Genomic features of Mycobacterium avium subsp. hominissuis isolated from pigs in Japan

Abstract

Mycobacterium avium subsp. hominissuis (MAH) is one of the most important agents causing non-tuberculosis mycobacterial infection in humans and pigs. There have been advances in genome analysis of MAH from human isolates, but studies of isolates from pigs are limited despite its potential source of infection to human. Here, we obtained 30 draft genome sequences of MAH from pigs reared in Japan. The 30 draft genomes were 4,848,678–5,620,788 bp in length, comprising 4652–5388 coding genes and 46–75 (median: 47) tRNAs. All isolates had restriction modification-associated genes and 185–222 predicted virulence genes. Two isolates had tRNA arrays and one isolate had a clustered regularly interspaced short palindromic repeat (CRISPR) region. Our results will be useful for evaluation of the ecology of MAH by providing a foundation for genome-based epidemiological studies.

Data description

Context

To date, incidence of infection caused by non-tuberculous mycobacteria (NTM) has been increasing worldwide [1]. Among NTMs, Mycobacterium avium complex (MAC) is one of the most critical agents. M. avium has four subspecies: M. avium subsp. avium (MAA), M. avium subsp. paratuberculosis (MAP), M. avium subsp. silvaticum (MAS) and M. avium subsp. hominissuis (MAH). MAH is a major pathogen for humans, causing lung disease and sometimes disseminated infection in immune-suppressed patients [2, 3]. MAH is also a main causative agent of mycobacteriosis in pigs [4], showing mesenteric and mandibular lymphadenitis [5] and sometimes systemic infection [6]. Swine mycobacteriosis has severe economic effects on affected farms. MAH-infected pigs are suspected to be a potential risk for human infection [7–10].

Recently, there has been extensive progression in the genomic epidemiological study of MAH. Based on findings from our recent studies, MAH is divided into six major lineages: MahEastAsia1, MahEastAsia2, and SC1–4. Each lineage is predominant in specific regions on a global scale [11, 12]. For example, the MahEastAsia1 and MahEastAsia2 lineages are frequently isolated from human lung disease in Japan and Korea, but SC1–4 lineages are isolated from America and Europe [11, 12]. Japanese pig isolates are mainly classified into two lineages, SC2 and SC4 [11, 12]. However, the number of pig isolates used in these studies was insufficient to precisely clarify the ecology of MAH.

Most of the essential genes of MAH are thought to be mutual orthologs of genes in Mycobacterium tuberculosis (MTB) [13]. Although components of virulence systems have been investigated [14], reports about genome contents, even drug resistance genes are not available, despite the increasing incidence of MAH disease [1]. To understand MAH evolution and distribution, and to promote the identification of targets for antimicrobial drug discovery, characterization of the defining genomic features of MAH is essential.

Here, we obtained draft genome sequences of 30 MAH (NCBI:txid439334) isolates derived from pigs reared in Japan, and identified genome features for bacterial defense systems, such as restriction modification (RM) system, clustered regularly interspaced short palindromic repeat (CRISPR), tRNA arrays, virulence factors and drug resistance genes. The results from this study may enable greater understanding of the epidemiological relationship between MAH in humans and pigs.

Methods

Protocols for bacterial isolation and DNA extraction are available in a protocols.io collection (Figure 1 [15]).

Figure 1.

Protocols for bacterial isolation and genomic DNA extraction of Mycobacterium avium from pig lymph nodes [15]. https://www.protocols.io/widgets/doi?uri=dx.doi.org/10.17504/protocols.io.bzbtp2nn

Sampling

MAH isolates were collected from pigs reared at two areas, Tokai and Hokuriku in Japan, where about 10% of pigs in Japan are reared. Forty-eight mesenteric or mandibular lymph nodes of pigs reared in the Tokai area were collected from Gifu Meat Inspection Center between July and December 2015. Samples (20 mesenteric lymph nodes, one mandibular lymph node, one liver) from Tokai and Hokuriku areas were collected between August 1998 and March 2018 and archived at Toyama Meat Inspection Center.

Bacterial isolation and DNA extraction

The method used for bacterial isolation is available in protocols.io [16]. Mesenteric or mandibular lymph nodes with mycobacterial granulomatous lesions were mixed with 400 μl of 2% NaOH and incubated at room temperature overnight. The samples were spread onto 2% Ogawa medium (Kyokuto Pharmaceutical, Tokyo, Japan) and incubated at 37 °C for 3–4 weeks. A single colony was inoculated onto 7H11 broth with 10% oleic acid-albumin-dextrose-catalase as a supplement. The isolates were stored with Microbank (Pro Lab Diagnostics Inc., Richmond Hill, ON, Canada) at –80 °C. The method of extraction of genomic DNA was also available in protocols.io [17]. In brief, cells were delipidated by treatment with acetone, then lysed by lysozyme and Proteinase K. Genomic DNA was extracted by phenol/chloroform treatment of the lysates.

Identification of MAH and insertion sequence profile

PCR amplification of M. avium 16S rRNA genes (MAV) was conducted for screening [18]. Isolates positive for MAV were identified by sequencing hsp65 and rpoB genes [19, 20]. Basic Local Alignment Search Tool (BLAST) analysis was conducted using partial sequences of rpoB gene. Phylogenetic analysis of both genes was conducted using the maximum likelihood method using Molecular Evolutionary Genetics Analysis (MEGA) software v.7.0 (RRID:SCR_000667). Bootstrap values were calculated from 1000 replications. Insertion sequence patterns of IS900, IS901, IS902 and IS1245 were performed as described previously [21–23]. IS1311 and IS1613 were searched for within draft genomes using ISfinder v.2.0 (RRID:SCR_003020) [24] with default parameters [25].

Draft genome sequences and genome annotation

Extraction of genomic DNA was described above. An average of 350-bp paired-end libraries were prepared from extracted genomic DNA using the TruSeq DNA PCR-Free High Throughput Library Prep Kit (Illumina, San Diego, CA, USA). Paired-end sequencing (2 × 150 bp) was conducted using the HiSeq X Ten sequencing platform (Illumina) at the Beijing Genomics Institute (Shenzhen, China). Output reads were trimmed by TrimGalore v.0.4.1 (RRID:SCR_011847) [26] and mismatched reads were corrected by SPAdes v.3.12.0 (RRID:SCR_000131) [27]. The reads were assembled and polished using Pilon v.1.22 (RRID:SCR_014731) [28] and Unicycler v.0.4.6 [29], and genome completeness was then estimated by CheckM v.1.0.7 (RRID:SCR_016646) [30]. Taxonomic classification of contigs was carried out using Kaiju v1.4.5 [31] and Anvi’o v.3 [32]. Draft genome sequences were annotated via the National Center for Biotechnology Information (NCBI) Prokaryotic Genome Annotation Pipeline (PGAP) v.4.9 (RRID:SCR_021329) [33].

Detection of bacterial defence systems (RM system and CRISPR CAS system) in the MAH genome

RM systems were determined using the online tool Restriction-ModificationFinder v.1.1 [34] twice, with the following settings (1: database: All incl. putative genes, threshold for %ID: 90%, minimum length: 80% to search the RM system of MAH and 2: database: All, threshold for %ID: 10%, minimum length: 20% to confirm the orthologue of MTB or the other Mycobacteria) [35]. CRISPR-Cas9 systems were identified using the online tool CRISPRCasFinder v.4.2.2 [36] with default setting [37, 38].

Detection of tRNA arrays in the MAH genome

The total number of tRNAs in this study were retrieved from gb files annotated by PGAP. Draft genomes of GM17 and OCU479 isolates, which had more tRNAs than the others (Table 1), were inspected by tRNAscan-SE v.2.0 (RRID:SCR_010835) to search tRNA arrays [39]. tRNA gene isotype synteny (expressed by the single-letter amino acid code) of both isolates and the reference strains were aligned and used for the maximum likelihood method by MEGA 7.0. Classification of both isolates was conducted as previously described [40].

Table 1.

Summary information for the draft genome sequences of 30 MAH isolates in this study.

Isolate	Genome size (bp)	N50 (bp)	Coverage	No. of contigs	G+C content (%)	No. of CDSs*	No. of tRNAs
GM5	5,037,010	35,760	277	224	69.06	4,877	47
GM10	4,858,055	33,212	277	248	69.16	4,708	47
GM12	4,848,678	33,219	253	261	69.17	4,732	47
GM16	5,012,047	24,262	274	346	68.84	4,981	46
GM17	5,265,075	30,906	355	289	68.77	5,190	75
GM21	4,899,737	45,080	411	216	69.20	4,734	47
GM32	4,897,271	47,147	292	208	69.20	4,712	47
GM44	5,086,547	26,307	251	316	68.95	4,780	46
OCU467	5,110,693	243,182	207	75	69.16	4,803	46
OCU468	5,459,638	137,464	198	132	68.96	5,176	46
OCU469	5,167,480	190,329	191	57	69.19	4,886	47
OCU470	5,388,572	124,661	220	132	68.98	5,103	46
OCU471	4,990,913	193,095	237	70	69.24	4,713	47
OCU472	5,410,552	119,264	180	139	68.97	5,163	47
OCU473	5,237,229	105,027	232	118	69.11	4,981	47
OCU474	5,087,878	168,670	213	81	69.26	4,817	47
OCU475	5,376,580	113,114	243	130	68.99	5,121	46
OCU476	5,359,545	133,302	268	132	69.00	5,094	46
OCU477	5,087,664	218,065	221	85	69.22	4,779	47
OCU478	5,108,303	272,265	230	73	69.17	4,803	46
OCU479	5,620,788	112,152	167	143	68.78	5,388	75
OCU480	5,088,946	195,446	53	73	69.24	4,820	47
OCU481	5,100,722	163,519	247	101	69.19	4,802	47
OCU482	5,100,769	163,705	244	99	69.19	4,800	47
OCU483	4,943,024	200,611	228	68	69.24	4,652	47
OCU484	5,096,430	141,792	249	104	69.20	4,811	47
OCU485	5,109,020	243,182	258	80	69.16	4,805	46
OCU486	5,023,805	234,302	40	52	69.23	4,722	47
Toy194	5,347,524	216,164	273	93	68.97	5,018	47
Toy195	5,346,468	168,809	192	103	68.97	5,029	47

*CDSs: coding sequences.

Detection of virulence factors and drug resistance genes

Virulence genes were identified using VFanalyzer (release 5) [41, 42]. We selected the following settings: genus: Mycobacterium, specify a representative genome: M. avium 104 and choose genomes for comparison: blank. Draft genome fasta files were uploaded. Drug resistance genes were identified by Resistance Gene Identifier (RGI) v.5.1.0 [43] with the following settings: Select Data Type: DNA sequence, Select Criteria: Perfect and Strict hit only, Nudge ≥95% identity Loose hits to Strict: Exclude nudge, Sequence Quality: high quality/coverage [44]. To confirm the existence of mutations detected by RGI, we retrieved the respective drug resistance-associated genes from draft genome sequences, aligned by MEGA 7.0, and then manually checked for mutations in the nucleotide sequences.

Data validation and quality control

Identification of MAH

The experimental workflow from sampling to identification is shown in Figure 2. We successfully obtained 13 MAH isolates derived from the Tokai area. Of these, 8 isolates (GM5–GM44), together with 22 isolates from Tokai and Hokuriku areas (OCU467–OCU486, Toy194 and Toy195) were used for draft genome sequence analysis. We conducted multiple examinations to determine the isolates as MAH, IS possession patterns, or sequence analysis of hsp65 [45]. Among MAH subspecies, the patterns of IS possession are different and are used for subspecies identification [46]. IS900 and IS901 are known to be indicators of MAP and MAA, respectively [22, 23]. MAH is usually positive for IS1245 [47] and is negative for IS900, IS901 and IS902 [21]; however, MAH strains without IS1245 are frequently distributed in Japan [46, 48]. In our study, 10/30 isolates were negative for IS1245 (33.3%) and none had IS900, IS901 and IS902 [45]. Subspecies of M. avium are also usually identified by hsp65 gene analysis, which had 17 single nucleotide polymorphisms (SNP) variations among subspecies [20]. MAH usually has 1, 2, 3, 7, 8 or 9 hsp codes [20]; however, five isolates had unclassified hsp codes (indicated by N) in this study [45]. Therefore, we also conducted partial sequence analysis of the rpoB gene and the isolates were identified as MAH by BLAST analysis. In addition, we conducted phylogenetic analysis based on hsp65 and rpoB genes retrieved from the draft genome, and all isolates in this study were also classified as MAH (Figure 3). All these examinations confirmed that our isolates were MAH.

Figure 2.

The experimental workflows in this study.

Figure 3.

Phylogenetic analysis based on rpoB gene and hsp65 gene. Phylogenetic tree was generated with the maximum likelihood method using MEGA 7.0. All isolates in this study are indicated in bold font. (a) 30 MAH isolates in this study were classified as MAH and were differentiated from MAP and MAA nodes. (b) All the isolates in this study were classified into 5 hsp code, code 1, 2, 3, N1 and N4. These isolates were differentiated from MAP and MAA/MAS nodes. The bootstrap values were determined from 1,000 replications. The scale bar indicates genetic distances among strains.

Draft genome data

All our draft genome sequences had a total length of between 4.85 and 5.62 Mbp (megabase pairs), similar to complete MAH genomes [49, 50]. All isolates had N50 values over 24 Kbp (kilobase pairs), and over 40-fold genome coverage (average 233) (Table 1).

Genome content analysis

In total, we identified 73 putative RM systems, including 24 type I RM systems, 48 type II RM systems, and 1 type III RM systems [45]. All isolates had at least one type II RM system. GM5, GM16, GM17, OCU468–OCU470, OCU472, OCU473, OCU475, OCU476, OCU479, OCU483 and OCU484 had type I, type II RM systems. GM44 had three types of RM systems. In these RM systems, seven had homologs in MTB and 30 had homologs in M. kansasii. Orphan methyltransferase was detected in OCU473 and OCU479. CRISPR was detected only in GM44 (Table 2). The sequences of the region were identical to MAH 104 (query cover: 100%, E-value: 0.0, Per. Ident: 99.99%), which is the only MAH strain with an intact CRISPR in the database [51]. The isolates had 185–222 virulence factors; 141 factors were common in all isolates [45]. All isolates shared the same two drug resistance genes: mtrA, which is associated with cell division and cell wall integrity [52] and resistance to macrolide antibiotics, and RbpA, which regulates bacterial transcription and is associated with rifampicin resistance [45, 53]. In addition, SNPs associated with drug resistance were found. All isolates had a C117D change in the murA gene conferring resistance to fosfomycin. An A2274G mutation in the M. avium 23S rRNA, which contributes to macrolide resistance, was also detected by RGI, but when we examined the aligned nucleotide sequence, no point mutation was found in any isolates [45]. CRISPR, virulence factor and drug resistance genes were selected from online tools. Original databases of each tool used in this study were updated in 2020, suggesting our data are based on the forefront of existing knowledge.

Table 2.

Detected CRISPR-Cas systems in MAH GM44.

Strain name	Evidence level	No. of spacers	Sequence of spacers	CRISPR start position	CRISPR end position	CRISPR length	Consensus repeat	Repeat length
GM44	4	12	1: ACCGGTCGGTCACTGCGGTGGTGTCCTGTGCATGCTCC	4089	4860	771	TGCTCCCCGCGCAAGCGGGGATGAACC	27
			2: ACCTCCCAGGCGGACGCAGTGCCAGGGATGGCGAGTA
			3: ACCCGAGGCCGTCGCGGAGGCCTTGACCGACCCCGATA
			4: ACCGCGCACCTCAGCTGCTGTGCTGCGTGAGCGCGTCATA
			5: ACCCCTGCACCAGTCGATCCACTGCGACGTGCGCAGCA
			6: ACCCATCCCAGGTCAGGAAGTCTGCTCCCCGCGTAAGA
			7: ACCGGGCCTGTTGCTCATCGGCCCGCCGCGCTCGGGCA
			8: ACCGCCGATACCGGGCTTGGCATCCGTGCCGTACTGC
			9: CCCCGTGCCCGGTGGAGGAACCACCTCTCCCCCCACA
			10: ACCGGCCGCAGAGGAGGCCGTCACCGCGGCGAAGACC
			11: ACCCCTCCGATCCAGGTACCGCGTCCGGAAGATGTGGCC
			12: CCCCCCCCGTCTGCAGCGCAACGGTTCCTACTGCACCTCC

tRNA arrays

tRNA arrays were detected in isolates GM17 and OCU479 (Table 3). A tRNA array was discovered in some MAH isolates in a previous study, and phylogenetic analysis based on nucleotide sequences of this tRNA array showed that the tRNA array of MAH was classified into a specific group [40]. Phylogenetic analysis was performed to confirm that the tRNA arrays in this study were authentic. Our tRNA arrays were classified into group 3, as defined in a previous study (Figure 4) [40].

Table 3.

The information about tRNA array detected in MAH isolates GM17 and OCU479.

Isolate	Contig	Locus tag	tRNA gene isotype synteny	Species	Query cover	Identity	Accession
GM17	Contig 1	GBQ13_00450 – GBQ13_00590	LLKKGCWPVMNYQ QEFEINASHRRLITR	Mycobacterium chimaera strain MC045 genome assembly, plasmid: 2	64%	85.97%	LT703506
OCU479	Contig 38	GBP94_21805 – GBP94_21975	TWLLKKGCPVMNY QQEFEIPASHRRLRI	Mycobacterium chimaera strain AH16 plasmid unnamed1	32%	76.88%	CP012886

Figure 4.

Phylogenetic tree based on the sequence of tRNA isotype located in tRNA array. Phylogenetic tree was generated by maximum likelihood method using MEGA 7.0. Two isolates (GM17 and OCU479 indicated in bold) were classified in Group 3. The bootstrap values were determined from 1,000 replications. The scale bar indicates genetic distances among strains.

Re-use potential

MAH is one of the most critical M. avium subspecies causing non-tuberculosis mycobacterial infection in human and pigs. Pigs are suspected to be the most dominant host of MAH in animals, and a potential source of infection for humans [7–10]. However, genomic studies on the relationship between human and pig MAH isolates are limited[11, 12]. Our study provides 30 draft genome sequences of MAH isolated from pigs. These data will be useful for genome-based epidemiological studies to evaluate the importance of pigs as a source of infection. In addition, we provide molecular identification of defense systems, tRNA arrays, virulence factors and drug resistance genes. These data are expected to be used in future research on MAH classification, pathogenicity, and identification of antimicrobial drug targets. Principally, our draft genomes were derived from both cases of systemic and lymph node-limited infection of MAH. Thus, the provided virulence factors can be included as important candidate genes associated with the systemic infection of pigs.

Funding Statement

This research was supported by a grant from the Japan Agency for Medical Research and Development (AMED) (17fk0108116h040 and 21fk0108129h0502), the Japan Racing Association (JRA) Livestock Industry Promotion Project (H28-29_239, H29-30_7) of the JRA, a grant for Meat and Meat Products (H28-130, H30-60) managed by the Ito Foundation for research in design study, collection, analysis; and was supported by grants from the Japan Society for the Promotion of Science (JSPS) KAKENHI (JP26304039, JP18K19674, 16H05501, 16H01782, 20H00562). JOO is a recipient of a Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) scholarship.

Data availability

A summary of information about the 30 draft MAH isolate genomes is shown in Table 1. Genome sizes ranged from approximately 4.8 Mbp to 5.6 Mbps. GC content was 68.77–69.26%. All genome sequences have been deposited in GenBank under accession numbers VRUQ00000000, WEGO00000000 to WEGZ00000000 and WEHA00000000 to WEHQ00000000, and in the NCBI Sequence Read Archive (SRA) under accession numbers SRR13521605, SRR13556487 to SRR13556515. Other supporting data underlying the tables, annotations and other results are available in the GigaScience GigaDB repository [45].

List of abbreviations

BLAST: Basic Local Alignment Search Tool; CRISPR: clustered regularly interspaced short palindromic repeat; MAA: M. avium subsp. avium; MAC: Mycobacterium avium complex; MAH: Mycobacterium avium subsp. hominissuis; MAP: M. avium subsp. paratuberculosis; MAS: M. avium subsp. silvaticum; MEGA: Molecular Evolutionary Genetics Analysis; MTB: Mycobacterium tuberculosis; NCBI: National Center for Biotechnology Information; NTM: non-tuberculous mycobacteria; RM: restriction modification; PGAP: Prokaryotic Genome Annotation Pipeline; SNP: single nucleotide polymorphism; SRA: NCBI Sequence Read Archive.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by a grant from the Japan Agency for Medical Research and Development (AMED) (17fk0108116h040 and 21fk0108129h0502), the Japan Racing Association (JRA) Livestock Industry Promotion Project (H28-29_239, H29-30_7) of the JRA, a grant for Meat and Meat Products (H28-130, H30-60) managed by the Ito Foundation for research in design study, collection, analysis; and was supported by grants from the Japan Society for the Promotion of Science (JSPS) KAKENHI (JP26304039, JP18K19674, 16H05501, 16H01782, 20H00562). JOO is a recipient of a Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) scholarship.

Author’s contributions

T.K., K.O. and H.Y. wrote the manuscript. K.M., A.H., S.S. and K.S. collected samples. K.O., J.O.O., S.S. and K.S. performed laboratory works. T.K., K.O., A.O., H.Y., J.O.O., T.Ito and M.K. conducted computational analysis. Y.N., T.A., T.Y., H.F., T.W., S.Y., K.A. designed methods. M.A., A.D.B., K.O., N.Y., T.Iwamoto and F.M. designed whole research and advised on the interpretation of the study’s findings. All authors reviewed the manuscript.