Skip to main content
BMC Nephrology logoLink to BMC Nephrology
. 2022 Nov 14;23:365. doi: 10.1186/s12882-022-02975-5

Gene polymorphisms of VEGF and KDR are associated with initial fast peritoneal solute transfer rate in peritoneal dialysis

Yue Qian 1, Li Ding 1, Liou Cao 1, Zanzhe Yu 1, Xinghua Shao 1, Ling Wang 1, Minfang Zhang 1, Qin Wang 1, Xiajing Che 1, Na Jiang 1, Hao Yan 1, Wei Fang 1, Yan Jin 1, Jiaying Huang 1, Aiping Gu 1, Zhaohui Ni 1,
PMCID: PMC9664652  PMID: 36376833

Abstract

Background

Peritoneal dialysis (PD) is an effective and successful renal replacement therapy. The baseline peritoneal solute transfer rate (PSTR) is related to local membrane inflammation and may be partially genetically determined. Herein, we focused on vascular endothelial growth factor (VEGF) and its receptor, kinase insert domain containing receptor (KDR).

Methods

This study recruited 200 PD patients from Renji Hospital in Shanghai, China. We analysed the association between the polymorphisms of VEGF and KDR and the 4-hour dialysate-to-plasma ratio for creatinine (4 h D/P Cr), which was measured between one and three months after initiating PD.

Results

The CC genotype in VEGF rs3025039 and the AA genotype in KDR rs2071559 were both positively associated with a fast baseline PSTR (VEGF rs3025039 CC vs. TT + TC: 0.65 ± 0.12 vs. 0.61 ± 0.11; P = 0.029; KDR rs2071559 AA vs. GA + GG: 0.65 ± 0.12 vs. 0.62 ± 0.12; P = 0.039).

Conclusion

Baseline PSTR was partly determined by VEGF and KDR gene polymorphisms.

Keywords: Peritoneal dialysis, VEGF, KDR, Gene polymorphisms, SNP, Peritoneal solute transfer rate

Background

Peritoneal dialysis (PD) is an effective and important treatment for renal replacement in patients with end-stage renal disease (ESRD). Studies from all regions of the world have shown that faster baseline peritoneal solute transfer rate (PSTR) is related to higher risk for technology failure and death [14].

The characteristics of peritoneal baseline transport depend on the structure and function of the pre-dialysis peritoneum, which is related to race, age, sex, and underlying disease [5]. However, only 5–11% of the total interindividual variability in the PSTR can be explained by these demographic or clinical variables. Local peritoneal membrane inflammation seems to play an important role in this process. Dialysate IL-6 is the marker with the strongest known association with PSTR, whereas systemic inflammation is associated with comorbidity and patient survival [68]. Evidence from several small single-centre studies shows that some of the between-patient variation may be accounted for by genetic factors related to proinflammatory factors [9, 10].

Neovascularization contributes to both initial fast PSTR and fast PSTR in long -term PD. Although more studies have focused on neovascularization in long-term exposure in PD, several studies have shown higher concentrations of VEGF and KDR in peritoneal tissue in PD patients with initial high/high average transport than in patients with low/low average transport, which means that local expression of VEGF and KDR in peritoneal tissue can affect peritoneal baseline transport by increasing the number of new peritoneal vessels and increasing inflammation status [11, 12].

Vascular endothelial growth factor (VEGF) and its main receptor vascular endothelial growth factor receptor-2 (VEGFR2, or kinase insert domain containing receptor, KDR) are key factors involved in angiogenesis and inflammation [13]. Single-nucleotide polymorphisms (SNPs) mainly refer to polymorphisms of DNA sequences caused by variations in single nucleotides at the genome level, which may affect the function of proteins and lead to disease. SNPs of VEGF and KDR have been reported to be related to many diseases, including tumours, by participating in angiogenesis [1421].

Therefore, we speculate that SNPs may affect the expression of VEGF and KDR in peritoneal tissue at the gene level, thus causing differences in the baseline PSTR by affecting the number of blood vessels and the inflammatory state.

The aim of this study was to investigate the genetic association between VEGF and KDR gene polymorphisms and the type of baseline PSTR in PD patients and to try to find a reliable genetic locus that can predict initial high peritoneal transport, thereby revealing the characteristics of peritoneal transfer in the early stage.

Methods

Clinical characteristics of the study population

In this study, a total of 200 patients starting PD from January 1, 2004, to January 31, 2014, in the Department of Nephrology, Renji Hospital, Shanghai Jiaotong University, School of Medicine were included.

The inclusion criteria were as follows:

(1) Han Chinese;

(2) PD started within 3 months after catheter implantation;

(3) data available from the first peritoneal equilibration test (PET) between 1 and 3 months of starting PD;

(4) agreed to participate in the study.

Patients who were on long-term haemodialysis or who underwent transplantation before the current PD episode were excluded.

Measurement of peritoneal transfer rate

Classic 2.5% PET was performed between 1 and 3 months after PD initiation in all patients. The primary results were expressed as the 4-hour dialysate-to-plasma ratio for creatinine (4 h D/P Cr).

According to the 4 h D/P Cr, patients were classified into four transport types: high transport status (H, 4 h D/P Cr > 0.8), high average transport status (HA, 4 h D/P Cr 0.65–0.8), low average transport status (LA, 4 h D/P Cr 0.5–0.64), and low transport status (4 h D/P Cr < 0.5). In this study, we divided the patients into two groups: the H/HA transporter group and the L/LA transporter group.

SNP selection

Six SNPs of VEGF and seven SNPs of KDR were obtained from International HapMap Project Databases (Fig. 1; Table 1). The screening conditions and scope were as follows: Han Chinese in Beijing & Southern Han Chinese (CHB&CHS); the gene was amplified by 2000 bp upstream and 1000 bp downstream; minor allele frequency (MAF) > 0.05; r2 > 0.8; there was no linkage disequilibrium between each other. We used the Hardy Weinberg equilibrium (HWE) test for all the alleles in all samples as well as each group. If the P value < = 0.001, we considered the allele was not in conformity with the HWE in this population and would not use it for further analysis.

Fig. 1.

Fig. 1

Gene location of tag-SNPs in VEGF and KDR

Table 1.

Selected SNPs of VEGF and KDR

Gene SNPs Chr Position Gene Region
VEGF rs10434 Chr6:43,753,212 UTR 3
rs2010963 Chr6:43,738,350 UTR 5
rs25648 Chr6:43,738,977 Exon 1
rs3025039 Chr6:43,752,536 UTR 3
rs3025053 Chr6:43,753,325 UTR 3
rs699947 Chr6:43,736,389 upstream
KDR rs1870377 Chr4:55,972,974 Exon 11
rs2071559 Chr4:55,992,366 upstream
rs2305945 Chr4:55,971,846 Intron 12
rs2305948 Chr4:55,979,558 Exon 7
rs28517654 Chr4:55,993,468 upstream
rs41481345 Chr4:55,944,618 UTR 3
rs6837735 Chr4:55,985,815 Intron 2

SNP genotyping

Venous blood was collected at the time of PD initiation. DNA was extracted according to the standard process using Wizard® Genomic DNA Purification Kit. The SNPs of VEGF and VEGFR2 were genotyped by a single-base primer extension assay. The sequences of the primers were shown in Table 2. The genomic DNA flanking the SNP was amplified by standard polymerase chain reaction (PCR) using forward and reverse primer pairs. The PCR machine was MJ Research PT-100, and the ABI PRISM® SNaPshot™ Multiplex Kit was used.

Table 2.

Sequences of the primers of PCR

Gene SNPs Forward Sequences Reverse Sequences
VEGF rs10434 CTTCGCTTACTCTCACCTGCTTCTGA GGATCCTGCCCTGTCTCTCTGTG
rs2010963 ACGGCTTGGGGAGATTGCTCTA CCCCAAAAGCAGGTCACTCACT
rs25648 GGGCCGGGGAGGAAGAGTAG CAATGCACCCAAGACAGCAGAA
rs3025039 CCACACCATCACCATCGACAGA ATCTTCCGGGCTCGGTGATTTA
rs3025053 CTTCGCTTACTCTCACCTGCTTCTGA GGATCCTGCCCTGTCTCTCTGTG
rs699947 GTGCTGAGGATGGGGCTGACTA AGGGAACAAAGTTGGGGCTCTG
KDR rs1870377 CCTCCCTGGAAGTCCTCCACAC CAGAATAGCTGCTTCCCTCCTGTATC
rs2071559 CACAAGGGAGAAGCGGATACTCAG CTTGGGGCTAGGCAGGTCACTT
rs2305945 CACTGACTTCACATAAGCCCAGGAG TCTGGAGGTTTGGGTTGGATCA
rs2305948 TGGACCCTGACAAATGTGCTGTT TGAGATGAAGAAATTTTTGAGCACCTT
rs28517654 CCCTGCCCAGCCTTCACTTT CCTCCCCAAATAAATACCTCCCAGAT
rs41481345 AGCCACCCCCTCTTCCATTTTA GCATAACAAAGGTCATAATGCTTTCAGC
rs6837735 AAGAATTTTGCAGGAGGTGGTCTTG TGGTTTCCTGGCTGTTCCCTTA

Statistical analysis

The data were analysed by SPSS 25 and Prism 9. Categorical data are presented as the frequency (percentage); normally distributed continuous data are presented as the mean ± SD, and nonnormally distributed continuous data are expressed as the median (interquartile space). T tests and one-way ANOVA were used to analyse and compare the normally distributed data, and the Wilcoxon rank sum test was used to analyse and compare the nonnormally distributed data. The composition ratio of counting data was analysed and compared by the chi-square test. P < 0.05 was considered statistically significant.

Results

Clinical characteristics of the PD patients

According to the 4 h D/P Cr of their first PET, 94 patients had high/high average transporters, while 104 had low/low average transporters. The baseline clinical characteristics of the patients were shown in Table 3. H/HA transporters had lower haemoglobin (97.95 ± 21.48 vs. 106.21 ± 20.74, P = 0.006), serum albumin (34.55 (31.10, 38.80) vs. 36.49 (33.88, 40.10)) and ultrafiltration (-41.79 ± 595.13 vs. 227.89 ± 525.81) than L/LA group transporters. However, there were no significant differences in sex, age, BMI, underlying diseases (diabetes, hypertension), CRP, urine, urea clearance index (Kt/V) or normalized protein catabolic rate (nPCR) between the two groups.

Table 3.

Clinical characteristics of the 200 PD patients

H/HA (n = 94) L/LA (n = 106) P Value
Male (%) 56(59.6) 50(47.2) 0.079
Age (year) 51.47 ± 14.24 52.72 ± 14.78 0.545
BMI (kg/m2) 21.60(19.54, 23.63) 21.81(19.55, 23.73) 0.930
Diabetes (%) 20(21.3) 16(15.1) 0.274
Hb (g/L) 97.95 ± 21.48 106.21 ± 20.74 0.006
Alb (g/L) 34.55(31.10, 38.80) 36.49(33.88, 40.10) 0.022
CRP (mg/L) 4.97(1.00, 4.07) 6.47(0.66, 4.12) 0.697
UF (ml) -41.79 ± 595.13 227.89 ± 525.81 0.001
Urine (ml) 1152.98 ± 686.61 1008.41 ± 593.31 0.112
4 h D/P Cr 0.74(0.69, 0.77) 0.54(0.50, 0.60) <0.001
Kt/V 2.20(1.83, 2.53) 2.24(1.81, 2.54) 0.737
nPCR [g/(kg·d)] 0.95(0.77, 1.10) 1.06(0.78, 1.14) 0.655

BMI: body mass index; Hb: haemoglobin; Alb: serum albumin; CRP: C reactive protein; UF: ultrafiltration; 4 h D/P Cr: 4-hour dialysate over plasma ratio for creatinine; Kt/V: urea clearance index; nPCR: normalized protein catabolic rate

Association between VEGF polymorphisms and PSTR

The frequency and distributions of genotypes in VEGF are shown in Fig. 2a. The allelic distributions were all in conformity with Hardy-Weinberg equilibrium.

Fig. 2.

Fig. 2

(a) VEGF polymorphisms and D/P Cr. M: alteration allele; m: reference allele.(b) rs3025239 genotypes and D/P Cr

As shown in Fig. 2a, there was no significant association between D/P Cr and VEGF polymorphisms in rs10434, rs2010963, rs25648, rs3025053 and rs699947. VEGF SNPs in rs3025039 were significantly associated with PSTR.

In the rs3025039 polymorphism (Fig. 2b), patients with the CC genotype were related to higher D/P Cr (CC vs. TT + TC: 0.65 ± 0.12 vs. 0.61 ± 0.11; P = 0.029).

Moreover, we found that CC carriers had an increased H/HA transport status risk compared to TT and TC carriers (OR 0.36; 95% CI 0.19–0.65; P = 0.0007) (Table 4). The T alleles appear to decrease the genetic susceptibility to a lower transport status compared to C alleles.

Table 4.

rs3025239 genotype in the H/HA and L/LA groups

SNP Genotype H/HA Group
n = 94
 L/LA Group
n = 106
X2 P value
rs3025039 TT + TC 25 53 11.47 0.0007
CC 69 53

As shown in Table 5, there were no significant differences in age\BMI\Hb\Alb\CRP\UF\urine between rs3025039 polymorphisms. A total of 21.79% of CC carriers had diabetes, while the rate of TT or TC carriers was 15.57%. Patients with TT/CT had a higher Kt/V than those with the CC genotype.

Table 5.

Association between clinical characteristics and rs3025039 genotype

SNP rs3025039
Genotype

TT + TC

n = 122

CC

n = 78

P value
Age (year) 53.95 ± 15.80 50.97 ± 13.55 0.156
BMI (kg/m2) 21.62(19.59,24.00 20.84(19.54,23.55) 0.383
Diabetes (%) 19(15.57) 17(21.79) 0.265
Hb (g/L) 103.60 ± 18.38 101.50 ± 23.22 0.502
ALB (g/L) 35.80(32.18,39.43) 36.30(33.25,38.83) 0.915
CRP (mg/L) 2.41(0.89,4.89) 2.92(0.98,3.83) 0.844
UF (ml) 128.70 ± 563.80 83.51 ± 582.20 0.588
Urine (ml) 1033.00 ± 610.60 1104.00 ± 661.20 0.446
4 h D/P Cr 0.61 ± 0.11 0.65 ± 0.12 0.029
Kt/V 2.25(1.88,2.73) 2.03(1.77,2.48) 0.016
nPCR [g/(kg·d)] 0.85(0.78,1.08) 0.92(0.77,1.13) 0.132

BMI: body mass index; Hb: haemoglobin; Alb: serum albumin; CRP: C reactive protein; UF: ultrafiltration; 4 h D/P Cr: 4-hour dialysate over plasma ratio for creatinine; Kt/V: urea clearance index; nPCR: normalized protein catabolic rate

Association between KDR polymorphisms and peritoneal transport status

We also examined the association between KDR polymorphisms and the 4 h D/P Cr. The allelic distributions were all in conformity with Hardy-Weinberg equilibrium.

Among the seven selected tagSNPs in the KDR gene, rs2071559 was shown to be associated with the 4 h D/P Cr, while the other six SNPs in rs1870377, rs2305945, rs2305948, rs28517645, rs41483145 and rs683773 had no effect on the 4 h D/P Cr (Fig. 3a).

Fig. 3.

Fig. 3

(a) KDR polymorphisms and D/P Cr. M: alteration allele; m: reference allele. (b) rs2071559 genotypes and D/P Cr

Patients carrying two minor alleles at rs2071559 (AA genotype) had a significantly higher D/P Cr than those carrying the GG or GA genotype (AA vs. GG + GA: 0.65 ± 0.12 vs. 0.62 ± 0.12; P = 0.036) (Fig. 3b).

Furthermore, H/HA transport status patients had a remarkably higher frequency of the AA genotype than L/LA transport status patients (OR 0.56; 95% CI 0.31–0.99; P = 0.045) (Table 6). The G allele was shown to be associated with an increased risk of L/LA transport status compared to the A allele.

Table 6.

rs2071559 genotype in the H/HA and L/LA groups

SNP Genotype H/HA Group
n = 94
 L/LA Group
n = 106
X2 P value
rs2071559 GG + GA 49 70 4 0.045
AA 45 36

There were no significant differences between the GG + GA and AA genotypes of rs2071559 in age, BMI, Hb, Alb, CRP, UF or urine volume. A total of 23.46% of AA carriers had diabetes, which was higher than the proportion of GG or GA carriers (14.29%). However, AA carriers had a significantly higher Kt/V than GG and GA carriers (Table 7).

Table 7.

Association between clinical characteristics and rs2071559 genotype

SNP rs2071559
Genotype

GG + GA

n = 119

AA

n = 81

P value
Age (year) 52.45 ± 14.47 51.65 ± 14.63 0.703
BMI (kg/m2) 21.56(19.59,24.57) 20.70(19.52,23.01) 0.272
Diabetes (%) 17(14.29) 19(23.46) 0.132
Hb (g/L) 101.80 ± 20.60 103.10 ± 22.72 0.655
ALB (g/L) 36.10(33.90,39.10) 35.70(31.95,39.15) 0.384
CRP (mg/L) 2.65(0.61,5.18) 3.00(1.00,3.74) 0.641
UF (ml) 105.20 ± 536.80 95.23 ± 628.30 0.904
Urine (ml) 1016.00 ± 640.00 1165.00 ± 636.80 0.107
4 h D/P Cr 0.62 ± 0.12 0.65 ± 0.12 0.036
Kt/V 2.07(1.78,2.41) 2.24(1.87,2.71) 0.041
nPCR [g/(kg·d)] 0.92(0.79,1.08) 0.91(0.75,1.16) 0.713

BMI: body mass index; Hb: haemoglobin; Alb: serum albumin; CRP: C reactive protein; UF: ultrafiltration; 4 h D/P Cr: 4-hour dialysate over plasma ratio for creatinine; Kt/V: urea clearance index; nPCR: normalized protein catabolic rate

Discussion

In this study, we analysed the association between baseline PSTR and genetic polymorphisms of two genes (VEGF and KDR) in a Chinese Han population. The results showed that SNPs of rs3025039 in VEGF and SNPs of rs2071559 in KDR were significantly associated with initial 4 h D/P Cr. Genetic factors related to neovascularization are related to the initial PSTR in PD.

Fast initial peritoneal transport status is an independent risk factor for long-term prognosis in patients with PD. Meta-analysis showed that for every 0.1 increase in the dialysate over plasma ratio for creatinine (D/P Cr), the relative risk of death increased by 1.15-fold, which was equivalent to a 21.9% increase in low average transporters, a 45.7% increase in high average transporters and a 77.3% increase in high transport of the patients compared with the low transport patients. For every 0.1 increase in the D/P Cr, the risk of death associated with technology failure increased by 1.18-fold [22].

The pathophysiological mechanism of late acquired high transport induced by long-term peritoneal dialysis is different from that of early inherent high transport [23, 24]. After initiating PD, significant changes occur in the transport characteristics, which may be due to the differences in the structure and function of the peritoneum before dialysis; these differences mainly manifest as microvascular endothelial function and microinflammation of the peritoneum [11, 25]. Genetic factors are involved in determining initial peritoneal status. Previous studies in our centre have shown that the gene polymorphisms of vascular-related TIE2(rs639225) and inflammation-related IL-6(rs13306345) are associated with high initial peritoneal transport [26].

The VEGF gene is located on chromosome 6p21.3, containing and contains 8 exons and 7 introns. It belongs to the VEGF/platelet-derived growth factor gene family, also known as the growth factor cystine superfamily [27]. VEGF is an important regulatory factor in endothelial cell physiology and a major specific growth factor of endothelial cells [28, 29]. VEGF affects the inflammatory environment by acting as a proinflammatory cytokine through its ability to act as a monocyte chemotactic agent [30].

To date, VEGF gene polymorphisms have been confirmed to be associated with a variety of diseases by participating in angiogenesis. The rs3025039 polymorphism was found to be associated with elevated plasma VEGF levels in glioma and many other cancers [1417, 29, 31].

The biological function of VEGF is achieved through its receptor, mainly for KDR [13]. The KDR gene is located in chromosomal region 4q11-q12 and contains 26 exons [27]. It is mainly expressed in vascular endothelial cells and lymphatic vessels and is the main receptor in the angiogenesis signalling pathway. The gene polymorphisms of rs2071559 were also reported to be associated with tumour recurrence [20].

The two SNPs rs3025039 of VEGF and rs2071559 of KDR, which were found to be associated with initial higher peritoneal transport status, are located in the 3’UTR and upstream, which belong to the noncoding region. Although this region cannot encode proteins, it is indispensable for the expression of genetic information. The nucleotide sequences can regulate the expression of genetic information to have genetic effects. Genetic variation due to gene polymorphisms in noncoding regions may partially explain the significant association between SNPs of the two tested genes and initial peritoneal high transport risk. ESRD patients with the CC genotype of rs3025039 in VEGF or the AA genotype of rs2071559 in KDR are more likely to have a congenital high transport type that may be associated with a poor outcome. Such patients may require a more comprehensive evaluation before dialysis, and perhaps haemodialysis or early intervention through peritoneal dialysis may improve the outcome.

This study also has some limitations. First, our study was conducted in a single population, so our results may not be applicable to other populations due to genetic variation. Second, our study is a single-centre study with a small sample size. Therefore, in future research, we will include patients from multiple centres, increase the sample size, and try to measure the concentration of VEGF and KDR in the initial peritoneum. Tag-SNPs may not completely cover all the genetic variants, and some existing SNPs of VEGF or KDR were not included. Furthermore, the coreceptor neuropilin-1 (Nrp-1) can enhance the effect of VEGF binding to KDR, which plays an important role in the mesothelial to mesenchymal transition (MMT) in long-term PD and causes peritoneal membrane dysfunction [32]. In future studies, we will further study the SNPs of Nrp-1 and focus on the corresponding pathways of SNPs.

At present, the gene polymorphisms of VEGF and KDR are mainly used in the field of cancer. In this study, we investigated for the first time the genetic association between the initial PD transport status and VEGF/KDR. The CC genotype of rs3025039(VEGF) and AA genotype of rs2071559(KDR) could be predictors of initial high transport status, and allele T of rs3025039 or allele G of rs2071559 were associated with the occurrence of initial lower transport status. These results suggest that VEGF and KDR may be used as genetic markers to identify the initial fast PSTR.

Conclusion

The baseline PSTR was partly determined by VEGF and KDR gene polymorphisms. The CC genotype of rs3025039(VEGF) and AA genotype of rs2071559(KDR) could be predictors of initial high transport status.

Acknowledgements

This work was supported by the Department of Nephrology, Renji Hospital, School of Medicine, Shanghai Jiao Tong University. The authors thank physicians and nurses of the PD centre for technical assistance.

List of abbreviations

PD

Peritoneal dialysis

PSTR

Peritoneal solute transfer rate

VEGF

Vascular endothelial growth factor

KDR

Kinase insert domain containing receptor

ESRD

End-stage renal disease

SNP

Single nucleotide polymorphism

PET

Peritoneal equilibration test

4 h D/P Cr

4-hour dialysate-to-plasma ratio for creatinine

CHB&CHS

Han Chinese in Beijing & Southern Han Chinese

MAF

Minor allele frequency

HWE

Hardy Weinberg equilibrium

PCR

Polymerase chain reaction

H

High transport status

HA

High average transport status

LA

Low average transport status

L

Low transport status

BMI

Body mass index

Hb

Haemoglobin

Alb

Serum albumin

CRP

C reactive protein

UF

Ultrafiltration

Kt/V

Urea clearance index

nPCR

Normalized protein catabolic rate

Authors’ contributions

YQ, LD, ZY and ZN contributed to conception and design. YQ, LD, LC, ZY, XS, LW, MZ, QW, XC, NJ, HY, WF, YJ, JH, AG and ZN contributed to acquisition of data, or analysis and interpretation of data. YQ, LD, LC, ZY, XS, LW, MZ, QW, XC, NJ, HY, WF, YJ, JH, AG and ZN contributed to drafting the manuscript or revising it critically for important intellectual content. All authors reviewed the manuscript.

Funding

National Natural Science Foundation of China (82070693, 81770666, 81570604), Shanghai Municipal Health Bureau (201740037), School of Medicine, Shanghai Jiao Tong University (DLY201805). The funders of the study had no role in study design, data collection, data analysis, data interpretation, or writing. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.

Data availability

The datasets during and/or analysed during the current study available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The study was approved by Shanghai Jiaotong University School of Medicine, Renji Hospital Ethics Committee, NO.2018 − 220. All methods were carried out in accordance with relevant guidelines and regulations.

Informed consent

was obtained from all subjects involved in the present study.

Consent for publication

Consents obtained from study participants were written.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Yue Qian and Li Ding have contributed equally to this work.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Churchill DN, Thorpe KE, Nolph KD, Keshaviah PR, Oreopoulos DG, Pagé D. Increased peritoneal membrane transport is associated with decreased patient and technique survival for continuous peritoneal dialysis patients. The Canada-USA (CANUSA) Peritoneal Dialysis Study Group. J Am Soc Nephrol. 1998;9:1285–92. doi: 10.1681/ASN.V971285. [DOI] [PubMed] [Google Scholar]
  • 2.Davies SJ, Phillips L, Griffiths AM, Russell LH, Naish PF, Russell GI. Impact of peritoneal membrane function on long-term clinical outcome in peritoneal dialysis patients. Perit Dial Int. 1999;19(Suppl 2):91–4. doi: 10.1177/089686089901902S14. [DOI] [PubMed] [Google Scholar]
  • 3.Rumpsfeld M, McDonald SP, Johnson DW. Higher peritoneal transport status is associated with higher mortality and technique failure in the Australian and New Zealand peritoneal dialysis patient populations. J Am Soc Nephrol. 2006;17:271–8. doi: 10.1681/ASN.2005050566. [DOI] [PubMed] [Google Scholar]
  • 4.Chung SH, Heimbürger O, Lindholm B. Poor outcomes for fast transporters on PD: the rise and fall of a clinical concern. Semin Dial. 2008;21:7–10. doi: 10.1111/j.1525-139X.2007.00327.x. [DOI] [PubMed] [Google Scholar]
  • 5.Rumpsfeld M, McDonald SP, Purdie DM, Collins J, Johnson DW. Predictors of baseline peritoneal transport status in Australian and New Zealand peritoneal dialysis patients. Am J Kidney Dis. 2004;43:492–501. doi: 10.1053/j.ajkd.2003.11.010. [DOI] [PubMed] [Google Scholar]
  • 6.Lambie M, Chess J, Donovan KL, Kim YL, Do JY, Lee HB, et al. Independent effects of systemic and peritoneal inflammation on peritoneal dialysis survival. J Am Soc Nephrol. 2013;24:2071–80. doi: 10.1681/ASN.2013030314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pecoits-Filho R, Carvalho MJ, Stenvinkel P, Lindholm B, Heimbürger O. Systemic and intraperitoneal interleukin-6 system during the first year of peritoneal dialysis. Perit Dial Int. 2006;26:53–63. doi: 10.1177/089686080602600109. [DOI] [PubMed] [Google Scholar]
  • 8.Yang X, Zhang H, Hang Y, Yan H, Lin A, Huang J, et al. Intraperitoneal interleukin-6 levels predict peritoneal solute transport rate: a prospective cohort study. Am J Nephrol. 2014;39:459–65. doi: 10.1159/000362622. [DOI] [PubMed] [Google Scholar]
  • 9.Gillerot G, Goffin E, Michel C, Evenepoel P, Biesen WV, Tintillier M, et al. Genetic and clinical factors influence the baseline permeability of the peritoneal membrane. Kidney Int. 2005;67:2477–87. doi: 10.1111/j.1523-1755.2005.00357.x. [DOI] [PubMed] [Google Scholar]
  • 10.Hwang YH, Son MJ, Yang J, Kim K, Chung W, Joo KW, et al. Effects of interleukin-6 T15A single nucleotide polymorphism on baseline peritoneal solute transport rate in incident peritoneal dialysis patients. Perit Dial Int. 2009;29:81–8. doi: 10.1177/089686080902900112. [DOI] [PubMed] [Google Scholar]
  • 11.Teng L, Chang M, Liu S, Niu M, Zhang Y, Liu X, et al. Peritoneal microvascular endothelial function and the microinflammatory state are associated with baseline peritoneal transport characteristics in uremic patients. Int Urol Nephrol. 2015;47:191–9. doi: 10.1007/s11255-014-0775-1. [DOI] [PubMed] [Google Scholar]
  • 12.Zhang AH, Wang G, Zhang DL, Zhang QD, Liu S, Liao Y, et al. Association between VEGF receptors and baseline peritoneal transport status in new peritoneal dialysis patients. Ren Fail. 2012;34:582–9. doi: 10.1007/s00018-005-5426-3. [DOI] [PubMed] [Google Scholar]
  • 13.Cébe-Suarez S, Zehnder-Fjällman A, Ballmer-Hofer K. The role of VEGF receptors in angiogenesis; complex partnerships. Cell Mol Life Sci. 2006;63:601–15. doi: 10.1016/j.gene.2017.07.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu B, Wei J, Li M, Jiang J, Zhang H, Yang L, et al. Association of common genetic variants in VEGFA with biliary atresia susceptibility in Northwestern Han Chinese. Gene. 2017;628:87–92. doi: 10.22034/APJCP.2017.18.7.1799. [DOI] [PubMed] [Google Scholar]
  • 15.Naikoo NA, Afroze D, Rasool R, Shah S, Ahangar AG, Bhat IA, et al. SNP and Haplotype Analysis of Vascular Endothelial Growth Factor (VEGF) Gene in Lung Cancer Patients of Kashmir. Asian Pac J Cancer Prev. 2017;18:1799–804. doi: 10.2147/HP.S117967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Buroker NE, Ning XH, Zhou ZN, Li K, Cen WJ, Wu XF, et al. SNPs, linkage disequilibrium, and chronic mountain sickness in Tibetan Chinese. Hypoxia (Auckl) 2017;5:67–74. doi: 10.1186/s12943-016-0497-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bekes I, Friedl TW, Köhler T, Möbus V, Janni W, Wöckel A, et al. Does VEGF facilitate local tumor growth and spread into the abdominal cavity by suppressing endothelial cell adhesion, thus increasing vascular peritoneal permeability followed by ascites production in ovarian cancer? Mol Cancer. 2016;15:13. doi: 10.3390/genes9120631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Furuya TK, Jacob CE, Tomitão MTP, Camacho LCC, Ramos MFKP, Eluf-Neto J, et al. Association between Polymorphisms in Inflammatory Response-Related Genes and the Susceptibility, Progression and Prognosis of the Diffuse Histological Subtype of Gastric Cancer. Genes (Basel) 2018;9:631. doi: 10.1007/s12035-015-9240-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang J, Yang J, Chen Y, Mao Q, Li S, Xiong W, et al. Genetic Variants of VEGF (rs201963 and rs3025039) and KDR (rs7667298, rs2305948, and rs1870377) Are Associated with Glioma Risk in a Han Chinese Population: a Case-Control Study. Mol Neurobiol. 2016;53:2610–8. doi: 10.1111/j.1349-7006.2011.02194.x. [DOI] [PubMed] [Google Scholar]
  • 20.Dong G, Guo X, Fu X, Wan S, Zhou F, Myers RE, et al. Potentially functional genetic variants in KDR gene as prognostic markers in patients with resected colorectal cancer. Cancer Sci. 2012;103:561–8. doi: 10.1093/annonc/mdp452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kim DH, Xu W, Kamel-Reid S, Liu X, Jung CW, Kim S, et al. Clinical relevance of vascular endothelial growth factor (VEGFA) and VEGF receptor (VEGFR2) gene polymorphism on the treatment outcome following imatinib therapy. Ann Oncol. 2010;21:1179–88. doi: 10.3109/0886022X.2012.669322. [DOI] [PubMed] [Google Scholar]
  • 22.Brimble KS, Walker M, Margetts PJ, Kundhal KK, Rabbat CG. Meta-analysis: peritoneal membrane transport, mortality, and technique failure in peritoneal dialysis. J Am Soc Nephrol. 2006;17:2591–8. doi: 10.1681/ASN.2006030194. [DOI] [PubMed] [Google Scholar]
  • 23.Rodrigues AS, Almeida M, Fonseca I, Martins M, Carvalho MJ, Silva F, et al. Peritoneal fast transport in incident peritoneal dialysis patients is not consistently associated with systemic inflammation. Nephrol Dial Transplant. 2006;21:763–9. doi: 10.1093/ndt/gfi245. [DOI] [PubMed] [Google Scholar]
  • 24.Rodrigues R, Martins AS, Korevaar M, Silva JC, Oliveira S, Cabrita JC, et al. Evaluation of peritoneal transport and membrane status in peritoneal dialysis: focus on incident fast transporters. Am J Nephrol. 2007;27:84–91. doi: 10.1159/000099332. [DOI] [PubMed] [Google Scholar]
  • 25.Gao D, Zhao ZZ, Liang XH, Li Y, Cao Y, Liu ZS. Effect of peritoneal dialysis on expression of vascular endothelial growth factor, basic fibroblast growth factor and endostatin of the peritoneum in peritoneal dialysis patients. Nephrol (Carlton) 2011;16:736–42. doi: 10.1111/j.1440-1797.2011.01502.x. [DOI] [PubMed] [Google Scholar]
  • 26.Ding L, Shao X, Cao L, Fang W, Yan H, Huang J, et al. Possible role of IL-6 and TIE2 gene polymorphisms in predicting the initial high transport status in patients with peritoneal dialysis: an observational study. BMJ Open. 2016;6:e012967. doi: 10.1136/bmjopen-2016-012967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Takahashi H, Shibuya M. The vascular endothelial growth factor (VEGF)/VEGF receptor system and its role under physiological and pathological conditions. Clin Sci (Lond) 2005;109:227–41. doi: 10.1042/CS20040370. [DOI] [PubMed] [Google Scholar]
  • 28.Goligorsky MS. Endothelial cell dysfunction: can’t live with it, how to live without it. Am J Physiol Renal Physiol. 2005;288:F871–80. doi: 10.1152/ajprenal.00333.2004. [DOI] [PubMed] [Google Scholar]
  • 29.Melincovici CS, Boşca AB, Şuşman S, Mărginean M, Mihu C, Istrate M, et al. Vascular endothelial growth factor (VEGF) - key factor in normal and pathological angiogenesis. Rom J Morphol Embryol. 2018;59:455–67. [PubMed] [Google Scholar]
  • 30.Melder RJ, Koenig GC, Witwer BP, Safabakhsh N, Munn LL, Jain RK. During angiogenesis, vascular endothelial growth factor and basic fibroblast growth factor regulate natural killer cell adhesion to tumor endothelium. Nat Med. 1996;2:992–7. doi: 10.1038/nm0996-992. [DOI] [PubMed] [Google Scholar]
  • 31.Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE. Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production. Cytokine. 2000;12:1232–5. doi: 10.1006/cyto.2000.0692. [DOI] [PubMed] [Google Scholar]
  • 32.Pérez-Lozano ML, Sandoval P, Rynne-Vidal A, Aguilera A, Jiménez-Heffernan JA, Albar-Vizcaíno P, et al (2013) Functional relevance of the switch of VEGF receptors/co-receptors during peritoneal dialysis-induced mesothelial to mesenchymal transition. PLoS One. 2013;8(4):e60776. 10.1371/journal.pone.0060776. [DOI] [PMC free article] [PubMed]
  • 33.Clinical T. Registration: www.ClinicalTrials.gov, identifier: NCT04888065.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets during and/or analysed during the current study available from the corresponding author on reasonable request.


Articles from BMC Nephrology are provided here courtesy of BMC

RESOURCES