Skip to main content
NCBI home page
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2022 Sep 27;10(11):e2060. doi: 10.1002/mgg3.2060

Identification of a novel CACNA1F mutation in a Chinese family with CORDX3

Meng Du 1,2, Yang Li 1,2, Panpan Zheng 1,2, Liang Zhong 1,2, Weili Zhao 1,2, Yuxin Zhang 1,2, Haiyan Gu 1,2, Xue Li 3, Zanchao Liu 1,2,✉
PMCID: PMC9651601  PMID: 36165086

Abstract

Background

X‐linked cone‐rod dystrophy (CORDX) is one form of inherited retinal disorders (IRDs) characterized by progressive dysfunction of photoreceptor. Three types of CORDX were reported and CACNA1F gene defect can cause CORDX3. The aim of this study was to investigate the pathogenic variant in a Chinese family with IRD.

Methods

The two affected subjects including the proband and his elder sister underwent ophthalmic examinations. Whole exome sequencing (WES) was performed in the proband at first, then co‐segregation analysis was performed in the family by Sanger sequencing. Minigene approach was used to verify the effect of the mutation on the splicing of CACNA1F. X‐chromosomal inactivation assay was performed to evaluate the inactivation patterns of the female carriers.

Results

The ophthalmic examination results of the proband fit the clinical description of CORDX3, and the female patient presented with only mild symptoms due to mildly skewed X‐chromosomal inactivation (ratio 67: 33). Molecular genetic testing identified a novel splice‐site mutation c.3847‐2A > G in CACNA1F (NM_005183.4) gene in the patients, which inherited from their asymptomatic mother. Minigene approach confirmed that c.3847‐2A > G could affect the splicing of CACNA1F.

Conclusion

Our study identified a novel splice‐site mutation in the CACNA1F gene, which expanded the mutational spectrum of CACNA1F‐releated diseases and demonstrated the importance of combining clinical and genetic testing in the diagnosis of IRDs.

Keywords: CACNA1F, minigene, splice‐site mutation, X‐linked cone‐rod dystrophy

A novel splice‐site variant c.3847‐2A > G in CACNA1F gene causing CORDX3 was identified. This finding further expands the mutational spectrum of CACNA1F related disease.

graphic file with name MGG3-10-e2060-g002.jpg

1. INTRODUCTION

X‐linked cone‐rod dystrophy (CORDX) is a rare, progressive retinal disease characterized by decreased visual acuity, myopia, abnormal color vision and cone or cone‐rod dystrophy. CORDX is clinically and genetically heterogeneous (Jalkanen et al., 2006). The age of onset and severity of symptoms are variable expressivity, and three gene loci have been identified. CORDX1 (OMIM: 304020) is caused by RPGR defect (Demirci et al., 2002), which also causes retinitis pigmentosa 3 (OMIM: 300029) (Meindl et al., 1996) and macular degeneration (OMIM: 300834) (Ayyagari et al., 2002). Additional forms of CORDX include CORDX2 (OMIM: 300085) mapped to Xq27 (Bergen & Pinckers, 1997), and CORDX3 (OMIM: 300476) caused by CACNA1F mutation (Jalkanen et al., 2006; Mäntyjärvi et al., 2001). The CACNA1F gene defect is also responsible for Aland Island eye disease (AIED, OMIM:300600) (Jalkanen et al., 2007) and incomplete congenital stationary night blindness (icCSNB, OMIM: 300071) (Bech‐Hansen et al., 1998; Strom et al., 1998). It comprises 48 exons and codes for the pore‐forming α1F subunit of the L‐type voltage gated calcium channel (Cav1.4), which localized to rod and cone photoreceptor ribbon synapses and supported Ca2+ influx under relatively depolarized conditions (Abdelkader et al., 2018; Koschak et al., 2021). Over 200 mutations in CACNA1F including missense, nonsense, splice‐site variants, and indels have been reported (Mahmood et al., 2021).

Here, we describe the clinical phenotypes of two patients—a male patient and his elder sister—from a Chinese family with congenital visual impairment. A novel splice‐site mutation c.3847‐2A > G in the CACNA1F gene was identified and the deleterious effect was demonstrated by minigene approach. Combined with the ophthalmic examinations and genetic testing results, the family was finally diagnosed as CORDX3.

2. MATERIALS AND METHODS

2.1. Clinical examinations

Four individuals including two patients and their parents were recruited in this study (Figure 1a), and ophthalmic examinations were performed on each of the two patients (II2 and II3). The ophthalmic examinations included best corrected visual acuity (BCVA), color vision test (pseudo‐isochromatic plate tests), panoramic laser scanning fundus photography, and full field electroretinogram (ff‐ERG) in accordance with International Society for Clinical Electrophysiology of Vision (ISCEV) guidelines (Hauke et al., 2013; Kimchi et al., 2019).

FIGURE 1.

FIGURE 1

Open in a new tab

Identification of CACNA1F mutation. (a) Family pedigree. Black arrow represents the proband. Wt represents wild type. (b) Sanger sequencing of the CACNA1F (NM_005183.4) mutation c.3847‐2A > G for the proband II3 (mutant‐type hemizygote), father I1 (wild‐type hemizygote), mother I2 (heterozygote) and the elder sister II2 (heterozygote)

2.2. DNA mutation detection

Peripheral blood DNA from the two patients and their parents was isolated using the Blood Genomic DNA Extraction kit (Solarbio, Beijing, China). Genomic DNA of the proband II3 was analyzed by whole exome sequencing (WES) in MyGenostics (Beijing, China) using the XTen system (Illumina, San Diego, CA, USA). Sequenced reads were mapped against the human reference genome (GRCh37) with Burrows‐Wheeler Aligner (BWA). Variant identification was performed with Genome Analysis Toolkit (GATK). The annotation of variants was performed by ANNOVAR. Variants identified in known genes associated with inherited retinal disorders (IRDs) were carefully prioritized by allele frequency in gnomAD and predicted results using bioinformatics software including SIFT (http://sift.bii.a‐star.edu.sg), Polyphen‐2 (http://genetics.bwh.harvard.edu/pph2/), MutationTaster (http://www.mutationtaster.org/), NNSplice (http://www.fruitfly.org/seq_tools/splice.html), and FSPLICE (http://www.softberry.com). A splice‐site mutation in CACNA1F (NM_005183.4) was found as candidate variant. Co‐segregation analysis was performed by Sanger sequencing (Sangon Biotech, Shanghai, China) after specific PCR using primer 1 h‐CA‐F/R (Table 1). The pathogenicity of the variant was assessed according to the American College of Medical Genetics and Genomics (ACMG) guidelines (Richards et al., 2015).

TABLE 1.

Primers for co‐segregation analysis and minigene approach

Primer name Sequence Restriction enzymes
1 h‐CA‐F 5‐TAATGACCCCACCATCACCC‐3 –
1 h‐CA‐R 5‐TCTCCAAAGTGCCAAGGACT‐3 –
2 h‐CA‐F 5‐CTAGCTAGCGCCCATCGTGTGATCCAA‐3 Nhe I
2 h‐CA‐R 5‐CCGCTCGAGGCCAGGAAACATCTCGGG‐3 Xho I
3 h‐CA‐F 5‐GAACACGTTTGACGCTCTTATT‐3 –
3 h‐CA‐R 5‐AATGACGGCATAGATGAAGAATA‐3 –
GAPDH‐F 5‐AGAAGGCTGGGGCTCATTTG‐3 –
GAPDH‐R 5‐AGGGGCCATCCACAGTCTTC‐3 –
Open in a new tab

Note: The underlined sequence is the restriction endonuclease recognition site.

2.3. Minigene approach

Using the Minigene approach to verify the effect of mutations on gene splicing has been widely accepted (Nakajima et al., 2016). Fragments of CACNA1F gene spanned intron 30 to intron 35 were amplified from control and patient genomic DNA (I1 and II3) respectively using 2× Phanta® Master Mix (Vazyme, Nanjing, China) and primer 2 h‐CA‐F/R (Table 1, Figure 3a). The amplicons were cloned into pcDNA3.1(+) vector at the Nhe I and Xho I sites respectively, then transformed into Trans5α chemically competent cell (TransGen, Beijing, China). Positive clones were analyzed by Sanger sequencing (Figure S4). EndoFree Mini Plasmid Kit II (TianGen, Beijing, China) was used to extract the pcDNA3.1‐CA‐wt/mut plasmids. Transient transfection studies were performed in HEK293T cells in 6‐well plates using LipoFiter (HANBIO, Shanghai, China), and total RNA was extracted by RNAsimple Total RNA Kit (TianGen, Beijing, China). Reverse transcription was performed using HiScript®IIQ RT SuperMix for qPCR (Vazyme, Nanjing, China). To analyze the splicing products, PCR was performed using primer 3 h‐CA‐F/R present in exon 31 and 34 (Table 1, Figure 3a). Five‐microliter PCR products were investigated by electrophoresis on a 2% agarose gel. Amplified bands were directly excised from the gel and purified using Gel Extraction Kit (CWBIO, Beijing, China), then analyzed by Sanger sequencing.

FIGURE 3.

FIGURE 3

Open in a new tab

Analysis of the c.3847‐2A > G mutation using minigene approach. (a) The CACNA1F gene fragment selected for minigene. The horizontal arrows showed binding sites of primer 2 h‐CA‐F/R used for expression vector constructing, and primer 3 h‐CA‐F/R used for RT‐PCR analysis. The mutation c.3847‐2A > G was marked by vertical arrow. (b) Electrophoresis of RT‐PCR products of the CACNA1F transcripts obtained from HEK293T cells transfected with pcDNA3.1‐CA‐wt and pcDNA3.1‐CA‐mut. 1‐HEK293T, 2‐HEK293T + pcDNA3.1 (empty vector), 3‐HEK293T + pcDNA3.1‐CA‐wt, 4‐HEK293T + pcDNA3.1‐CA‐mut, 5 ~ 8‐GAPDH PCR products of cDNA. (c) Directly Sanger sequencing of the RT‐PCR products from the wild‐type and the mutant minigene

2.4. X‐chromosomal inactivation assay

X‐chromosomal inactivation (XCI) patterns of II2 and I2 were analyzed according to Allen et al. (1992). In brief, genomic DNA was digested with methylation‐sensitive restriction endonuclease Hpa II. The polymorphic repeat (CAG)n regions in AR gene exon 1 from digested and undigested DNA samples were amplified by PCR with primer AR‐F/R (AR‐F: 5‐FAM‐GCTGTGAAGGTTGCTGTTCCTCAT‐3, AR‐R: 5‐TCCAGAATCTGTTCCAGAGCGTGC‐3) (Daza‐Cajigal et al., 2013), then the products were analyzed by ABI3500DX (ABI, USA). XCI ratio was calculated according to the following formula: [(d1/u1)/(d1/u1 + d2/u2)], where d1 = peak height of allele 1 (digested DNA), d2 = peak height of allele 2 (digested DNA), u1 = peak height of allele 1 (undigested DNA), and u2 = peak height of allele 2 (undigested DNA) (Butler et al., 2007). The XCI pattern was classified as random (ratio 50:50 ~ 59:41), mildly skewed (65:35 ~ 79:21), or severely skewed (≥80:20).

3. RESULTS

3.1. Clinical characteristics

There are two affected patients in this family (Figure 1a). The parents denied consanguinity. The proband (II3) is 31 years old. He had severe myopia, amblyopia since childhood, and nystagmus was present since the first weeks of life. BCVA was 0.25 and 0.15 in the right and left eye, respectively. Panoramic laser scanning fundus photography revealed typical fundus features of high myopia in both eyes, including peripapillary atrophy, peripheral retinal degeneration, and chorioretinal atrophy (Figure 2a). ff‐ERG showed severely decreased scotopic and photopic responses with almost extinguished a‐ and b‐ waves in rod‐specific, combined rod‐cone, and cone‐specific responses. Oscillatory potentials were markedly reduced and the 30‐Hz flicker responses were extinguished in both eyes (Figure 2b). Pseudo‐isochromatic plate tests indicated that he had red‐green color defect. II2 is a 33‐year‐old female who presented with hyperopia and astigmatism. BCVA was 0.4 and 0.5 in the right and left eye, respectively. Fundus photograph revealed normal. ff‐ERG in both eyes showed reduced rod‐specific responses and oscillatory potentials. The rod‐cone and cone responses were electronegative. The 30‐Hz flicker responses were mildly reduced (Figure S1).

FIGURE 2.

FIGURE 2

Open in a new tab

(a) Panoramic laser scanning fundus photography of patient II3 revealed typical fundus features of high myopia with peripapillary atrophy, peripheral retinal degeneration and chorioretinal atrophy in both eyes. (b) ff‐ERG of patient II3 showed severely decreased scotopic and photopic responses with almost extinguished a‐ and b‐ waves in rod‐specific, combined rod‐cone and cone‐specific responses. Oscillatory potentials were also markedly reduced and the 30‐Hz flicker responses were extinguished in both eyes. 1R‐right eye, 2 L‐left eye

3.2. A novel splice‐site mutation was identified in CACNA1F

We first performed WES in the proband II3, and identified two nucleotide variants in the CACNA1F (NM_005183.4) gene: c.3847‐2A > G and c.3940C > T (p.Arg1314Cys). Co‐segregation analysis showed that both of the two mutations inherited from the asymptomatic mother I2. The father I1 did not carry any of them (Figure 1b, Figure S2). There are three male individuals reported to carry the variant c.3940C > T in gnomAD. The mutation c.3847‐2A > G has not been reported in databases including gnomAD, dbSNP, ClinVar and 1000 Genomes before. Several software including NNsplice, MutationTaster and FSPLICE predicted that c.3847‐2A > G abolished the normal splice‐acceptor site of intron 32 and would result in aberrant splicing (Figure S3). Based on this information, c.3847‐2A > G was assessed as a pathogenic (PVS1 + PM2 + PP3) variant according to ACMG guidelines.

3.3. Effect of the splice‐site mutation c.3847‐2A > G in CACNA1F

To investigate the effect of c.3847‐2A > G, we performed a minigene approach. RT‐PCR analysis of the pcDNA3.1‐CA‐wt transcript showed two different bands (Figure 3b). The longer band was 250 bp and the other one was 121 bp. In contrast, the pcDNA3.1‐CA‐mut RT‐PCR products revealed only one band of 121 bp with the 250 bp band missing (Figure 3b). Sanger sequencing confirmed that the 250 bp band corresponded to the transcript with skipping of exon 32, contained exons 31, 33 and 34 of CACNA1F. The 121 bp band contained exon 31 and 34 (Figure 3c). These results suggested that c.3847‐2A > G resulted in aberrant splicing of CACNA1F exon 33, although neither the wild‐type nor mutant minigene constructs corresponded to the canonical transcript of CACNA1F including exon 32. The in‐frame deletion of exon 32 and 33 was predicted to lead to the absence of transmembrane segment IVS4 and nearby extracellular loops (DeepTMHMM, https://dtu.biolib.com/DeepTMHMM) (Figure S5).

3.4. X‐chromosomal inactivation patterns of the female carriers

Two AR gene amplified products were found before digestion of the genomic DNA from patient II2. The 287 bp (allele 1) and 293 bp (allele 2) fragments were inherited from her father I1 and mother I2, respectively. Peak height of the 293 bp fragment was significantly reduced than that of the 287 bp band after Hpa II digestion (peak height: d1 = 2398, u1 = 2804; d2 = 889, u2 = 2137). Accordingly, the paternal X‐chromosome was mildly skewed inactivation in patient II2 with an XCI ratio of 67: 33 (Figure S6). XCI assay of the mother I2 showed a random inactivation pattern (ratio 52: 48, peak height: d1 = 898, u1 = 438, d2 = 653, u2 = 346) (Figure S6).

4. DISCUSSION

We performed ophthalmic examinations and genetic testing on the proband II3 and his sister II2 and identified a novel splice‐site mutation c.3847‐2A > G in CACNA1F, which was inherited from the mother I2. Minigene showed that c.3847‐2A > G resulted in aberrant splicing of CACNA1F exon 33. However, since the short band was also detected in the wild‐type transcript, it was inadequate to determine whether the short band detected in the mutant transcript was due to the splice‐site variant or minigene approach (Zeitz et al., 2019). The mutation may result in exon 33 skipping to produce a truncated protein, or potential splice‐sites lead to the presence of termination codon, which in turn triggers nonsense‐mediated mRNA degradation (NMD). As for the absence of exon 32, a systematical screen for alternatively spliced exons in Cav1.4 transcripts from the human retina cDNA revealed that the most abundant productive splice variant was Δ32 (exon 32 skipping) (Tan et al., 2012). Although more experiments on protein level are needed to verify the function of the splice‐site mutation, we can confirm that it does lead to the loss of the normal transcript in the patients.

The relationship between genotype and phenotype of CACNA1F associated diseases is unclear. The pathogenic variants were distributed throughout the whole gene, and no mutation hotspots were found. About 230 variants were reported to be associated with icCSNB, and only a few variants with CORDX3 were reported (Mahmood et al., 2021). The variant c.3847‐2A > G identified in this study is located in intron 32, next to the splice‐site variant c.3847‐1G > A which is reported to be associated with icCSNB (Zeitz et al., 2019). However, we preferred to describe the family in our research as CORDX3 for the almost extinguished photopic and scotopic function, color vision defect, and the progressively decreased visual acuity described by the two patients. The occurrence of nystagmus and astigmatism presented in the family is atypical, but can be seen in some patients with CORDX3. Variable clinical features observed in CORDX3, AIED and icCSNB are not explainable by different CACNA1F mutations (Hauke et al., 2013; Mahmood et al., 2021). Even, the same mutation in CACNA1F in one family can cause icCSNB and AIED in different members at the same time (Boycott et al., 2000; Vincent et al., 2011). Given the significant phenotype overlapping of CORDX3 and its allelic disorders icCSNB and AIED, to provide a more precise diagnosis researchers proposed to classify the diseases by genotype, calling them CACNA1F‐associated retinal dystrophy (Men et al., 2017; Mihalich et al., 2022).

In general, most X‐linked recessive genetic disease do not lead to clinical symptoms in carrier females. However, skewed X‐chromosomal inactivation or homozygous mutations can lead to female involvement, and this phenomenon is not rare in retinal diseases (Kimchi et al., 2019; Michalakis et al., 2014). In our study, the mother in the family was asymptomatic and the daughter II2 presented mild manifestation and therefore, we performed the XCI assay. The results suggested that mildly skewed XCI was responsible for the clinical presentation of II2. Preising et al. reported two female siblings from a consanguineous Pakistani family showing high myopia and reduced visual acuity due to a novel homozygous splice‐site mutation in CANCA1F (Preising et al., 2018). Therefore, females with visual impairment should be also concerned about whether they have X linked hereditary eye diseases.

IRDs are clinically and genetically heterogeneous diseases, and the early accurate diagnosis is difficult to achieve. Birtel et al. reported one pedigree with four IRDs in which the diagnosis was confirmed by combining in‐depth retinal phenotyping and molecular genetic testing (Birtel et al., 2020). It is not rare for icCSNB patients to be misdiagnosed with other eye conditions before genetic testing (Men et al., 2017; Pasutto et al., 2018). In our research, the proband II3 was diagnosed as high myopia and amblyopia when he was about 13 years old, and II2 had never had an ophthalmic examination until they were found to carry a splice‐site mutation in CACNA1F gene recently, which facilitated the clinical diagnosis in this family. Therefore, the combination of clinical examinations and genetic testing in IRDs patients is needed for precise diagnosis, even potential therapeutic options.

5. CONCLUSION

In summary, we identified a novel variant in the CACNA1F gene causing CORDX3. This finding further expands the mutational spectrum and our knowledge of CACNA1F related disease, and highlight the importance of combining clinical examination with genetic testing for patients with IRDs.

AUTHOR CONTRIBUTIONS

Meng Du, Yang Li, and Panpan Zheng contributed to the design and operation of this study; Weili Zhao and Yuxin Zhang participated in the sample collection and processing; Xue Li and Liang Zhong were responsible for WES and data analysis; Meng Du, Haiyan Gu, and Zanchao Liu were responsible for manuscript writing and revision. Meng Du and Zanchao Liu contributed equally to this work.

FUNDING INFORMATION

This study was supported by the Medical Science Research Project of Hebei Province (grant no. 20210112).

CONFLICT OF INTEREST

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ETHICS STATEMENT

The research was approved by the Ethical Committee of Shijiazhuang Second Hospital and followed the tenets of the Declaration of Helsinki. Informed consent was obtained from all participants.

Supporting information

Figures S1‐S6

Click here for additional data file. (9MB, docx)

ACKNOWLEDGMENTS

We sincerely thank the family members for active participation in the study. We also thank Professor Chenju Yi and Wei Zhang (The Seventh Affiliated Hospital of Sun Yat‐sen University) for providing HEK293T.

Du, M. , Li, Y. , Zheng, P. , Zhong, L. , Zhao, W. , Zhang, Y. , Gu, H. , Li, X. , & Liu, Z. (2022). Identification of a novel CACNA1F mutation in a Chinese family with CORDX3. Molecular Genetics & Genomic Medicine, 10, e2060. 10.1002/mgg3.2060

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Abdelkader, E. , AlHilali, S. , Neuhaus, C. , Bergmann, C. , AlMurshed, T. , & Schatz, P. (2018). Congenital stationary night blindness associated with morning glory disc malformation: A novel hemizygous mutation in CACNA1F . Ophthalmic Genetics, 39(5), 659–661. 10.1080/13816810.2018.1498526 [DOI] [PubMed] [Google Scholar]
  2. Allen, R. C. , Zoghbi, H. Y. , Moseley, A. B. , Rosenblatt, H. M. , & Belmont, J. W. (1992). Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen‐receptor gene correlates with X chromosome inactivation. American Journal of Human Genetics, 51(6), 1229–1239. [PMC free article] [PubMed] [Google Scholar]
  3. Ayyagari, R. , Demirci, F. Y. , Liu, J. , Bingham, E. L. , Stringham, H. , Kakuk, L. E. , Boehnke, M. , Gorin, M. B. , Richards, J. E. , & Sieving, P. A. (2002). X‐linked recessive atrophic macular degeneration from RPGR mutation. Genomics, 80(2), 166–171. 10.1006/geno.2002.6815 [DOI] [PubMed] [Google Scholar]
  4. Bech‐Hansen, N. T. , Naylor, M. J. , Maybaum, T. A. , Pearce, W. G. , Koop, B. , Fishman, G. A. , Mets, M. , Musarella, M. A. , & Boycott, K. M. (1998). Loss‐of‐function mutations in a calcium‐channel alpha1‐subunit gene in Xp11.23 cause incomplete X‐linked congenital stationary night blindness. Nature Genetics, 19(3), 264–267. 10.1038/947 [DOI] [PubMed] [Google Scholar]
  5. Bergen, A. A. , & Pinckers, A. J. (1997). Localization of a novel X‐linked progressive cone dystrophy gene to Xq27: Evidence for genetic heterogeneity. American Journal of Human Genetics, 60(6), 1468–1473. 10.1086/515458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Birtel, J. , Gliem, M. , Hess, K. , Birtel, T. H. , Holz, F. G. , Zechner, U. , Bolz, H. J. , & Herrmann, P. (2020). Comprehensive geno‐ and phenotyping in a complex pedigree including four different inherited retinal dystrophies. Genes, 11(2), 137. 10.3390/genes11020137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boycott, K. M. , Pearce, W. G. , & Bech‐Hansen, N. T. (2000). Clinical variability among patients with incomplete X‐linked congenital stationary night blindness and a founder mutation in CACNA1F . Canadian Journal of Ophthalmology, 35(4), 204–213. 10.1016/s0008-4182(00)80031-9 [DOI] [PubMed] [Google Scholar]
  8. Butler, M. G. , Theodoro, M. F. , Bittel, D. C. , Kuipers, P. J. , Driscoll, D. J. , & Talebizadeh, Z. (2007). X‐chromosome inactivation patterns in females with Prader‐Willi syndrome. American Journal of Medical Genetics. Part A, 143A(5), 469–475. 10.1002/ajmg.a.31506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Daza‐Cajigal, V. , Martínez‐Pomar, N. , Garcia‐Alonso, A. , Heine‐Suñer, D. , Torres, S. , Vega, A. K. , Molina, I. J. , & Matamoros, N. (2013). X‐linked thrombocytopenia in a female with a complex familial pattern of X‐chromosome inactivation. Blood Cells, Molecules & Diseases, 51(2), 125–129. 10.1016/j.bcmd.2013.04.004 [DOI] [PubMed] [Google Scholar]
  10. Demirci, F. Y. , Rigatti, B. W. , Wen, G. , Radak, A. L. , Mah, T. S. , Baic, C. L. , Traboulsi, E. I. , Alitalo, T. , Ramser, J. , & Gorin, M. B. (2002). X‐linked cone‐rod dystrophy (locus COD1): Identification of mutations in RPGR exon ORF15. American Journal of Human Genetics, 70(4), 1049–1053. 10.1086/339620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hauke, J. , Schild, A. , Neugebauer, A. , Lappa, A. , Fricke, J. , Fauser, S. , Rösler, S. , Pannes, A. , Zarrinnam, D. , Altmüller, J. , Motameny, S. , Nürnberg, G. , Nürnberg, P. , Hahnen, E. , & Beck, B. B. (2013). A novel large in‐frame deletion within the CACNA1F gene associates with a cone‐rod dystrophy 3‐like phenotype. PLoS One, 8(10), e76414. 10.1371/journal.pone.0076414 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jalkanen, R. , Bech‐Hansen, N. T. , Tobias, R. , Sankila, E. M. , Mäntyjärvi, M. , Forsius, H. , de la Chapelle, A. , & Alitalo, T. (2007). A novel CACNA1F gene mutation causes Aland Island eye disease. Investigative Ophthalmology & Visual Science, 48(6), 2498–2502. 10.1167/iovs.06-1103 [DOI] [PubMed] [Google Scholar]
  13. Jalkanen, R. , Mäntyjärvi, M. , Tobias, R. , Isosomppi, J. , Sankila, E. M. , Alitalo, T. , & Bech‐Hansen, N. T. (2006). X linked cone‐rod dystrophy, CORDX3, is caused by a mutation in the CACNA1F gene. Journal of Medical Genetics, 43(8), 699–704. 10.1136/jmg.2006.040741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kimchi, A. , Meiner, V. , Silverstein, S. , Macarov, M. , Mor‐Shaked, H. , Blumenfeld, A. , Audo, I. , Zeitz, C. , Mechoulam, H. , Banin, E. , Sharon, D. , & Yahalom, C. (2019). An Ashkenazi Jewish founder mutation in CACNA1F causes retinal phenotype in both hemizygous males and heterozygous female carriers. Ophthalmic Genetics, 40(5), 443–448. 10.1080/13816810.2019.1681008 [DOI] [PubMed] [Google Scholar]
  15. Koschak, A. , Fernandez‐Quintero, M. L. , Heigl, T. , Ruzza, M. , Seitter, H. , & Zanetti, L. (2021). Cav1.4 dysfunction and congenital stationary night blindness type 2. European Journal of Physiology, 473(9), 1437–1454. 10.1007/s00424-021-02570-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mahmood, U. , Méjécase, C. , Ali, S. , Moosajee, M. , & Kozak, I. (2021). A novel splice‐site variant in CACNA1F causes a phenotype synonymous with Åland Island eye disease and incomplete congenital stationary night blindness. Genes, 12(2), 171. 10.3390/genes12020171 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Mäntyjärvi, M. , Nurmenniemi, P. , Partanen, J. , Myöhänen, T. , Peippo, M. , & Alitalo, T. (2001). Clinical features and a follow‐up study in a family with X‐linked progressive cone‐rod dystrophy. Acta Ophthalmologica Scandinavica, 79(4), 359–365. 10.1034/j.1600-0420.2001.079004359.x [DOI] [PubMed] [Google Scholar]
  18. Meindl, A. , Dry, K. , Herrmann, K. , Manson, F. , Ciccodicola, A. , Edgar, A. , Carvalho, M. R. , Achatz, H. , Hellebrand, H. , Lennon, A. , Migliaccio, C. , Porter, K. , Zrenner, E. , Bird, A. , Jay, M. , Lorenz, B. , Wittwer, B. , D'Urso, M. , Meitinger, T. , & Wright, A. (1996). A gene (RPGR) with homology to the RCC1 guanine nucleotide exchange factor is mutated in X‐linked retinitis pigmentosa (RP3). Nature Genetics, 13(1), 35–42. 10.1038/ng0596-35 [DOI] [PubMed] [Google Scholar]
  19. Men, C. J. , Bujakowska, K. M. , Comander, J. , Place, E. , Bedoukian, E. C. , Zhu, X. , Leroy, B. P. , Fulton, A. B. , & Pierce, E. A. (2017). The importance of genetic testing as demonstrated by two cases of CACNA1F‐associated retinal generation misdiagnosed as LCA. Molecular Vision, 23, 695–706. [PMC free article] [PubMed] [Google Scholar]
  20. Michalakis, S. , Shaltiel, L. , Sothilingam, V. , Koch, S. , Schludi, V. , Krause, S. , Zeitz, C. , Audo, I. , Lancelot, M. E. , Hamel, C. , Meunier, I. , Preising, M. N. , Friedburg, C. , Lorenz, B. , Zabouri, N. , Haverkamp, S. , Garcia Garrido, M. , Tanimoto, N. , Seeliger, M. W. , … Wahl‐Schott, C. A. (2014). Mosaic synaptopathy and functional defects in Cav1.4 heterozygous mice and human carriers of CSNB2. Human Molecular Genetics, 23(6), 1538–1550. 10.1093/hmg/ddt541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mihalich, A. , Cammarata, G. , Tremolada, G. , Pollazzon, M. , Di Blasio, A. M. , & Marzoli, S. B. (2022). Two novel CACNA1F gene mutations cause two different phenotypes: Aland eye disease and incomplete congenital stationary night blindness. Experimental Eye Research, 221, 109143. 10.1016/j.exer.2022.109143 [DOI] [PubMed] [Google Scholar]
  22. Nakajima, Y. , Meijer, J. , Zhang, C. , Wang, X. , Kondo, T. , Ito, T. , Dobritzsch, D. , & Van Kuilenburg, A. B. (2016). Altered pre‐mRNA splicing caused by a novel intronic mutation c.1443+5G > A in the Dihydropyrimidinase (DPYS) gene. International Journal of Molecular Sciences, 17(1), 86. 10.3390/ijms17010086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pasutto, F. , Ekici, A. , Reis, A. , Kremers, J. , & Huchzermeyer, C. (2018). Novel truncating mutation in CACNA1F in a young male patient diagnosed with optic atrophy. Ophthalmic Genetics, 39(6), 741–748. 10.1080/13816810.2018.1520263 [DOI] [PubMed] [Google Scholar]
  24. Preising, M. N. , Friedburg, C. , Bowl, W. , & Lorenz, B. (2018). Unexpected genetic cause in two female siblings with high myopia and reduced visual acuity. BioMed Research International, 2018, 1048317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Richards, S. , Aziz, N. , Bale, S. , Bick, D. , Das, S. , Gastier‐Foster, J. , Grody, W. W. , Hegde, M. , Lyon, E. , Spector, E. , Voelkerding, K. , Rehm, H. L. , & ACMG Laboratory Quality Assurance Committee . (2015). Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in Medicine: Official Journal of the American College of Medical Genetics, 17(5), 405–424. 10.1038/gim.2015.30 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Strom, T. M. , Nyakatura, G. , Apfelstedt‐Sylla, E. , Hellebrand, H. , Lorenz, B. , Weber, B. H. , Wutz, K. , Gutwillinger, N. , Rüther, K. , Drescher, B. , Sauer, C. , Zrenner, E. , Meitinger, T. , Rosenthal, A. , & Meindl, A. (1998). An L‐type calcium‐channel gene mutated in incomplete X‐linked congenital stationary night blindness. Nature Genetics, 19(3), 260–263. 10.1038/940 [DOI] [PubMed] [Google Scholar]
  27. Tan, G. M. , Yu, D. , Wang, J. , & Soong, T. W. (2012). Alternative splicing at C terminus of Ca(V)1.4 calcium channel modulates calcium‐dependent inactivation, activation potential, and current density. The Journal of Biological Chemistry, 287(2), 832–847. 10.1074/jbc.M111.268722 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Vincent, A. , Wright, T. , Day, M. A. , Westall, C. A. , & Héon, E. (2011). A novel p.Gly603Arg mutation in CACNA1F causes Åland Island eye disease and incomplete congenital stationary night blindness phenotypes in a family. Molecular Vision, 17, 3262–3270. [PMC free article] [PubMed] [Google Scholar]
  29. Zeitz, C. , Michiels, C. , Neuillé, M. , Friedburg, C. , Condroyer, C. , Boyard, F. , Antonio, A. , Bouzidi, N. , Milicevic, D. , Veaux, R. , Tourville, A. , Zoumba, A. , Seneina, I. , Foussard, M. , Andrieu, C. , Preising, M. N. , Blanchard, S. , Saraiva, J. P. , Mesrob, L. , … Audo, I. (2019). Where are the missing gene defects in inherited retinal disorders? Intronic and synonymous variants contribute at least to 4% of CACNA1F‐mediated inherited retinal disorders. Human Mutation, 40(6), 765–787. 10.1002/humu.23735 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figures S1‐S6

Click here for additional data file. (9MB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES