Skip to main content
International Journal of Environmental Research and Public Health logoLink to International Journal of Environmental Research and Public Health
. 2022 Oct 22;19(21):13740. doi: 10.3390/ijerph192113740

Vitamin D and Swimming Exercise Prevent Obesity in Rats under a High-Fat Diet via Targeting FATP4 and TLR4 in the Liver and Adipose Tissue

Eman Kolieb 1,*, Shymaa Ahmed Maher 2,3,*, Mohammed Nader Shalaby 4, Amnah Mohammed Alsuhaibani 5, Afaf Alharthi 6, Wael A Hassan 7,8, Karima El-Sayed 1
Editor: Forough Jahandideh
PMCID: PMC9656563  PMID: 36360622

Abstract

The prevalence of obesity has risen in the last decades, and it has caused massive health burdens on people’s health, especially metabolic and cardiovascular issues. The risk of vitamin D insufficiency is increased by obesity, because adipose tissue alters both the requirements for and bioavailability of vitamin D. Exercise training is acknowledged as having a significant and long-term influence on body weight control; the favorable impact of exercise on obesity and obesity-related co-morbidities has been demonstrated via various mechanisms. The current work illustrated the effects of vitamin D supplementation and exercise on obesity induced by a high-fat diet (HFD) and hepatic steatosis in rats and explored how fatty acid transport protein-4 (FATP4) and Toll-like receptor-4 antibodies (TLR4) might be contributing factors to obesity and related hepatic steatosis. Thirty male albino rats were divided into five groups: group 1 was fed a normal-fat diet, group 2 was fed an HFD, group 3 was fed an HFD and given vitamin D supplementation, group 4 was fed an HFD and kept on exercise, and group 5 was fed an HFD, given vitamin D, and kept on exercise. The serum lipid profile adipokines, interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-α) were analyzed, and the pathological changes in adipose and liver tissues were examined. In addition, the messenger–ribonucleic acid (mRNA) expression of FATP4 and immunohistochemical expression of TLR4 in adipose and liver tissues were evaluated. Vitamin D supplementation and exercise improved HFD-induced weight gain and attenuated hepatic steatosis, along with improving the serum lipid profile, degree of inflammation, and serum adipokine levels. The expression of FATP4 and TLR4 in both adipose tissue and the liver was downregulated; it was noteworthy that the group that received vitamin D and was kept on exercise showed also improvement in the histopathological picture of this group. According to the findings of this research, the protective effect of vitamin D and exercise against obesity and HFD-induced hepatic steatosis is associated with the downregulation of FATP4 and TLR4, as well as a reduction in inflammation.

Keywords: HFD: (high-fat diet), obesity, Exercise Physiology, Sports Exercise, Swimming Exercise Vit D: (vitamin D), FATP4: (fatty acid transport protein 4), TLR4: (Toll-like receptor 4 antibodies), T2D: (type 2 diabetes)

1. Introduction

Obesity is a chronic condition characterized by excessive adipose tissue. It can be clinically controlled by lifestyle changes, pharmacological therapy, and surgery. An unhealthy body weight and abdominal adiposity, which reflects the amount of visceral fat mass, have been correlated with the development of chronic diseases, including type 2 diabetes mellitus (T2D), cardiovascular diseases, metabolic diseases, and cancers [1,2,3,4]. Investigations have demonstrated an increased incidence of cardiovascular illnesses in obese persons compared with lean persons with no metabolic risk factors [5].

The accumulation of adipose tissue, mainly white adipose tissue, which is regarded as the most essential fat depot, is linked to a metabolic state that is chronically pro-inflammatory at a low grade [6]. Adipocytes, macrophages, and T cells have been demonstrated to trigger inflammatory responses that disrupt the metabolic balance by secreting a variety of cytokines and adipokines in response to metabolic cues [7]. The size of adipocytes appears to be a significant influence on the formation of inflammatory cytokines such as interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), and interleukin-1 beta (IL-1β) [8]. This low-grade inflammatory state is associated with insulin resistance, dyslipidemia, T2D, and cardiovascular disease [9].

Non-alcoholic fatty liver disease (NAFLD) is one of the obesity-related co-morbidities. NAFLD is often described as metabolic dysfunction-associated fatty liver disease (MAFLD) and is widely regarded as the most common form of liver disease in patients who abstain from drinking alcohol. The etiology of NAFLD is complex, with multiple variables implicated, including insulin resistance, obesity, and dyslipidemia [10,11,12]. Eating HFD over the long term is commonly associated with hepatic steatosis due to triglyceride (TG) accumulation and lipid dysregulation combined with increased oxidative stress and pro-inflammatory cytokines. In numerous rat models, HFD increased the body weight and adiposity because of its high-energy density [13].

Obesity, which raises the risk of vitamin D deficiency, might affect one’s vitamin D status. Adipose tissue is also a major factor in determining vitamin D needs and bioavailability. For many years, the association between obesity and the vitamin D status has been well known [14,15,16]. It has been observed in people of all races and sexes, as well as men and women of all ages [17]. Vitamin D deficiency may negatively impact glycemia, whereas vitamin D supplementation has been shown to restore normal glucose metabolism [18] and lower rates of metabolic syndrome [14]. A potentially non-pharmacological approach to avoiding obesity and weight gain is exercise training and improved physical activity. Exercise can reduce the deleterious effects of an HFD on adipose tissue, decrease inflammation in visceral white adipose tissue, and improve the lipid profile. Intermittent swimming exercise could decrease adiposity in HFD rats. Exercise could also decrease white adipose tissue inflammation in HFD model of obesity [19,20].

In the present study, we aimed to evaluate the effects of both vitamin D supplementation and swimming exercise on regulating obesity, adiposity, and hepatic steatosis. We also examined their effects on the serum lipid profile, degree of inflammation, adipokine serum levels, and expression of FATP4 and TLR4 in both adipose tissue and the liver.

2. Materials and Methods

2.1. Experimental Animals and Grouping

Eight-week-old male albino rats (n = 30) weighing 180–200 gm were utilized in the research. The rats were acquired from the rat’s animal breeding house of the Faculty of Medicine at Suez Canal University, Egypt. Rats were preconditioned and housed in five rat cages for 1 week at ambient temperature (22 ± 2 °C) with relative humidity (55 ± 10%) and a 12 h light/dark cycle. During this week, rats obtained water and a standard chow diet ad libitum.

2.2. Ethical Statement

The animal experiments were performed following the National Institutes of Health (NIH) ethical guidelines for the care and use of laboratory animals (NIH; Publication No. 85-23, revised 1985). This work was approved by the Ethical approval committee from the Suez Canal University (SCU) Animal Ethics Committee on 11 October 2020 (Protocol number: 4313). Before samples were collected, the animals were treated with ketamine/xylazine via an intraperitoneal injection, followed by cervical dislocation to minimize pain.

2.3. Diets

The Al-Gomhoureya Company provided the standard rat chow diet, which had 306.2 kcal per 100 grammes, 48.8 percent of its composition as carbohydrates, 21 percent of its composition as protein, and 3 percent of its composition as fat. The high-fat diet was modified in accordance with the description that was supplied by Levin and Dunn-Meynell (2002). The high-fat diet has a total caloric content of 414.0 kcal/100 g, of which 43.0 kcal come from carbohydrates, 17.0 kcal from protein, and 40.0 kcal come from fat. All the ingredients of the diet were mixed and prepared as pellets. The rat chow pellet represented 68% of the diet, while instant milk powder makes up 20%, maize oil makes up 6%, and ghee makes up 6% [21,22].

(Ghee is clarified butter; it’s more concentrated in fat than butter, as its water and milk solids have been removed.)

2.4. Experimental Design

2.4.1. Groups

Thirty male albino rats were classified into the following groups:

CTL (normal control group) (n = 6): Control (normal diet): Rats were fed with a normal rat chow diet for 12 consecutive weeks.

HFD (high-fat diet group): (n = 6): Rats were supplied with a high-fat diet (HFD) for 12 weeks without treatment [23].

Vitamin D treated group: (n = 6) Rats were supplied with a HFD for 6 consecutive weeks, then received a concomitant therapeutic dose of vitamin D (500 IU/kg) by oral gavage for 6 weeks [24]. Vitamin D was purchased from Sigma Pharmaceutical Industries Agency, Nasr City, Egypt.

Swimming exercise treated group: (n = 6) Rats were supplied with a HFD for 6 consecutive weeks then underwent concomitant swimming exercise for 6 consecutive weeks (30 min/day) [25].

Combined (exercise+ vitamin D) treated group: (n = 6):

Rats were fed with HFD for 6 consecutive weeks, and then underwent concomitant daily swimming exercise (30 min/day) and vitamin D (500 IU/kg) by oral gavage for 6 consecutive weeks.

2.4.2. Swimming Exercise

The swimming training was accomplished in a glass water tank at 32 °C without a load, (dimensions: 100 cm × 40 cm × 60 cm). The water depth was adjusted to ensure the free swimming of rats. The period of the first swimming exercise was adjusted to 15 min, which was increased daily by 5 min to reach total time of 30 min. For 6 weeks, rats in the swimming exercise treated group and combined treated group swam for 30 min every day, five days a week [26].

2.5. Measurements of Obesity-Associated Parameters

Body Weight Gain

An electric scale was used to determine the bodyweight of each rat in each group prior to the beginning of the investigation (Day 0), as well as after the conclusion of the treatment after 12 weeks. The body size was assessed at the end of the study by measuring the length from the nose to the anus. The following formula was utilized to estimate the Lee’s obesity index: Lee’s index = cube root of body weight (g)/body size (cm) [27].

2.6. Sample Collection

After a fasting period of 12 h, the rats were given an intraperitoneal injection of ketamine and xylazine to induce anesthesia at the conclusion of the 12th week of the program. Blood samples were taken from the heart. The serum was obtained by centrifuging the blood for 15 min at 800× g at 4 °C. After scarification, the liver was separated, weighed, and kept frozen at −80 °C.

2.7. Adiposity Index

Following the process of scarification, adipose tissue was removed from the epididymal, visceral, and retroperitoneal pad and then weighed. The adiposity index was calculated by taking the total fat weight of the epididymis, viscera, and retroperitoneum and dividing that number by the subject’s body weight multiplied by 100. The data were presented in the form of a percentage of total body fat [27].

2.8. Biochemical Analysis

2.8.1. Lipid Profile

The concentration of serum triglycerides (TGs) was assessed following the procedure of Fossati and Prencipe [28] using commercial kits(Cat. no. TR 20 30). The concentration of cholesterol in the serum was measured using a technique developed by Allian et al. [29] using commercial kits (Cat. no. CH 12 20). The concentration of serum HDL-cholesterol was evaluated in accordance with the method of Burestein et al. [30] using commercial kits (Cat. no. CH 12 30). The concentration of serum LDL-cholesterol was measured following Wieland and Seidel [31] using commercial kits (Cat. no. CH 12 31). All kits were purchased from Biodiagnostic (El Omraniya, Egypt).

2.8.2. Liver Enzymes

The serum levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were assessed utilizing an automatic analyzer (Olympus AU600, Tokyo, Japan) and proper commercial kits.

2.8.3. Inflammatory Markers

Serum TNF-α and interleukin-6 levels were evaluated utilizing the rat TNF-α ELISA Kit (ab100784) and rat IL-6 ELISA Kit (ab100772), respectively, purchased from Abcam according to the manufacturer’s instructions.

2.8.4. Hormones

Adipokines

Serum was collected in Eppendorf tubes and was used for measuring leptin, and ghrelin using a specific ELISA kit (Cat. No. EZRGRA and RAB0335, respectively, purchased from Sigma-Aldrich, St. Louis, MI, USA). The level of serum adiponectin was evaluated utilizing a rat Adiponectin ELISA (Cat. No. Ab239421, Abcam, Cambridge, UK), following the manufacturer’s instructions.

Insulin

Serum insulin concentration was determined utilizing insulin ELISA kit (Cat. No. ERINS, Invitrogen Bioservices India Pvt. Ltd., Bengaluru, India), according to the manufacturer’s instructions.

2.9. Quantitative Realtime PCR of FATP4 in Hepatic and Adipose Tissue

The RNeasy Mini Kit was used to extract RNA from hepatic and adipose tissue. (cat no 74104, Qiagen, Hilden, Germany). Reverse transcription followed by mRNA expression level by SYBR Green method (Cat. No. 208052, Qiagen, Germany). The sequence of the used primers is mentioned in (Table 1). The relative expression is being calculated according to Livak equation 2−∆∆Ct [32].

Table 1.

The primer sequences of RT-PCR of hepatic and adipose tissue FATP4.

Primer Sequence
FATP4 Forward: 5′GCACTCTCACTTCCTCTTGC3′
Reverse: 5′GCAGGAAAGGAACAATGCCA3′
GAPDH Forward: 5′CCCCATTTGATGTTAGCGGG3′
Reverse: 5′AACGACCCCTTCATTGACCT3′

The primer was designed using primer3web version 4.1.0 & NCBI and tested in silico using Sequence manipulation suite (SMS) version 2, PCR Primer Stat tool & UCSC In silico PCR and in silico PCR amplification tool.

2.10. Histological Analysis

The sections have been fixed with formalin (10%) and inserted into paraffin. From each block, 3 µm thickness sections were mounted to the slide of glass, discolored by hematoxylin and eosin (H&E) stain, and analyzed. Slides were subsequently scanned, and images were processed using the ImageJ scanner and viewer software (LOCI, University of Wisconsin, Madison, WI, USA).

2.10.1. Histopathological Study of Liver Tissue Sections

Liver tissue sections were examined, and staging and grading of liver were graded according to the Supplementary Tables S1 and S2 [33].

2.10.2. Histopathological Study of Adipose Tissue Sections

Adipose tissue sections were analyzed by determining the average number of adipocytes and each adipocyte area (µm2) in the field (40×). Adipocytes were evaluated in four different fields, and the average number and area were determined. Data were expressed as mean ± SD.

2.10.3. Immunohistochemical Analysis

Selected paraffin blocks were cut into 4 µm thickness sections and were mounted to the glass slides. The sections were subsequently incubated with primary anti-Toll-Like receptor 4 (TLR4) antibodies (Anti-TLR4 antibody, ab22048; Abcam; Cambridge, UK), followed by the proper secondary antibody (Goat anti-Rabbit IgG (H + L) Secondary Antibody, HRP, Abcam; Cambridge, UK). All sections were counterstained for 30 s with hematoxylin before mounting and dehydration.

2.10.4. Immunohistochemical Evaluation

The cells were considered positive if they exhibit a cytoplasmic reaction to TLR4 antibody. Modified Allred scoring system guidelines have been applied to semi-quantitatively assess the positive-stained sections [34]. The counts of the positive cells have been quantified in three different high-power fields (hpf). The scores of the positive cells’ percentage (0–5) and the cytoplasm staining intensity (0–3) were recorded to provide the final scores. The positive cells percentage was calibrated as follows: score 1-less than 10% positive cells; score 2- for 10–20% positive cells; score 3- for 20–50% positive cells; score 4- for 50–70% positive cells; and score 5-more than 70% positive cells. The SMA staining intensity was recorded as: score 1-weak; score 2-medium; and score 3-strong [34].

2.11. Statistical Analysis

The present work was a simple random allocation experimental study. Random allocation was done by using computer-generated random numbers.

The sample size was determined by using the equation of the difference between two means:

Sample size/group = 2 σ2 (Zα + Zβ)2/Δ2

where Zα: the value of standard normal distribution for type I error probability for two sided test (0.05/2) = 1.96. Zβ: The value of standard normal for the desired statistical power (90%) = 1.282. Δ: The lowest mean difference (u/mL) of HDL (as a one of lipid profile tests) between any two studying groups. σ: The within group standard deviation (u/ mL).

Sample size/group = 2 σ 2 (Zα + Z β)2/∆2 = 2 × 0.05 × 2 (1.96 + 1.282)2/(0.85 − 0.26)2 = 1.296/0.14 = 6 rats/group [35] The calculated sample size was 6 rats/group. This sample size was included in the protocol of the study that was approved by the Ethical approval committee from the Suez Canal University (SCU) Animal Ethics Committee on 11 October 2020 (Protocol number: 4313).

The present work was a simple random allocation experimental study. Random allocation was done by using computer-generated random numbers. All data were statistically evaluated using a statistical package for the social sciences (SPSS) program (windows version number 22). All values were presented as means ± SD. The parametric data derived from three groups, or more were evaluated by one-way analysis of variance (ANOVA) followed by a post hoc Tukey’s test. The Non-parametric data, as well as discrete data from histologic scoring, were analyzed using the Kruskal–Wallis test followed by the Dunn test. Data were considered statistically significant with a p-value < 0.05.

3. Results

3.1. Measures of Adiposity

In this research, there was no discernible variation in the starting body weights of the animals across the various groups. When compared with the normal control group, the HFD group had a statistically significant rise in total body weight. The groups that were given vitamin D (D-group), kept on exercise (E-group), or given vitamin D and kept on exercise (combination group) demonstrated a significant decrease in the final body weight compared with the HFD group. As indicated in Table 1, the combination group had a significant reduction in final body weight compared with the normal control group, and the reduction was non-significant compared with the D-group and E-group.

The HFD group had a considerably larger body size compared with the normal control group. Conversely, the E-group had a significantly smaller body size than the HFD group. The difference in body size among the D-group, combination group, and HFD group was not statistically significant. The E-group showed a significant reduction in body size compared with the control group (see Table 2).

Table 2.

Effects of vitamin D, swimming exercise, combined (vitamin D + exercise), and HFD on body weight, body size, fat weight, adiposity index and Lee’s index.

Group Variable (Mean ± SD) Normal Control HFD Vitamin D Exercise Treated Combined
Initial weight (gm) 232.5 ± 19.48 210 ± 22.36 219.17 ± 23.54 224.17 ± 18 219 ± 22.74
Final weight (gm) 249.16 ± 18.28 418.57 ± 31.72 ** 363.33 ± 13.29 # 339 ± 30 ## 312 ± 13.4 *##
Body size (cm) 22.83 ± 1.72 27 ± 1.15 ** 26.16 ± 1.33 24.33 ± 1.03 # 25.8 ± 0.84 **
Fat weight(gm) 0.5 ± 0.5 20.57 ± 5.44 ** 11.42 ± 2.53 ## 9.08 ± 1.02 ## 9.70 ± 0.84 ##
Adiposity Index 0.21 ± 0.22 4.9 ± 1.27 ** 3.16 ± 0.78 ## 2.70 ± 0.30 ## 3.11 ± 0.24 ##
Lee’s obesity index 0.27 ± 0.02 0.28 ± 0.02 0.27 ± 0.01 0.29 ± 0.01 0.26 ± 0.02

Data presented as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01 & * p, # p ˂ 0.05 (*) compared to the normal control group, (#) compared to HFD. HFD = high fat diet.

The HFD group demonstrated a statistically significant increase in fat weight compared with the normal group. When compared with the HFD group, the D-group, E-group, and combination group all had a substantial reduction in fat weight. The fat weight of the E-group demonstrated a non-significant difference compared with the D-group and the combination group (see Table 2).

The adiposity index for the HFD group was significantly greater than for the regular control group. The D-group, E-group, and combination group all had a statistically significant decrease in the adiposity index compared with the HFD group. The E-group exhibited the greatest decrease in the adiposity index; however, this decrease was not statistically significant in comparison with the D-group and combination group (p = 0.81 and 0.89, respectively). When comparing the various groups, there were no discernible variations in the Lee’s obesity index of any of the animals (see Table 2).

3.2. Lipid Profile

The HFD group had a significant increase in low-density lipoprotein (LDL), very low density lipoprotein (VLDL), serum total cholesterol, and TG levels compared with the control group. The D-group, E-group, and combination group had a significant decrease in LDL, VLDL, serum total cholesterol, and TG levels in comparison with the HFD group. The combination group had a non-significant decrease in the serum total cholesterol level and VLDL level in comparison with the difference normal control group. The combination group had a significant reduction in the serum total cholesterol level in comparison with the D-group and E-group. Further, the combination group demonstrated a significant decrease in VLDL levels compared with the D-group and a non-significant reduction in comparison with the E-group. Regarding LDL levels, the combination group showed a significant reduction when compared with the control group. The reduction was significant in comparison with the D-group and E-group. Regarding TG levels, the combination group exhibited a significant decrease compared with the control group, D-group, and E-group (Table 3).

Table 3.

Illustrates the lipid profile results of the different groups, including total cholesterol, HDL, LDL, VLDL, and triglycerides.

Group Variable (Mean ± SD) Normal Control HFD Vitamin D Exercise Combined
Total cholesterol (mg/dL) 56.70 ± 6.01 231.40 ± 33.28 ** 115.83 ± 21.54 ## 97.50 ± 15.41 ## 64.29 ± 10.18 ##
HDL (mg/dL) 52.50 ± 9.35 17.14 ± 3.93 ** 29.16 ± 3.76 # 32 ± 3.76 # 40 ± 10.81 *##
LDL (mg/dL) 59.90 ± 12.50 149.14 ± 8.89 ** 122.83 ± 3.59 ## 112.97 ± 4.95 ## 93.71 ± 5.6 **##
VLDL (mg/dL) 29.50 ± 3.72 47.43 ± 3.10 ** 38 ± 1.87 ## 35.17 ± 1.10 ## 31.50 ± 3.35 ##
TG (mg/dL) 140.50 ± 5.71 207.85 ± 9.11 ** 190 ± 2.82 ## 177.67 ± 2.80 ## 167.14 ± 4.80 ##**

Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01 & * p, # p ˂ 0.05 (*) compared to the normal control group, (#) compared to HFD. HFD = high fat diet.

In comparison with the control group, the HFD group demonstrated a statistically significant decrease in the blood high-density lipoprotein (HDL) level. The D-group, E-group, and combination group demonstrated a substantial upregulation in the serum HDL level. In comparison with the HFD group, the D-group and E-group exhibited a substantial increase in blood HDL levels. Nevertheless, the combination group had a non-significant upregulation in HDL levels. At the same time, the difference was significant compared with the control group (see Table 3).

3.3. Liver Enzymes Levels

The serum aspartate transferase (AST) and alanine transaminase (ALT) concentrations were measured to see if vitamin D and exercise might prevent HFD-induced liver damage.

In the HFD group, both the ALT and AST levels showed a significant elevation in comparison with the control group. Regarding the ALT, the D-group exhibited a non-significant decrease in comparison with the HFD group. In contrast, the E-group and combination group showed a significant reduction in comparison with the HFD group. The combination group demonstrated a significant decrease in comparison with the D-group and a non-significant reduction in comparison with the control group and E-group (Table 4).

Table 4.

Illustrates the liver enzymes, ALT, and AST of the studied groups.

Group Variable
(Mean ± SD)
Normal Control HFD Vitamin D Exercise Combined
ALT (mg/dL) 19.8 ± 5.80 31.4 ± 5.20 ** 26.80 ± 2.20 21.20 ± 1.92 ## 18 ± 3.80 ##
AST (mg/dL) 25.60 ± 7.20 39.80 ± 1.50 ** 31.40 ± 3.00 # 27.6 ± 2.40 ## 20.8 ± 2.77 ##

Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01 & # p ˂ 0.05 (*) compared to the normal control group, (#) compared to HFD. HFD = high fat diet.

Regarding the AST, the D-group revealed a significant decrease in comparison with the HFD group. The E-group and combination group showed significant reductions in comparison with the HFD group. In comparison with the D-group and combination group, the reduction was statistically significant. On the other hand, the reduction was not statistically significant compared with the control group, E-group, and combination group (see Table 4).

3.4. Inflammatory Markers Levels

In our investigations, the impact of an HFD on levels of inflammatory markers was assessed. The HFD group exhibited upregulation in levels of the inflammatory markers TNF-α and IL-6 compared with the control group. In comparison with the HFD group, serum levels of TNF-α and IL-6 were significantly lower in the D-group, E-group, and combination group. When compared with each other, individual modality treatment was associated with a non-significant difference regarding serum IL-6 and TNF-α. However, the combination group had a substantial reduction in serum TNF-α and IL-6 compared with the HFD group and E-group (Figure 1).

Figure 1.

Figure 1

Inflammatory markers of the studied groups, including TNF-α and IL-6. Values are expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01, in comparison to the control group, (#) in comparison to HFD.

3.5. Adipokines Levels

The circulating levels of adipokines in the HFD group were measured; there was a significant reduction in levels of ghrelin and serum adiponectin but a significant increase in levels of serum leptin in comparison with the control group. The D-group, E-group, and combination group showed a significant rise in serum adiponectin and ghrelin levels and a decrease in serum leptin levels compared with the HFD group (p < 0.01). The difference in adiponectin, ghrelin, and leptin levels between individual treatment modalities was non-significant (p = 0.23, 0.69, 0.42, respectively). When compared with the D-group and E-group, the combination group exhibited a statistically significant elevation in serum adiponectin levels.

Regarding ghrelin, the elevation of it in the combination group was significant compared with the D-group, while it was non-significant compared with the E-group (p = 0.13). The reduction in leptin levels in the combination group was significant compared with the D-group and E-group (Figure 2).

Figure 2.

Figure 2

Adipokines levels of the studied groups include adiponectin, ghrelin, and leptin. Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01, and # p ˂ 0.05 (*) in comparison to the control group, (#) in comparison to HFD.

3.6. Insulin Level

Obesity has been correlated with insulin resistance and elevations in insulin levels. In the present investigation, those who followed the HFD diet had a statistically significant higher level of blood insulin in comparison with those who followed the usual control diet. In comparison with the HFD group, the levels of blood insulin in the D-group, E-group, and combination group were substantially decreased. The combination group showed an insignificant decrease in the serum insulin level in comparison with the normal control group and E-group. In addition, the decrease was considerable in comparison with the D-group (Figure 3).

Figure 3.

Figure 3

Insulin levels of the studied groups. Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01 in comparison to the control group, (#) in comparison to HFD.

3.7. Expression of FATP4 in Tissues

The HFD group showed a significant increase in FATP4 mRNA expression levels in liver and adipose tissues as compared with the control group. The D-group, E-group, and combination group exhibited a significant decrease in FATP4 mRNA expression levels in liver and adipose tissues as compared with the HFD group. The combination group demonstrated a significant downregulation in liver tissue levels of FATP4 mRNA expression in comparison with the control group, D-group, and E-group. In adipose tissue, a non-significant downregulation in FATP4 expression was seen in the combination group in comparison with the control group and a significant downregulation was seen in comparison with the D-group and E-group (Figure 4).

Figure 4.

Figure 4

FATP4 expression level in hepatocytes and adipocytes in the studied groups. Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01, in comparison to the control group, (#) in comparison to HFD.

3.8. Histopathological Evaluation of Adipose Tissue and Liver Tissues Sections

The adipose tissue, in the control group showed uniform adipocytes separated with thin fibrous septa. The HFD group exhibited a significant elevation in the size of adipocytes as compared with the normal group. The D-group and E-group showed a significant reduction in the size and number of their adipocytes compared with the HFD group. The combination group had a significant reduction in the size of its adipocytes compared with the HFD group and control group, as shown in Figure 5A–E and Table 5.

Figure 5.

Figure 5

Figure 5

Figure 5

Histopathological evaluation of liver and adipose tissue sections.

Table 5.

Histopathological evaluation of adipose tissue sections.

Group Variable
(Mean ± SD)
Normal Control HFD Vitamin D Exercise Combined
Size of adipocytes (mm2) 647.75 ± 70.9 950.7 ± 154.6 * 634 ± 22.6 ## 465.7 ± 186.8 ## 436.2 ± 91.8 *##
Number of adipocytes 57.2 ± 6 62.2 ± 6.8 51.5 ± 1.2 ## 53 ± 2.4 ## 47.5 ± 2 **##

Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01, and * p ˂ 0.05 (*) in comparison normal control group, (#) compared to HFD.

Regarding liver tissue, the control group showed normal liver tissue and uniform hepatocytes with no evidence of pathological changes. There were no fatty changes, no lytic necrosis, and no hydropic degeneration (Figure 5A, Table 6). In the HFD group, there was evidence of pathological changes in the liver tissue, such as multiple foci of lytic necrosis, marked fatty changes, and marked hydropic degeneration (see Figure 5B, Table 6). The D-group had uniform hepatocytes with mild fatty changes, mild lytic necrosis, and hydropic degeneration (see Figure 5C, Table 6). The E-group showed uniform hepatocytes with mild fatty changes, mild lytic necrosis, and hydropic degeneration (see Figure 5D, Table 6). The combination group had normal liver tissue and uniform hepatocytes with no evidence of pathological changes. There were no fatty changes, no lytic necrosis, and no hydropic degeneration (see Figure 5E, Table 6).

Table 6.

Histopathological evaluation of liver tissue sections.

Group Variable
(Mean ± SD)
Normal Control HFD Vitamin D Exercise Combined
Liver tissue
Grading
0 1 (One focus of lytic necrosis)
Marked fatty change,
Marked hydropic degeneration
0
No fatty changesMild hydropic degeneration
0
Mild fatty change,
Mild hydropic degeneration
0

3.9. Immunohistochemical Evaluation of Adipose Tissue and Liver Tissues Sections

Immunohistochemical staining of TLR4 in adipose tissue and liver revealed that there was negative expression of TLR4 in adipose tissue and liver of control group while in HFD group there was significant diffuse positive expression. The D-group and E-group had a significant decrease in the expression of TLR4 in both liver and adipose tissue. The combined treatment group showed negative expression of TLR4 in both liver and adipose tissue as shown in Figure 6, Figure 7 and Figure 8 and Table 7.

Figure 6.

Figure 6

Level of TLR expression by immunohistochemistry in the studied groups in hepatocytes and adipocytes. Values are expressed as mean ± SD, statistically significant difference, ## p ˂ 0.01, and * p, # p ˂ 0.05 (*) compared to normal control group, (#) compared to HFD. HDF = high fat diet.

Figure 7.

Figure 7

TLR expression by immunohistochemistry in the five studied groups in hepatocytes.

Figure 8.

Figure 8

TLR expression by immunohistochemistry in the five studied groups in adipocytes.

Table 7.

Immunohistochemical scoring for TLR4 expression in adipocytes and hepatocytes.

Group Variable (Mean ± SD) Normal Control HFD Vitamin D Exercise Combined
TLR positive cells in hepatocytes 0 19.6 ± 0.5 ** 6 ± 1 ## 8.6 ± 1.5 *## 0 ##
Staining intensity 0 Moderate Score 2 Weak Score 1 Weak Score 1 0
Total score 0 4 2 2 0
Group variable (mean ± SD) Normal group HFD group Vitamin D treated group Exercise treated group Combined treated group
TLR positive cells in adipocytes 0 57.6 ± 2.5 ** 8.6 ± 3 ## 9.3 ± 1.1 ## 0 ##
Staining intensity 0 Strong Score 3 Weak Score 1 Weak Score 1 0
Total score 0 7 2 2 0

Data expressed as mean ± SD, statistically significant difference, ** p, ## p ˂ 0.01, and * p ˂ 0.05 (*) in comparison to the control group, (#) in comparison to HFD.

4. Discussion

Obesity is associated with several life-threatening conditions and is linked to increased mortality and morbidity rates. An HFD, in general, promotes obesity-related co-morbidities such as metabolic syndrome, which encompasses a pro-inflammatory and pro-thrombotic state, atherogenic dyslipidemia, cardiovascular disease, high blood pressure, oxidative stress, and central obesity [36,37,38]. NAFLD is one of the obesity-related co-morbidities. It is associated with many liver disorders, including cirrhosis, severe fibrosis, nonalcoholic steatohepatitis (NASH), and simple steatosis [10,11,39].

Vitamin D and exercise are beneficial in obesity management, but the potential mechanistic relevance of exercise and supplementation of vitamin D in obesity and obesity-related co-morbidities is now being contested. As a result, this research was performed to explore their effect on FATP4 and TLR4 in adipose tissue and liver tissue in a rat model of HFD-induced obesity.

The major findings of the present study are summarized in the subsequent points. (1) HFD was associated with increased body weight and significant elevation in the profiles of lipids, including TG, total cholesterol, LDL, VLDL cholesterol, and HDL cholesterol, along with the elevation of inflammatory markers. Furthermore, there was increased expression of FATP4 and TLR4 in adipose tissue and liver tissue in HFD-fed rats, which was associated with significant hypertrophy in the size of adipocytes and fatty degeneration of the liver hepatocytes, demonstrating steatosis. (2) The D-group, E-group, and combination group showed improvement in the findings as mentioned earlier compared with the HFD group with decreased FATP4 and TLR4 expression. (3) The combination group outperformed the individual modalities, with a more pronounced decrease in FATP4 and TLR4 expression associated with improvement in fatty liver degeneration and adipocyte mass.

Dysregulation of adipose fatty acid metabolism is a substantial factor in developing obesity and related metabolic diseases. This imbalance is primarily caused by differences in the rates of long-chain fatty acid (LCFA) influx, export, and metabolism by adipose tissue [40,41,42]. The FATP family is made up of six members (FATP1 to 6), with FATP4 displaying tissue-specific expression in the liver, skin, brain, adipose tissue, heart, and skeletal muscle [43]. It is the only FATP located in the small intestine [44,45]. The physiological role of FATP4 in most of these tissues is unknown. Multiple investigations found an enhanced cellular inflow of fatty acids to result from overexpression of FATP4 in several cultured cell lines [46,47,48]. FATP4 was first thought to be a transmembrane transport protein [49].

Evidence suggests that FATP4 is confined to the endoplasmic reticulum and other intracellular compartments, implying that FATP4 may play an essential role in intracellular LCFA processing [48,50,51]. FATP4 has acyl-CoA synthetase activity, which allows it to catalyze and activate the fatty acid metabolism (most likely the synthesis of phospholipids and TGs) [44]. The enzymatic activity of FATP4 has been correlated with vectorial acylation (i.e., the triggering of lipid uptake [50]), which indirectly increases LCFA uptake. These LCFAs are subsequently utilized for energy production and cellular respiration. As the quantity of intracellular free LCFAs decreases, the cell takes up more LCFAs [52,53].

Adipocytes with FATP4-knockdown revealed increased basal lipolysis, implying a function in the esterification of fatty acid in 3T3-L1 adipocytes. Because of their different cellular locations and activities, FATP4 and FATP1 influence the size of TG lipid droplets and other complex lipid pools. These activities have been linked to insulin resistance and obesity development, indicating that FATP4 may act in adipocytes through LCFA re-esterification following lipolysis [40]. FATP4 expression was upregulated in acquired obesity, regardless of genetic variables. Furthermore, expression levels of CD36 and FATP4 were linked to obesity and insulin resistance. This was compatible with our finding regarding FATP4 increased expression and elevated lipid profile indices in the current study [54].

FATP4 has been linked to the development of NAFLD by findings showing that increased FATP4 leads to the dysregulation of fatty acids [55]. Previous work regarding the contribution of CD36 and FATP4 to hepatic LCFA uptake as a possible player in NAFLD or NASH found that overexpression of FATP2 and FATP4 in cells was associated with elevated oleate uptake in comparison with control cells. Free LCFA concentrations in the intracellular and extracellular domains could be created as a result of the proposed enhanced enzyme activity; this reduced the intracellular pool of free LCFAs and affirmed that at least FATP2 and FATP4 had a significant impact on the uptake of LCFAs [56]. FATP4 expression was elevated in the adipose tissue and liver tissue of the HFD group, as shown in the current study.

TLR4 represents the link between fatty acids, immunity, and inflammation and has been linked to the pathogenesis of obesity, insulin resistance, and NAFLD. Obesity-induced inflammation is mostly triggered by the TLR4 signaling pathways, and it leads to the production of TNF-α pro-inflammatory cytokines. Activation of the TLR4 signaling pathway has been implicated in alcoholic and non-alcoholic liver disease and is regarded as the major pathway for the development of NAFLD and NASH [57,58,59,60,61].

In the current study, the applied model provided the typical features of NASH in humans. In this regard, it was shown that there was a substantial increase in dyslipidemia and body weight and amplified liver function, together with the dysfunction of adipocytes and the increase of serum TNF-α and leptin and a noticeable decrease in adiponectin levels and elevated expression of TLR4 in the adipose tissue and liver. FATP4 and TLR4 might be employed as possible medications for obesity and other obesity-related conditions, such as steatosis of the liver. To the best of our knowledge, this is the first study to show the effect of vitamin D and exercise on obesity and one of the obesity-related liver diseases in terms of the influence of FATP4.

Vitamin D impacts several organic processes, including adipose tissue morphological function and lipid metabolism. Obesity reduces vitamin D bioavailability. Previous research on the causal relationship between obesity and vitamin D deficiency (VDD) discovered that VDD causes obesity and has been connected to hyperglycemia, hyperinsulinemia, insulin resistance, impaired β-cell function, and elevated homeostatic model assessment for insulin resistance (HOMA-IR) and intrahepatic lipid concentrations. Vitamin D has a beneficial effect on insulin production, insulin receptor expression, and insulin sensitivity. It enhances signal transduction by modulating extracellular calcium, boosting insulin-dependent glucose oxidation, and decreasing systemic inflammation. In obese people and animals, vitamin D improved HDL cholesterol levels while lowering hypertriacylglycerolemia levels in adipose tissue [62,63,64,65,66,67].

Vitamin D therapy reduced body weight gain and abdominal fat deposition, while it enhanced the plasma lipid profile and insulin sensitivity in obese rats that had been fed a Western diet. As demonstrated in our work, these effects were followed by decreased leptin and circulating TNF-α levels [48]. Pro-inflammatory adipokines IL-6 and TNF-α are produced and released when vitamin D deficiency occurs, resulting in an increase in the amount of fat in the body. Vitamin D deprivation enhances the expression of adipogenic genes and reduces the extent of mRNA for some genes involved in the metabolism of fatty acids including carnitine palmitoyl transferase1 (CPT1), peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC1), very long chain acyl-CoA dehydrogenase (VLCAD), peroxisome proliferator-activated receptor (PPAR), and long-chain acyl-CoA dehydrogenase, in addition to reducing AMPK/SIRT1 activity [54].

Previous studies suggested that vitamin D reduces TG levels and lipid droplet accumulation in NAFLD produced by an HFD. Additionally, it lowers high levels of liver enzymes in a mechanistic manner by reducing lipogenesis, increasing lipid oxidation, mitigating the effects of oxidative stress, and lowering pro-inflammatory marker levels. There was a reduction in the expression of SREBP-1c and its target genes, fatty acid synthase and acetyl CoA carboxylase, which demonstrated that vitamin D increased the production of antioxidant and anti-inflammatory chemicals. Simultaneously, it triggered the upregulation of hepatic mRNA expression of PPARα and CPT-1 and reduced leptin, induced adiponectin/AdipoR1 with suppression of the p53–p21 pathway of caspase-3/apoptosis, and increased SMP-30 levels [68,69,70,71,72].

Regarding the effect of exercise on obesity and obesity-related co-morbidities, it is well documented that the mechanism underlying this beneficial effect is still under debate. Exercise improves lipid profiles and enhances insulin sensitivity. In a trial to uncover the mechanism behind the beneficial effect of exercise, Jordy and colleagues performed lipidomic profiling in the skeletal muscle and liver of exercise-trained mice after the induction of insulin resistance and obesity by high-fat feeding for 4 weeks. They found that the exercise decreased diacylglycerol and cholesterol esters in the livers of trained mice. Further, an increased ratio of phosphatidylcholine (PC) to phosphatidylethanolamine (PE) was correlated with membrane integrity and associated with hepatic disease progression. A concomitant decrease was noted for the liver’s fatty acid transporters FATP4 and CD36 [73]. This was coordinated with our finding regarding FATP4 expression in the liver. To the best of our knowledge, there are no available data on the effect of exercise on the expression of FATP4 in adipose tissue. However, exercise may have its beneficial effect by reducing such expression, as reported in the current study. Our results suggested that exercise promotes a coordinated decrease in the entry of fatty acid into hepatocytes and adipose tissue. In lipid accumulation at ectopic sites, involving the liver and skeletal muscle, adipose tissue is a common result of obesity.

One interesting study regarding the effect of exercise on the expression of FATP4 in skeletal muscles revealed that training increased the protein content of FATP4 by 33%, associated with enhanced lipid oxidation during prolonged submaximal exercise [74]. Thus, the increased fuel demand induced by exercise training in skeletal muscles could be another benefit of exercise, through reducing the uptake of LCFA by the adipose tissue and liver to decrease TG formation and lipid accumulation while increasing expression in muscle to increase uptake and oxidation.

In agreement with our findings, several investigations found that inhibiting the activity of the TLR4/NF-kB signaling pathway and gene expression led to a reduction in the activity of TNF-α, IL-6, and other inflammatory mediators [75,76]. In obese rats, vitamin D deprivation has been demonstrated to increase the expression levels of TLR2, TLR4, and TLR9 hepatic mRNA [77]. Supplementation of vitamin D has been indicated to reduce TLR4 expression in the ileum of an obese mouse model of NASH [78,79]. Exercise has been shown to reduce TLR4 expression in rats with diet-induced obesity, with both acute and chronic exercise causing a significant suppression in the TLR4 signaling pathway in the muscle, liver, and adipose tissue and improvement of insulin signaling and sensitivity [80,81].

5. Conclusions

In conclusion, we have presented evidence that expression levels of FTAP4 in liver and visceral adipose tissue are associated with acquired obesity, obesity-associated liver disease, and insulin resistance in rat. Obesity increased FATP4 expression. Following the induction of obesity, vitamin D supplementation and exercise attenuated body weight gain and abdominal adiposity, and NAFLD. Further, it ameliorated the plasma lipid profile in obese rats. These effects may be mediated, at least in part, by decrease of FTAP4, TLR4 expression with a reduction of circulating levels of leptin and TNF-α. When considered as a whole, the findings of this study lend credence to the hypothesis that a combination of vitamin D and physical activity could be an effective therapy of obesity and the comorbidities that are associated with it.

Acknowledgments

Special thanks to by Faculty of Medicine, Suez Canal university, Ismailia, Egypt for supporting the studied Animal model in their lab and Animal house. We extend our acknowledgments to Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2022R65), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijerph192113740/s1. Table S1. Modified liver staging: architectural changes, fibrosis, and cirrhosis. Table S2. Modified liver histological activity index (HAI) grading: necro-inflammatory scores.

Author Contributions

Conceptualization, E.K., S.A.M., K.E.-S.; data curation, E.K., S.A.M., M.N.S., A.A., K.E.-S. and W.A.H.; formal analysis. S.A.M., E.K., M.N.S., A.A. and K.E.-S.,W.A.H.; investigation, S.A.M., E.K., M.S, A.A., K.E.-S., A.M.A. and W.A.H.; methodology, S.A.M., E.K., K.E.-S. and W.A.H.; resources, K.E, S.A.M., E.K., A.M.A. and W.A.H.; software, S.A.M. and E.K.; validation, S.A.M. and E.K.; visualization, S.A.M., E.K.; writing—original draft, S.A.M., E.K., K.E.-S. and W.A.H.; writing—review and editing, S.A.M., E.K., M.N.S., A.A., K.E.-S., A.M.A. and W.A.H.; funding M.N.S., A.M.A. and A.A. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of the Faculty of Medicine, Suez Canal University (Protocol number: 4313# and date of approval: 11 October 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research is being funded by Faculty of Medicine, Suez Canal university, Ismailia, Egypt. Also, the support of Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2022R65), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Karnafel W., Możejko-Pastewka B. Obesity and the risk of type 2 diabetes mellitus and certain types of cancer. Clin. Diabetol. 2015;4:163–171. [Google Scholar]
  • 2.Johnson C.B., Davis M.K., Law A., Sulpher J. Shared risk factors for cardiovascular disease and cancer: Implications for preventive health and clinical care in oncology patients. Can. J. Cardiol. 2016;32:900–907. doi: 10.1016/j.cjca.2016.04.008. [DOI] [PubMed] [Google Scholar]
  • 3.Caleyachetty R., Thomas G.N., Toulis K.A., Mohammed N., Gokhale K.M., Balachandran K., Nirantharakumar K. Metabolically healthy obese and incident cardiovascular disease events among 3.5 million men and women. J. Am. Coll. Cardiol. 2017;70:1429–1437. doi: 10.1016/j.jacc.2017.07.763. [DOI] [PubMed] [Google Scholar]
  • 4.Vilarrasa N., Maravall J., Estepa A., Sánchez R., Masdevall C., Navarro M., Alía P., Soler J., Gómez J. Low 25-hydroxyvitamin D concentrations in obese women: Their clinical significance and relationship with anthropometric and body composition variables. J. Endocrinol. Investig. 2007;30:653–658. doi: 10.1007/BF03347445. [DOI] [PubMed] [Google Scholar]
  • 5.Saied E.M., El-Maradny Y.A., Osman A.A., Darwish A.M.G., Abo Nahas H.H., Niedbała G., Piekutowska M., Abdel-Rahman M.A., Balbool B.A., Abdel-Azeem A.M. A Comprehensive Review about the Molecular Structure of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2): Insights into Natural Products against COVID-19. Pharmaceutics. 2021;13:1759. doi: 10.3390/pharmaceutics13111759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Aleksandrova K., Mozaffarian D., Pischon T. Addressing the perfect storm: Biomarkers in obesity and pathophysiology of cardiometabolic risk. Clin. Chem. Lab. Med. 2018;64:142–153. doi: 10.1373/clinchem.2017.275172. [DOI] [PubMed] [Google Scholar]
  • 7.Kim S.W., Choi J.-W., Yun J.W., Chung I.-S., Cho H.C., Song S.-E., Im S.-S., Song D.-K. Proteomics approach to identify serum biomarkers associated with the progression of diabetes in Korean patients with abdominal obesity. PLoS ONE. 2019;14:e0222032. doi: 10.1371/journal.pone.0222032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Timotin A., Cinato M., Boal F., Dejean S., Anesia R., Arnaut O., Lagente C., Roncalli J., Desmoulin F., Tronchere H. Differential protein profiling as a potential multi-marker approach for obese patients with heart failure: A retrospective study. Sci. Rep. 2018;8:7894. doi: 10.1038/s41598-018-26118-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Foster-Schubert K.E., Cummings D.E. Emerging therapeutic strategies for obesity. Endocr. Rev. 2006;27:779–793. doi: 10.1210/er.2006-0041. [DOI] [PubMed] [Google Scholar]
  • 10.Ragab S.M., Abd Elghaffar S.K., El-Metwally T.H., Badr G., Mahmoud M.H., Omar H.M. Effect of a high fat, high sucrose diet on the promotion of non-alcoholic fatty liver disease in male rats: The ameliorative role of three natural compounds. Lipids Health Dis. 2015;14:83. doi: 10.1186/s12944-015-0087-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Afifi N.A., Ramadan A., Erian E.Y., Saleh D.O., Sedik A.A., Badawi M., El Hotaby W. Trigonelline attenuates hepatic complications and molecular alterations in high-fat high-fructose diet-induced insulin resistance in rats. Can. J. Physiol. Pharmacol. 2017;95:427–436. doi: 10.1139/cjpp-2016-0269. [DOI] [PubMed] [Google Scholar]
  • 12.Khalifa S.A.M., Shedid E.S., Saied E.M., Jassbi A.R., Jamebozorgi F.H., Rateb M.E., Du M., Abdel-Daim M.M., Kai G.-Y., Al-Hammady M.A.M., et al. Cyanobacteria—From the Oceans to the Potential Biotechnological and Biomedical Applications. Marine Drugs. 2021;19:241. doi: 10.3390/md19050241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Han Y., Han H.J., Kim A.H., Choi J.Y., Cho S.J., Park Y.B., Jung U.J., Choi M.S. d-Allulose supplementation normalized the body weight and fat-pad mass in diet-induced obese mice via the regulation of lipid metabolism under isocaloric fed condition. Mol. Nutr. Food Res. 2016;60:1695–1706. doi: 10.1002/mnfr.201500771. [DOI] [PubMed] [Google Scholar]
  • 14.Shalaby M.N., Fadl M.A., Wahab H.A.H.A., Hashem R.M.H., Faid R.A.A.M., Mousa N.A., Khalil M.F. Effect of a Training Program Accompanied by a Suggested Diet on Some Physiological Variables and Regulating Blood Sugar Level in Type II Diabetics. Int. J. Hum. Mov. Sports Sci. 2022;10:54–65. doi: 10.13189/saj.2022.100109. [DOI] [Google Scholar]
  • 15.Wortsman J., Matsuoka L.Y., Chen T.C., Lu Z., Holick M.F. Decreased bioavailability of vitamin D in obesity. Am. J. Clin. Nutr. 2000;72:690–693. doi: 10.1093/ajcn/72.3.690. [DOI] [PubMed] [Google Scholar]
  • 16.Shalaby M.N., Sakoury M.M.A., Akl H.F.M., Hassan R.H.A., Ababtain H.A.S., Alghamdi A. Effect of Physical Exertion on the Effect of Physical Exertion on the Concentration of Copper and Blood Pressure in Athletesn the Concentration of Copper and Blood Pressure in Athletes. Pedagogy phys. cult. sports. 2022;26:260–264. doi: 10.15561/26649837.2022.0405. [DOI] [Google Scholar]
  • 17.Yao Y., Zhu L., He L., Duan Y., Liang W., Nie Z., Jin Y., Wu X., Fang Y. A meta-analysis of the relationship between vitamin D deficiency and obesity. Int. J. Clin. Exp. Med. 2015;8:14977. [PMC free article] [PubMed] [Google Scholar]
  • 18.Shalaby M.N., Sakoury M.M.A., Abdi E., Elgamal S., Elrkbwey S., Ramadan W., Taiar R. The Impact of Resistance Training on Gene Expression of IGF1 and Athletes’ Physiological Parameters. Open Access Maced J Med Sci. 2021;9:934–940. doi: 10.3889/oamjms.2021.7215. [DOI] [Google Scholar]
  • 19.Mohamed D.I., Alaa El-Din Aly El-Waseef D., Nabih E.S., El-Kharashi O.A., Abd El-Kareem H.F., Abo Nahas H.H., Abdel-Wahab B.A., Helmy Y.A., Alshawwa S.Z., Saied E.M. Acetylsalicylic Acid Suppresses Alcoholism-Induced Cognitive Impairment Associated with Atorvastatin Intake by Targeting Cerebral MiRNA155 and NLRP3: In Vivo, and In Silico Study. Pharmaceutics. 2022;14:529. doi: 10.3390/pharmaceutics14030529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kang Y.-S., Kim J.-C., Kim J.-S., Kim S.H. Effects of swimming exercise on serum irisin and bone FNDC5 in rat models of high-fat diet-induced osteoporosis. J. Sport. Sci. Med. 2019;18:596. [PMC free article] [PubMed] [Google Scholar]
  • 21.Levin B.E., Dunn-Meynell A.A. Defense of body weight depends on dietary composition and palatability in rats with diet-induced obesity. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2002;282:R46–R54. doi: 10.1152/ajpregu.2002.282.1.R46. [DOI] [PubMed] [Google Scholar]
  • 22.Abdul Kadir N.A.A., Rahmat A., Jaafar H.Z. Protective effects of tamarillo (Cyphomandra betacea) extract against high fat diet induced obesity in Sprague-Dawley rats. J. Obes. 2015;2015:846041. doi: 10.1155/2015/846041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Orhan C., Tuzcu M., Deeh Defo P.B., Sahin N., Ojalvo S.P., Sylla S., Komorowski J.R., Sahin K. Effects of a Novel Magnesium Complex on Metabolic and Cognitive Functions and the Expression of Synapse-Associated Proteins in Rats Fed a High-Fat Diet. Biol. Trace Elem. Res. 2022;200:247–260. doi: 10.1007/s12011-021-02619-z. [DOI] [PubMed] [Google Scholar]
  • 24.Mohamed D.I., Abou-Bakr D.A., Ezzat S.F., El-Kareem H.F.A., Nahas H.H.A., Saad H.A., Mehana A.E., Saied E.M. Vitamin D3 Prevents the Deleterious Effects of Testicular Torsion on Testis by Targeting MiRNA-145 and ADAM17: In Silico and In Vivo Study. Pharmaceuticals. 2021;14:1222. doi: 10.3390/ph14121222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ciolac E.G., Greve J.M.D.A. Exercise-induced improvements in cardiorespiratory fitness and heart rate response to exercise are impaired in overweight/obese postmenopausal women. Clinics. 2011;66:583–589. doi: 10.1590/S1807-59322011000400011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Eleawa S., Sakr H.F. Effect of exercise and orlistat therapy in rat model of obesity induced with high fat diet. Med. J. Cairo Univ. 2013;81:59–67. [Google Scholar]
  • 27.He C., Cheng D., Peng C., Li Y., Zhu Y., Lu N. High-fat diet induces dysbiosis of gastric microbiota prior to gut microbiota in association with metabolic disorders in mice. Front. Microbiol. 2018;9:639. doi: 10.3389/fmicb.2018.00639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fossati P., Prencipe L. Serum triglycerides determined colorimetrically with an enzyme that produces hydrogen peroxide. Clin. Chem. 1982;28:2077–2080. doi: 10.1093/clinchem/28.10.2077. [DOI] [PubMed] [Google Scholar]
  • 29.Allain C.C., Poon L.S., Chan C.S., Richmond W., Fu P.C. Enzymatic determination of total serum cholesterol. Clin. Chem. 1974;20:470–475. [PubMed] [Google Scholar]
  • 30.Burstein M., Scholnick H., Morfin R.J. Rapid method for the isolation of lipoproteins from human serum by precipitation with polyanions. J. Lipid Res. 1970;11:583–595. doi: 10.1016/S0022-2275(20)42943-8. [DOI] [PubMed] [Google Scholar]
  • 31.Wieland H., Seidel D. A simple specific method for precipitation of low density lipoproteins. J. Lipid Res. 1983;24:904–909. doi: 10.1016/S0022-2275(20)37936-0. [DOI] [PubMed] [Google Scholar]
  • 32.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 33.Mohamed D.I., Ezzat S.F., Elayat W.M., El-Kharashi O.A., El-Kareem H.F.A., Nahas H.H.A., Abdel-Wahab B.A., Alshawwa S.Z., Saleh A., Helmy Y.A., et al. Hepatoprotective Role of Carvedilol against Ischemic Hepatitis Associated with Acute Heart Failure via Targeting MiRNA-17 and Mitochondrial Dynamics-Related Proteins: An In Vivo and In Silico Study. Pharmaceuticals. 2022;15:832. doi: 10.3390/ph15070832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ilić I.R., Stojanović N.M., Radulović N.S., Živković V.V., Randjelović P.J., Petrović A.S., Božić M., Ilić R.S. The Quantitative ER immunohistochemical analysis in breast cancer: Detecting the 3+ 0, 4+ 0, and 5+ 0 Allred score cases. Medicina. 2019;55:461. doi: 10.3390/medicina55080461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhang S., Xu H., Yu X., Wu Y., Sui D. Metformin ameliorates diabetic nephropathy in a rat model of low-dose streptozotocin-induced diabetes. Exp. Ther. Med. 2017;14:383–390. doi: 10.3892/etm.2017.4475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Petrie J.R., Guzik T.J., Touyz R.M. Diabetes, hypertension, and cardiovascular disease: Clinical insights and vascular mechanisms. Can. J. Cardiol. 2018;34:575–584. doi: 10.1016/j.cjca.2017.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kaur J. A comprehensive review on metabolic syndrome. Cardiol. Res. Pract. 2014;2014:943162. doi: 10.1155/2014/943162. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 38.Hruby A., Hu F.B. The epidemiology of obesity: A big picture. Pharmacoeconomics. 2015;33:673–689. doi: 10.1007/s40273-014-0243-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Öner-İyidoğan Y., Kocak H., Seyidhanoğlu M., Gürdöl F., Gülçubuk A., Yildirim F., Çevik A., Uysal M. Curcumin prevents liver fat accumulation and serum fetuin-A increase in rats fed a high-fat diet. J. Physiol. Biochem. 2013;69:677–686. doi: 10.1007/s13105-013-0244-9. [DOI] [PubMed] [Google Scholar]
  • 40.Lobo S., Wiczer B.M., Smith A.J., Hall A.M., Bernlohr D.A. Fatty acid metabolism in adipocytes: Functional analysis of fatty acid transport proteins 1 and 4. J. Lipid Res. 2007;48:609–620. doi: 10.1194/jlr.M600441-JLR200. [DOI] [PubMed] [Google Scholar]
  • 41.Li H., Herrmann T., Seeßle J., Liebisch G., Merle U., Stremmel W., Chamulitrat W. Role of fatty acid transport protein 4 in metabolic tissues: Insights into obesity and fatty liver disease. Biosci. Rep. 2022;42:BSR20211854. doi: 10.1042/BSR20211854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Engin A.B. What is lipotoxicity? Obes. Lipotoxicity. 2017;960:197–220. doi: 10.1007/978-3-319-48382-5_8. [DOI] [PubMed] [Google Scholar]
  • 43.Abdelmegeed M.A., Esterle A., Chilian W.M. Eicosanoids in Metabolic Syndrome. Immunopharmacology. 2013;66:157. doi: 10.1016/B978-0-12-404717-4.00005-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Herrmann T., Buchkremer F., Gosch I., Hall A.M., Bernlohr D.A., Stremmel W. Mouse fatty acid transport protein 4 (FATP4): Characterization of the gene and functional assessment as a very long chain acyl-CoA synthetase. Gene. 2001;270:31–40. doi: 10.1016/S0378-1119(01)00489-9. [DOI] [PubMed] [Google Scholar]
  • 45.Araújo J.R., Tomas J., Brenner C., Sansonetti P. Impact of high-fat diet on the intestinal microbiota and small intestinal physiology before and after the onset of obesity. Biochimie. 2017;141:97–106. doi: 10.1016/j.biochi.2017.05.019. [DOI] [PubMed] [Google Scholar]
  • 46.Ehehalt R., Sparla R., Kulaksiz H., Herrmann T., Füllekrug J., Stremmel W. Uptake of long chain fatty acids is regulated by dynamic interaction of FAT/CD36 with cholesterol/sphingolipid enriched microdomains (lipid rafts) BMC Cell Biol. 2008;9:45. doi: 10.1186/1471-2121-9-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gimeno R.E., Ortegon A.M., Patel S., Punreddy S., Ge P., Sun Y., Lodish H.F., Stahl A. Characterization of a heart-specific fatty acid transport protein. J. Biol. Chem. 2003;278:16039–16044. doi: 10.1074/jbc.M211412200. [DOI] [PubMed] [Google Scholar]
  • 48.Jia Z., Moulson C.L., Pei Z., Miner J.H., Watkins P.A. Fatty acid transport protein 4 is the principal very long chain fatty acyl-CoA synthetase in skin fibroblasts. J. Biol. Chem. 2007;282:20573–20583. doi: 10.1074/jbc.M700568200. [DOI] [PubMed] [Google Scholar]
  • 49.Stahl A., Hirsch D.J., Gimeno R.E., Punreddy S., Ge P., Watson N., Patel S., Kotler M., Raimondi A., Tartaglia L.A. Identification of the major intestinal fatty acid transport protein. J. Mol. Cell. 1999;4:299–308. doi: 10.1016/S1097-2765(00)80332-9. [DOI] [PubMed] [Google Scholar]
  • 50.Milger K., Herrmann T., Becker C., Gotthardt D., Zickwolf J., Ehehalt R., Watkins P.A., Stremmel W., Füllekrug J. Cellular uptake of fatty acids driven by the ER-localized acyl-CoA synthetase FATP4. J. Cell Sci. 2006;119:4678–4688. doi: 10.1242/jcs.03280. [DOI] [PubMed] [Google Scholar]
  • 51.Jia Z., Pei Z., Maiguel D., Toomer C.J., Watkins P.A. The fatty acid transport protein (FATP) family: Very long chain acyl-CoA synthetases or solute carriers? J. Mol. Neurosci. 2007;33:25–31. doi: 10.1007/s12031-007-0038-z. [DOI] [PubMed] [Google Scholar]
  • 52.Digel M., Ehehalt R., Stremmel W., Füllekrug J. Acyl-CoA synthetases: Fatty acid uptake and metabolic channeling. Mol. Cell Biochem. 2009;326:23–28. doi: 10.1007/s11010-008-0003-3. [DOI] [PubMed] [Google Scholar]
  • 53.Hamilton J.A. New insights into the roles of proteins and lipids in membrane transport of fatty acids. Prostaglandins Leukot. Essent. Fat. Acids. 2007;77:355–361. doi: 10.1016/j.plefa.2007.10.020. [DOI] [PubMed] [Google Scholar]
  • 54.Gertow K., Pietiläinen K.H., Yki-Järvinen H., Kaprio J., Rissanen A., Eriksson P., Hamsten A., Fisher R. Expression of fatty-acid-handling proteins in human adipose tissue in relation to obesity and insulin resistance. Diabetologia. 2004;47:1118–1125. doi: 10.1007/s00125-004-1417-4. [DOI] [PubMed] [Google Scholar]
  • 55.Feng A.J., Chen D.F. The expression and the significance of L-FABP and FATP4 in the development of nonalcoholic fatty liver disease in rats. Zhonghua Gan Zang Bing Za Zhi = Zhonghua Ganzangbing Zazhi = Chin. J. Hepatol. 2005;13:776–779. [PubMed] [Google Scholar]
  • 56.Krammer J., Digel M., Ehehalt F., Stremmel W., Füllekrug J., Ehehalt R. Overexpression of CD36 and acyl-CoA synthetases FATP2, FATP4 and ACSL1 increases fatty acid uptake in human hepatoma cells. Int. J. Med. Sci. 2011;8:599. doi: 10.7150/ijms.8.599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Hu X., Zhou J., Song S.-s., Kong W., Shi Y.-C., Chen L.-L., Zeng T.-S. TLR4/AP-1-targeted anti-inflammatory intervention attenuates insulin sensitivity and liver steatosis. Mediat. Inflamm. 2020;2020:2960517. doi: 10.1155/2020/2960517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Guo J., Friedman S.L.J.F. Toll-like receptor 4 signaling in liver injury and hepatic fibrogenesis. Fibrogenesis Tissue Repair. 2010;3:21. doi: 10.1186/1755-1536-3-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Rogero M.M., Calder P.C.J.N. Obesity, inflammation, toll-like receptor 4 and fatty acids. Nutrients. 2018;10:432. doi: 10.3390/nu10040432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kim S.-J., Choi Y., Choi Y.-H., Park T. Obesity activates toll-like receptor-mediated proinflammatory signaling cascades in the adipose tissue of mice. J. Nutr. Biochem. 2012;23:113–122. doi: 10.1016/j.jnutbio.2010.10.012. [DOI] [PubMed] [Google Scholar]
  • 61.Miura K., Ohnishi H.J. Role of gut microbiota and Toll-like receptors in nonalcoholic fatty liver disease. World J. Gastroenterol. WJG. 2014;20:7381. doi: 10.3748/wjg.v20.i23.7381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Cordeiro M.M., Biscaia P.B., Brunoski J., Ribeiro R.A., Franco G.C.N., Scomparin D.X. Vitamin D supplementation decreases visceral adiposity and normalizes leptinemia and circulating TNF-α levels in western diet-fed obese rats. Life Sci. 2021;278:119550. doi: 10.1016/j.lfs.2021.119550. [DOI] [PubMed] [Google Scholar]
  • 63.Pramono A., Jocken J.W., Essers Y.P., Goossens G.H., Blaak E.E. Vitamin D and tissue-specific insulin sensitivity in humans with overweight/obesity. J. Clin. Endocrinol. Metab. 2019;104:49–56. doi: 10.1210/jc.2018-00995. [DOI] [PubMed] [Google Scholar]
  • 64.Mousa A., Naderpoor N., Wilson K., Plebanski M., de Courten M.P., Scragg R., de Courten B. Vitamin D supplementation increases adipokine concentrations in overweight or obese adults. Eur. J. Nutr. 2020;59:195–204. doi: 10.1007/s00394-019-01899-5. [DOI] [PubMed] [Google Scholar]
  • 65.Lotfi-Dizaji L., Mahboob S., Aliashrafi S., Vaghef-Mehrabany E., Ebrahimi-Mameghani M., Morovati A. Effect of vitamin D supplementation along with weight loss diet on meta-inflammation and fat mass in obese subjects with vitamin D deficiency: A double-blind placebo-controlled randomized clinical trial. Clin. Endocrinol. 2019;90:94–101. doi: 10.1111/cen.13861. [DOI] [PubMed] [Google Scholar]
  • 66.Guareschi Z.M., Valcanaia A.C., Ceglarek V.M., Hotz P., Amaral B.K., de Souza D.W., de Souza T.A., Nardelli T., Ferreira T.R., Leite N.C. The effect of chronic oral vitamin D supplementation on adiposity and insulin secretion in hypothalamic obese rats. Br. J. Nutr. 2019;121:1334–1344. doi: 10.1017/S0007114519000667. [DOI] [PubMed] [Google Scholar]
  • 67.Vranić L., Mikolašević I., Milić S.J.M. Vitamin D deficiency: Consequence or cause of obesity? J. Med. 2019;55:541. doi: 10.3390/medicina55090541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Refaat B., Abdelghany A.H., Ahmad J., Abdalla O.M., Elshopakey G.E., Idris S., El-Boshy M.J.B. Vitamin D3 enhances the effects of omega-3 oils against metabolic dysfunction-associated fatty liver disease in rat. BioFactors. 2022;48:498–513. doi: 10.1002/biof.1804. [DOI] [PubMed] [Google Scholar]
  • 69.Yin Y., Yu Z., Xia M., Luo X., Lu X., Ling W. Vitamin D attenuates high fat diet–induced hepatic steatosis in rats by modulating lipid metabolism. J. Eur. J. Clin. Investig. 2012;42:1189–1196. doi: 10.1111/j.1365-2362.2012.02706.x. [DOI] [PubMed] [Google Scholar]
  • 70.Liu Y., Wang M., Xu W., Zhang H., Qian W., Li X., Cheng X. Active vitamin D supplementation alleviates initiation and progression of nonalcoholic fatty liver disease by repressing the p53 pathway. Life Sci. 2020;241:117086. doi: 10.1016/j.lfs.2019.117086. [DOI] [PubMed] [Google Scholar]
  • 71.Al-Ghamdi H.A., Al Fayez F.F., Bima A.I., Khawaji T.M., Elsamanoudy A.Z. Study of cellular senescence and vitamin D deficiency in nonalcoholic fatty liver disease and the potential protective effect of vitamin D supplementation. J. Clin. Exp. Hepatol. 2021;11:219–226. doi: 10.1016/j.jceh.2020.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Ma M., Long Q., Chen F., Zhang T., Wang W.J.C. Active vitamin D impedes the progression of non-alcoholic fatty liver disease by inhibiting cell senescence in a rat model. Clin. Res. Hepatol. Gastroenterol. 2020;44:513–523. doi: 10.1016/j.clinre.2019.10.007. [DOI] [PubMed] [Google Scholar]
  • 73.Jordy A.B., Kraakman M.J., Gardner T., Estevez E., Kammoun H.L., Weir J.M., Kiens B., Meikle P.J., Febbraio M.A., Henstridge D.C. Analysis of the liver lipidome reveals insights into the protective effect of exercise on high-fat diet-induced hepatosteatosis in mice. Am. J. Physiol.-Endocrinol. Metab. 2015;308:E778–E791. doi: 10.1152/ajpendo.00547.2014. [DOI] [PubMed] [Google Scholar]
  • 74.Jeppesen J., Jordy A.B., Sjøberg K.A., Füllekrug J., Stahl A., Nybo L., Kiens B. Enhanced fatty acid oxidation and FATP4 protein expression after endurance exercise training in human skeletal muscle. PLoS ONE. 2012;7:e29391. doi: 10.1371/journal.pone.0029391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Chistyakov D.V., Azbukina N.V., Lopachev A.V., Kulichenkova K.N., Astakhova A.A., Sergeeva M.G. Rosiglitazone as a modulator of TLR4 and TLR3 signaling pathways in rat primary neurons and astrocytes. J. Int. J. Mol. Sci. 2018;19:113. doi: 10.3390/ijms19010113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Hassan N.F., Nada S.A., Hassan A., El-Ansary M.R., Al-Shorbagy M.Y., Abdelsalam R.M. Saroglitazar deactivates the hepatic LPS/TLR4 signaling pathway and ameliorates adipocyte dysfunction in rats with high-fat emulsion/LPS model-induced non-alcoholic steatohepatitis. Inflammation. 2019;42:1056–1070. doi: 10.1007/s10753-019-00967-6. [DOI] [PubMed] [Google Scholar]
  • 77.Roth C.L., Elfers C.T., Figlewicz D.P., Melhorn S.J., Morton G.J., Hoofnagle A., Yeh M.M., Nelson J.E., Kowdley K.V. Vitamin D deficiency in obese rats exacerbates nonalcoholic fatty liver disease and increases hepatic resistin and Toll-like receptor activation. Hepatology. 2012;55:1103–1111. doi: 10.1002/hep.24737. [DOI] [PubMed] [Google Scholar]
  • 78.Jahn D., Dorbath D., Kircher S., Nier A., Bergheim I., Lenaerts K., Hermanns H.M., Geier A. Beneficial effects of vitamin D treatment in an obese mouse model of non-alcoholic steatohepatitis. Nutrients. 2019;11:77. doi: 10.3390/nu11010077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Dickie L.J., Church L.D., Coulthard L.R., Mathews R.J., Emery P., McDermott M.F. Vitamin D3 down-regulates intracellular Toll-like receptor 9 expression and Toll-like receptor 9-induced IL-6 production in human monocytes. Rheumatology. 2010;49:1466–1471. doi: 10.1093/rheumatology/keq124. [DOI] [PubMed] [Google Scholar]
  • 80.Oliveira A.G., Carvalho B.M., Tobar N., Ropelle E.R., Pauli J.R., Bagarolli R.A., Guadagnini D., Carvalheira J.B., Saad M.J. Physical exercise reduces circulating lipopolysaccharide and TLR4 activation and improves insulin signaling in tissues of DIO rats. Diabetes. 2011;60:784–796. doi: 10.2337/db09-1907. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 81.Kawanishi N., Yano H., Yokogawa Y., Suzuki K. Exercise training inhibits inflammation in adipose tissue via both suppression of macrophage infiltration and acceleration of phenotypic switching from M1 to M2 macrophages in high-fat-diet-induced obese mice. Exerc. Immunol. Rev. 2010;16:105–118. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Data is contained within the article.


Articles from International Journal of Environmental Research and Public Health are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES