combination of aptamer–target recognition and T7 exonuclease-assisted cycling signal amplification. Biosens. Bioelectron. 2015;74:98–103. doi: 10.1016/j.bios.2015.05.069. [DOI] [PubMed] [Google Scholar]
  • 32.Phillips D.H., Farmer P.B. Evidence for DNA and protein binding by styrene and styrene oxide. CRC Crit. Rev. Toxicol. 1994;24(s1):S35–S46. doi: 10.3109/10408449409020139. [DOI] [PubMed] [Google Scholar]
  • 33.Sumner S.J., Fennell T.R. Review of the metabolic fate of styrene. CRC Crit. Rev. Toxicol. 1994;24(s1):S11–S33. doi: 10.3109/10408449409020138. [DOI] [PubMed] [Google Scholar]
  • 34.Franceschin M., Borbone N., Oliviero G., Casagrande V., Scuotto M., Coppola T., Borioni S., Mayol L., Ortaggi G., Bianco A. Synthesis of a dibromoperylene phosphoramidite building block and its incorporation at the 5' end of a G-quadruplex forming oligonucleotide: spectroscopic properties and structural studies of the resulting dibromoperylene conjugate. Bioconjugate Chem. 2011;22(7):1309–1319. doi: 10.1021/bc100526q. [DOI] [PubMed] [Google Scholar]
  • 35.Hallam P.M., Kampouris D.K., Kadara R.O., Banks C.E. Graphite screen printed electrodes for the electrochemical sensing of chromium(VI) Analyst. 2010;135(8):1947–1952. doi: 10.1039/c0an00228c. [DOI] [PubMed] [Google Scholar]
  • 36.Liu Z., Wang L., Nie Z., Peng F., Yan H., Yao S. Randomly arrayed G-quadruplexes for label-free and real-time assay of enzyme activity. Chem. Commun. 2014;50(52):6875–6878. doi: 10.1039/c4cc03103b. [DOI] [PubMed] [Google Scholar]
  • 37.Xiaohong Cheng X.L., Tao Bing, Cao Zehui, Shangguan D. General peroxidase activity of G-quadruplex-hemin complexes and its application in ligand screening. Biochemistry. 2009;48(33):7817–7823. doi: 10.1021/bi9006786. [DOI] [PubMed] [Google Scholar]
  • 38.Abdel-Salam O.M.E., Youness E.R., Mohammed N.A., Yassen N.N., Khadrawy Y.A., El-Toukhy S.E., Sleem A.A. Novel neuroprotective and hepatoprorective effects of citric acid in acute malathion intoxication. Asian Pac. J. Trop. Med. 2016;9(12):1157–1169. doi: 10.1016/j.apjtm.2016.11.005. [DOI] [PubMed] [Google Scholar]
  • 39.Bilal N., Suhail N., Hasan S., Ashraf G.M., Fatima S., Khan H.Y., Alharbi M.S., Alexiou A., Banu N. Exacerbation of N-nitrosodiethylamine induced hepatotoxicity and DNA damage in mice exposed to chronic unpredictable stress. Front. Pharmacol. 2017;8 doi: 10.3389/fphar.2017.00360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hart W.E., Marczak S.P., Kneller A.R., French R.A., Morris D.L. The abilities of selenium dioxide and selenite ion to coordinate DNA-bound metal ions and decrease oxidative DNA damage. J. Inorg. Biochem. 2013;125:1–8. doi: 10.1016/j.jinorgbio.2013.03.016. [DOI] [PubMed] [Google Scholar]
  • 41.Mello-Filho A.C., Meneghini R. Iron is the intracellular metal involved in the production of DNA damage by oxygen radicals. Mutat. Res. 1991;251(1):109–113. doi: 10.1016/0027-5107(91)90220-i. [DOI] [PubMed] [Google Scholar]
  • 42.Murray T.R., Downey K.M., Yunis A.A. Chloramphenicol-mediated DNA damage and its possible role in the inhibitory effects of chloramphenicol on DNA synthesis. J. Lab. Clin. Med. 1983;102(6):926–932. [PubMed] [Google Scholar]
  • 43.Beljanski V., Marzilli L.G., Doetsch P.W. DNA damage-processing pathways involved in the eukaryotic cellular response to anticancer DNA cross-linking drugs. Mol. Pharmacol. 2004;65(6):1496–1506. doi: 10.1124/mol.65.6.1496. [DOI] [PubMed] [Google Scholar]
  • 44.Iwamoto T., Hiraku Y., Oikawa S., Mizutani H., Kojima M., Kawanishi S. DNA intrastrand cross-link at the 5'-GA-3' sequence formed by busulfan and its role in the cytotoxic effect. Cancer Sci. 2004;95(5):454–458. doi: 10.1111/j.1349-7006.2004.tb03231.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jan Y.H., Heck D.E., Laskin D.L., Laskin J.D. Sulfur mustard analog mechlorethamine (Bis(2-chloroethyl)methylamine) modulates cell cycle progression via the DNA damage response in human lung epithelial A549 cells. Chem. Res. Toxicol. 2019;32(6):1123–1133. doi: 10.1021/acs.chemrestox.8b00417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Stefan L., Denat F., Monchaud D. Deciphering the DNAzyme activity of multimeric quadruplexes: insights into their actual role in the telomerase activity evaluation assay. J. Am. Chem. Soc. 2011;133(50):20405–20415. doi: 10.1021/ja208145d. [DOI] [PubMed] [Google Scholar]
  • 47.Beck M.J., Gopinath E., Bruice T.C. Influence of nitrogen base ligation on the rate of reaction of [5,10,15,20-tetrakis(2,6-dimethyl-3-sulfonatophenyl)porphinato]iron(III) hydrate with tert-BuOOH in aqueous solution. J. Am. Chem. Soc. 1993;115(1):21–29. [Google Scholar]
  • 48.Li W., Li Y., Liu Z., Lin B., Yi H., Xu F., Nie Z., Yao S. Insight into G-quadruplex-hemin DNAzyme/RNAzyme: adjacent adenine as the intramolecular species for remarkable enhancement of enzymatic activity. Nucleic Acids Res. 2016;44(15):7373–7384. doi: 10.1093/nar/gkw634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Adar F. Electronic absorption spectra of hemes and hemoproteins. The Porphyrins. 1978:167–209. [Google Scholar]
  • 50.Travascio P., Li Y., Sen D. DNA-Enhanced peroxidase activity of a DNA–aptamer–hemin complex. Cell Chem. Biol. 1998;5(9):505–517. doi: 10.1016/s1074-5521(98)90006-0. [DOI] [PubMed] [Google Scholar]
  • 51.Sengupta A., Roy S.S., Chowdhury S. Non-duplex G-quadruplex DNA structure: a developing story from predicted sequences to DNA structure-dependent epigenetics and beyond. Accounts Chem. Res. 2021;54(1):46–56. doi: 10.1021/acs.accounts.0c00431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Pavel V., Kari H. Identification of alkylation products of styrene oxide in single- and double-stranded DNA. Carcinogenesis. 1988;(9):1657–1660. doi: 10.1093/carcin/9.9.1657. [DOI] [PubMed] [Google Scholar]
  • 53.Li W., Li Y., Liu Z., Lin B., Yi H., Xu F., Nie Z., Yao S. Insight into G-quadruplex-hemin DNAzyme/RNAzyme: adjacent adenine as the intramolecular species for remarkable enhancement of enzymatic activity. Nucleic Acids Res. 2016;44(15):7373–7384. doi: 10.1093/nar/gkw634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Jones P., Suggett A. The catalase-hydrogen peroxide system. A theoretical appraisal of the mechanism of catalase action. Biochem. J. 1968;110(4):621–629. doi: 10.1042/bj1100621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Corwin A.H., Chivvis A.B., Poor R.W., Whitten D.G., Baker E.W. Porphyrin studies. XXXVII. The interpretation of porphyrin and metalloporphyrin spectra. J. Am. Chem. Soc. 1968;90(24):6577–6583. [Google Scholar]
  • 56.Fornera S., Walde P. Spectrophotometric quantification of horseradish peroxidase with o-phenylenediamine. Anal. Biochem. 2010;407(2):293–295. doi: 10.1016/j.ab.2010.07.034. [DOI] [PubMed] [Google Scholar]
  • 57.Ponhong K., Supharoek S.A., Siriangkhawut W., Grudpan K. A rapid and sensitive spectrophotometric method for the determination of benzoyl peroxide in wheat flour samples. J. Food Drug Anal. 2015;23(4):652–659. doi: 10.1016/j.jfda.2015.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Aumiller W.M., Davis B.W., Hatzakis E., Keating C.D. Interactions of macromolecular crowding agents and cosolutes with, small-molecule substrates: effect on horseradish peroxidase activity with two different substrates. J. Phys. Chem. B. 2014;118(36):10624–10632. doi: 10.1021/jp506594f. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Nakayama S., Sintim H.O. Investigating the interactions between cations, peroxidation substrates and G-quadruplex topology in DNAzyme peroxidation reactions using statistical testing. Anal. Chim. Acta. 2012;747:1–6. doi: 10.1016/j.aca.2012.08.008. [DOI] [PubMed] [Google Scholar]
  • 60.Mohanty J., Barooah N., Dhamodharan V., Harikrishna S., Pradeepkumar P.I., Bhasikuttan A.C. Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric G-quadruplex DNA. J. Am. Chem. Soc. 2013;135(1):367–376. doi: 10.1021/ja309588h. [DOI] [PubMed] [Google Scholar]
  • 61.Simon L., Hildebrand D.G., Britta M., Malak P.N., Becker M.S., Peter S., Frank E., Klaus S.O., Oliver R. LORD-Q: a long-run real-time PCR-based DNA-damage quantification method for nuclear and mitochondrial genome analysis. Nucleic Acids Res. 2013;(6):41–47. doi: 10.1093/nar/gkt1349. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Multimedia component 1
mmc1.pdf (711.3KB, pdf)

Articles from Bioactive Materials are provided here courtesy of KeAi Publishing

RESOURCES