Synergistic Effect of the Combination of Deferoxamine and Fluconazole In Vitro and In Vivo against Fluconazole-Resistant Candida Spp.

ABSTRACT

The opportunistic fungal infections are an increasing threat to humans due to the increasing number of patients with immunodeficiency, in which the most popular fungal pathogen is Candida albicans. Fluconazole (FLC) is the common drug for treating C. albicans infections, but increasing drug resistance has limited its clinical use. Currently, combination therapy is being investigated as a treatment to overcome the resistance of C. albicans. This report investigated the synergistic properties of deferoxamine (DFO) and FLC combination therapy in vitro and in vivo against drug-resistant C. albicans. The results showed that the combination of DFO and FLC had a great synergistic antifungal effect against C. albicans, an FLC-resistant strain, with a fractional inhibition concentration index (FICI) of 0.25 by the broth microdilution checkerboard assay. Furthermore, the combination of DFO and FLC significantly inhibited the activity of C. glabrata cells (approximately 30% of C. glabrata cells are azole-resistant). The time-growth curves confirmed that the combination of DFO and FLC have a potent synergistic antifungal effect. Hyphal formation assays confirmed that DFO inhibited the hyphal induction of C. albicans. In addition, the combination of DFO and FLC significantly inhibited the expression of the adhesion gene (ALS1). In vivo experiments showed that the combination of DFO and FLC significantly reduced pustules, CFU counts and inflammatory cell infiltration in skin tissue. These results suggest that the combination of DFO and FLC inhibits yeast-hyphae transformation, reduces C. albicans infectivity and resistance in vitro and in vivo, and affects Cek1 MAPK signaling. This may offer a new option for the treatment of cutaneous candidiasis.

INTRODUCTION

The species Candida spp. serves as a major fungal pathogen, causing invasive mucosal infections or fatal spread candidiasis in immunocompromised patients, as well as superficial infections in healthy individuals (1–4). Superficial infections of fungi, which are highly contagious, commonly involve the skin, keratinous tissue, and mucous membranes (5). These infections often impact the quality of life of patients (6). Among them, C. albicans is the most common Candida species, accounting for about 70% of Candida spp. infections (7, 8). Although fluconazole has been widely applied in treating patients with C. albicans infections due to its high efficacy, its clinical application has certain limitations due to increasing drug resistance (9, 10). Combination therapy has been intensively studied and utilized to overcome fluconazole resistance in C. albicans.

Iron is involved in many biological processes, including redox reactions, DNA repair and as protein cofactors (11). In addition, iron was found to alter the C. albicans transcriptome and virulence characteristics (adhesion and biofilm formation), and excess iron in the body can increase host susceptibility to infection and resistance to antifungal drugs (12, 13). Currently, limiting iron acquirement by pathogens is a promising strategy for defense against microbial infection (14, 15). Previous experiments showed that C. albicans cell viability is affected by the accumulation or absence of iron in the medium (16).

Deferoxamine (DFO), an iron chelator used clinically for the treatment of iron overload, was found to have a potential antifungal effect on mucormycosis in dialysis patients (17). Deferasirox and deferiprone were also shown to treat fungal mucormycosis in animal models (18). In C. albicans cells, iron restriction by chelating agents modulated membrane fluidity and increased sensitivity to FLC. Since there are minimal reports on the effect of DFO on C. albicans cell growth, the antifungal effect of DFO and its possible mechanisms were investigated in this study.

To investigate the role of DFO and the synergistic effect of the combination of DFO and FLC, the antifungal activity of DFO in combination with FLC against drug-resistant C. albicans was determined in vitro. In addition, we assessed whether DFO possesses a synergistic activity with FLC of drug-resistant C. albicans-mediated dermal candidiasis in a mouse model. Furthermore, we investigated the mechanism by which the combination of DFO and FLC inhibits yeast-hyphae transformation and the expression of adhesin Als1 and transcription factor Cph1. These effects may be achieved through the Cek1 MAPK signaling pathway.

RESULTS

Synergistic effects of DFO and FLC in vitro.

Checkerboard microdilution assays were first examined for the antifungal effect of DFO and DFO + FLC. DFO alone showed little antifungal activity against C. albicans n175, an FLC-resistant strain (MIC > 1280 μM) (Fig. 1A). However, the combination of DFO and FLC had a potent synergistic activity on the strains with drug resistance, and drug-resistant strains regained susceptibility to FLC (FICI, 0.25). However, this effect disappeared when iron was added to the medium (Fig. 1B). In addition, we examined whether DFO had similar antifungal effects against other Candida species with FLC resistance (C. glabrata and C. krusei). As shown in Table 1, the combination of DFO and FLC had additive and indiscriminate effects against C. glabrata and C. krusei (FICI, 1.0 and 2.0, respectively). In particular, when DFO was used alone, it showed potent antifungal activity against drug-resistant C. glabrata (MIC = 0.25 μM).

FIG 1.

Antifungal activity of DFO and FLC against C. albicans n175, a drug-resistant strain. (A) Combination activity of DFO and FLC against C. albicans without iron. (B) Combination activity of DFO and FLC against C. albicans with 4 mM iron. The color legend (0.1–0.4) refers to the value of MIC, the greener the color, the smaller the MIC value.

TABLE 1.

Combination activity of DFO and FLC on Candida spp.^a

No.	Species	MICs
		Agent alone		Combination	FICI
		DFO (μM)	FLC (μg/mL)	DFO/FLC
SC5314	C. albicans	>128	0.125	8/0.125	1.06 (AE)
n175		>128	8	32/1	0.25 (S)
n376	C. glabrata	0.25	32	0.25/0.125	1.00 (AE)
n264		0.25	32	0.25/0.125	1.00 (AE)
n379	C. krusei	>128	64	128/64	2.00 (I)
n241		>128	64	128/64	2.00 (I)

^aFLC, DFO, MIC, and FICI denoted fluconazole, deferoxamine, the MIC of the drug, and fractional inhibitory concentration index. MIC was determined as 80% of inhibition of fungal growth compared to growth control. S, synergism (FICI < 0.5); AE, additive effect (FICI = 1.0); I, indifference (1.0 < FICI ≦ 4.0).

Time-growth curves.

To further understand the dynamic suppressive action of DFO on C. albicans with FLC-resistance, a time-growth curve was fitted. The results showed that DFO and FLC alone had no significant effect on the growth of the drug-resistant strain n175, while the combination of DFO and FLC demonstrated a potent synergistic antifungal effect 8 h after administration, which was still very pronounced after 36 h (Fig. 2).

FIG 2.

The time-growth curves of C. albicans n175 after FLC, DFO, and DFO and FLC treatment. ****, P < 0.0001 compared to the untreated group.

Effect of DFO and FLC on hyphal induction in C. albicans.

To evaluate the inhibitory effect of DFO on hyphal induction, the morphology of C. albicans was observed under a microscope. C. albicans in the drug-free group induced hyphae after 2 h of incubation at 37°C (Fig. 3). Hyphal development was not significantly suppressed in the FLC and DFO alone groups compared to the control. However, in the combined FLC and DFO groups, the hyphal formation was prominently mitigated (*, P < 0.05).

FIG 3.

(A) Activity of the combination of FLC and DFO on C. albicans hyphae. Hyphal morphology was detected under a microscope (400 × magnification) after 2 h of incubation at 37°C in the culture medium (RPMI 1640) supplemented with 10% FBS. (B) Hyphal induction (%) was analyzed by GraphPad Prism 8. The combination of FLC and DFO significantly inhibited C. albicans hyphal formation. *, P < 0.05 compared to the untreated group.

Synergistic activity of DFO and FLC using cutaneous candidiasis in vivo model.

The in vivo efficacy of DFO was evaluated using a murine model of cutaneous candidiasis caused by FLC-resistant C. albicans. Pustules, edema, and inflammation of lesions were observed on the skin of mice with induced cutaneous candidiasis (Fig. 4A). Furthermore, we compared the volume of subcutaneous granulomas and performed fungal abundance analysis to determine the synergistic effect of DFO and FLC in combination on the development of cutaneous candidiasis. The volume of granuloma in both FLC and DFO alone groups was not markedly different from the model group, but the FLC + DFO group was reduced compared to the model, especially the FLC + DFO-40 group (Fig. 4B, Fig. S1). A similar trend was seen in Fig. 4C, where the fungal skin burden in the FLC + DFO group (P < 0.0001) was markedly reduced in a dose-dependent manner compared to the model, FLC, and DFO groups. Histopathological examination of C. albicans-infected dermal tissues indicated a large subcutaneous fungal load (Fig. 4D). Fungal invasion into the dermis and subcutaneous tissue was confirmed, and infiltration of the inflammatory cells was detected in the skin. Mice treated with a combination of DFO and FLC showed decreased fungal load and inflammation. In the combined group, fungal load and infiltration were further alleviated when the dose of DFO was increased.

FIG 4.

DFO synergizes with FLC against C. albicans with drug resistance in vivo. (A) Imaging for n175-infected mouse skin with treatment or without treatment. (B) Activity of the combination of DFO and FLC on the volume of subcutaneous granulomas. Mice in the FLC and DFO alone treatment groups showed no marked alteration. In contrast, the granuloma volume of mice in the FLC + DFO group was markedly decreased in a dose-dependent manner. (C) Skin fungal burden. After 4 days of treatment, the fungal skin count of mice in the FLC + DFO-40 group was markedly reduced compared to the model group. (D) Histological observation of n175 infected mouse skin biopsy specimens with PAS staining (40 × magnification). Data indicate M ± SD, n = 9/group. Compared with model group, groups were significant (**, P < 0.01); ^##, P < 0.01; compared with FLC + DFO-40.

FIG 5.

Gene expression of Cek1 MAPK pathway and adhesion genes. Gene expression was calculated by the 2^-ΔΔCt method with normalization of 18S gene expression as an internal control gene. All data were triplicated and represented M ± SD. Compared with model group, groups were significant (*, P < 0.05; **, P < 0.01); ^#, P < 0.05; ^##, P < 0.01; compared with FLC + DFO-40.

qRT-PCR assay.

To further explore the antifungal mechanism of the combination of DFO and FLC, qRT-PCR experiments were performed for CEK1, CPH1, ALS1, and ALS3. Cek1 MAPK plays a positive role in C. albicans hyphal development, and transcription factor Cph1 was activated as one of downstream factors of MAPK pathway when Cek1 MAPK was activated. Moreover, CPH1 is also a gene related to hyphal formation. ALS1 and ALS3, two hyphae-specific genes with well important role in cell adhesion, is regulated by the transcription factor Cph1. These genes are directly or indirectly involved in regulating morphological transformation of C. albicans cells, therefore we assayed the expression of CEK1, CPH1, ALS1, and ALS3 genes. The results (Fig. 5) showed that the expression of CEK1, CPH1, and ALS1 was markedly decreased in the combined DFO and FLC group compared to the model group: CEK1 > 3.08-fold, CPH1 > 2.33-fold, and ALS1 > 2.18-fold. However, the expression of ALS3 was markedly elevated in the combined DFO and FLC group compared to the model group.

DISCUSSION

Fluconazole has become the first-line drug for clinical therapy of C. albicans infections due to its broad antifungal spectrum and low toxicity. Long-term treatment with fluconazole makes a high rate of C. albicans resistance, resulting in clinical treatment difficulties (19). To overcome fluconazole resistance in C. albicans, combination therapies have been widely studied and used. It has been reported that fungal growth was inhibited in nutrient-deficient media, including but not limited to iron, calcium, N-acetyl-d-glucosamine, and methionine substances (20, 21). Previous experiments showed that the viability of C. albicans cells could be affected by the accumulation or absence of iron in the medium (16). In this study, we investigated the role of DFO against drug-resistant C. albicans in vitro and in vivo and the synergistic activity of the combination of DFO and FLC. For the treatment of iron overload, deferoxamine has been clinically used as an iron chelator in humans. We found that the combination of DFO and FLC exhibited a potent synergistic activity (FICI, 0.25) against drug-resistant C. albicans, whereas DFO alone hardly inhibited C. albicans. Furthermore, time-growth curves verified the synergistic activity of DFO and FLC. In addition, DFO markedly inhibited the proliferation of C. glabrata, an insensitive strain to FLC, and showed additive effects when combined with FLC.

The activity of DFO was then detected in cutaneous candidiasis in the murine model. The results showed that the combination of DFO and FLC markedly reduced pustules and edema based on comprehensive skin analysis. CFU measurement evaluation showed that the DFO and FLC combination treatment group significantly reduced the number of CFU at the site of skin infection in mice. Furthermore, inflammatory cell infiltration was also reduced when comparing the DFO- and FLC-treated groups. These results suggest that DFO has potent antifungal activity in a mouse model of cutaneous candidiasis due to its synergistic effect with FLC.

The results showed that the combination of DFO and FLC markedly downregulated the expression of genes related to the Cek1 MAPK signaling which is involved in the morphogenesis of C. albicans and highly conserved in the evolution of different species (22). Four MAPK signaling pathways exist in C. albicans: The Hog, Mkc1, Cek1, and Cek2 pathways (23). Among them, Cek1 plays an important role in cell surface contact reaction, which is a prerequisite for hyphal invasion growth and biofilm formation (24, 25). Several studies have shown that Cek1 MAPK is phosphorylated in the presence of iron and affects diverse biological functions of C. albicans (26). C. albicans has morpho-plasticity as a yeast, pseudo-hyphae, and hyphae form (21, 27). Among them, hyphal morphology plays an indispensable role in the infection process, forming biofilms with dense network structures that decrease the permeability of antifungal agents (28). Therefore, drug resistant C. albicans infection can be suppressed by inhibiting yeast-to-hyphae transformation. In in vitro experiments, FLC-resistant C. albicans n175 induced hyphal formation following 2 h of incubation at 37°C, but the combination of DFO and FLC caused most fungi to stay in the yeast state and further progression to hyphal formation was inhibited. Therefore, the combination of DFO and FLC is a potential method for treating infection of hyphae-related change caused by FLC-resistant C. albicans. qRT-PCR data demonstrated that expression of CEK1, CPH1, and ALS1 genes was markedly decreased in the combined DFO and FLC group (CEK1 > 3.08, CPH1 > 2.33, ALS1 > 2.18-fold).

Several similar studies have suggested a potential role for iron chelators in treating infectious diseases. Iron deficiency leads to enhanced membrane fluidity of C. albicans, resulting in an increased passive distribution of the drug and increased drug sensitivity, which can probably be accomplished by suppressing ERG11 expression (14). The work demonstrated that DIBI, a novel chelator, could limit cell proliferation and increase the effect of azoles against clinical isolates of C. albicans, but DFO was noninhibitory at the concentration tested (MIC > 1280 μg/mL) (15). In this study, DFO alone also had little antifungal activity against FLC-resistant C. albicans. However, DFO promoted the antifungal effect of fluconazole through a potent synergistic activity with FLC, reversing drug resistance in C. albicans, and was also efficient in treating cutaneous candidiasis. Surprisingly, DFO also showed potent antifungal activity against drug-resistant C. glabrata (MIC = 0.25 μM). This finding may be utilized in combination therapy against other infections with Candida. In this study, we demonstrate the potential of DFO as an antifungal adjuvant to overcome FLC-resistance in Candida spp., but the underlying mechanism needs to be examined in the future.

MATERIALS AND METHODS

Fungal culture conditions and strains.

Deferoxamine (DFO) was purchased from Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Fluconazole (FLC) was obtained from MACKLIN (Shanghai, China). FLC-resistant C. albicans n175, FLC-resistant C. glabrata n376, n264, and FLC-resistant C. krusei n379, n241 were clinical isolates from Shanghai Skin Disease Hospital. The C. albicans SC5314 as a standard strain was also included for quality control. All strains were incubated on SDA (Sabouraud dextrose agar) at 30°C for at least 24 h before the experiment.

Checkerboard microdilution method.

We assessed the MIC against C. albicans of DFO and DFO + FLC by using a broth microdilution method under the guidance of Clinical and Laboratory Standards Institute (CLSI) M27-S4 (29). 50 μL of a 4-fold dilution of FLC was first added to the 96 wells of a plate to achieve 0.125–64 μg/mL as an experimental concentration. Subsequently, 50 μL of DFO 4-fold diluents were added to the same wells to achieve a final concentration of 0.25 to128 μM. In addition, 50 μL of 1640 medium was added when FLC or DFO was used alone. Each well had 100 μL of yeast cell suspension of 1–5 × 10³ cells/mL. The flat bottom 96-well plates were cultured at 35°C for 24 h. The proliferation rate of wells was assessed by measuring the value of optical density (OD) at 630 nm by an ELx 800 Microplate Reader (Biotek, United States).

Subsequently, another experiment was conducted to determine the effect of DFO on other FLC-resistant Candida spp., including C. glabrata and C. krusei. The method was as described above. The interaction between DFO and FLC was analyzed using fractional inhibitory concentration index (FICI) and assessed using the formula as shown: FICI = (MIC_FLC+DFO/MIC_DFO) + (MIC_FLC+DFO/MIC_FLC), where MIC_FLC+DFO and MIC_FLC+DFO are combinations of test drugs and MIC_FLC and MIC_DFO are valued for the test drugs alone. An FICI of 0.5 or less was defined as synergism, 0.5 < FICI < 1.0 as partial synergistic, FICI of 1.0 as an additive effect, 1.0 < FICI ≦ 4.0 as no interaction or indifference, and FICI > 4.0 as antagonism (30). Experiments were conducted independently three times.

Time-growth curve.

To investigate the dynamic inhibitory activity of DFO on C. albicans n175, a FLC-resistant strain, OD of different drug-treated groups was measured, and time-growth curves were drawn. C. albicans yeast cells were diluted to 1 × 10⁵ cells/mL with a culture medium (RPMI 1640) and treated to DFO (128 μM), FLC (2 μg/mL) or exposed to FLC + DFO (2 μg/mL + 128 μM). For the control group, the same volume of the culture medium (RPMI 1640) was added. Cell suspensions were inoculated at 35°C with continuous shaking (200 rpm), and then 200 μL suspension was collected from tubes after 0, 2, 4, 8, 16, 24, and 36 h and the OD value was measured at 630 nm. Experiments were performed three times independently.

Effect on hyphal induction.

The effect of DFO on the hyphal growth of C. albicans was evaluated by assessing the extent of filamentous formation, a possible mechanism of test drugs. For the hyphal induction experiments, yeast cells were suspended in the culture medium (RPMI 1640) containing 10% FBS. 250 μL of suspension (10⁶ yeast cells/mL) was added in 48-well plates, and 250 μL of DFO (128 μM), FLC (2 μg/mL), or a combination of FLC (2 μg/mL) and DFO (128 μM) was added. In addition, control group received dilutions (RPMI/FBS) without drugs. 48-well plates were cultured at 37°C for 2 h. Imaging analysis was performed by using an inverted microscope with a camera (Zeiss, Germany). Five visual fields (400×) of each well were gathered randomly in 48-well plates for statistical analysis. The hyphal induction (%) = hypha cells/(hypha cells + yeast cells).

Experimental design and murine model.

To investigate the synergistic effects of DFO and FLC in vivo, we established a mouse model of cutaneous candidiasis (31). The experimental procedures of this study were performed in accordance with the Declaration of Helsinki. Female mice (6- to 8-week-old BALB/c) were used. After 1 week of adaptive feeding, mice were allocated to the following 6 groups (n = 9) at random: control group, model group, FLC (2.5 mg/kg), DFO (40 mg/kg), FLC (2.5 mg/kg) + DFO-20 (20 mg/kg) group, and FLC (2.5 mg/kg) + DFO-40 (40 mg/kg). Mice are prepared by shaving their backs the day before the experiment, and 100 μL of FLC-resistant C. albicans suspension (1 × 10⁶ cells/mL) is injected subcutaneously into the dorsal region of mice. In addition, PBS was injected subcutaneously in the control group. Four days after injection, mice were orally administered FLC, DFO, or a combination of DFO and FLC, while the same amount of PBS was received in the control and model mice.

Synergistic activity of DFO and FLC against cutaneous candidiasis in vivo.

DFO, FLC, and a combination of FLC and DFO were orally administered to mice for 4 days. Skin appearance were examined and subcutaneous granuloma volume were analyzed through Image J software. The volume of the granuloma size was calculated by the formula: volume (mm³) = length × width^2/2 (32). The number of CFU/g of infected skin was also determined. Three mice in each group were sacrificed, and the infected skin area was excised and weighed. The excised skin was added to 1 mL of PBS and ground with a homogenizer. After diluting the tissue homogenate 1,000-fold, 100 μL of the suspension was collected and incubated on SDA plates at 35°C for 24 h. The number of fungal burdens on the skin was counted using the following formula: CFU/g = (CFU count × dilution factor) × 10/tissue weight (g).

Histopathology of the skin of mice.

4% paraformaldehyde was used for mouse skin fixation for 24 h, and paraffin wax was used for embedding the specimens. Tissue sectioning was performed at a thickness of 4 μm. Following sectioning deparaffin, and dehydration were performed. Tissue sections were then stained with periodate Schiff solution (PAS). The slides were examined under a morphological microscope to detect subcutaneous hyphae at a certain magnification.

qRT-PCR assay.

RNA was extracted from C. albicans of mouse skin tissue homogenates incubating on an SDA plate with a TRIzol Reagent (Invitrogen, United States). The concentration and quality of the extracted RNA were measured using a Nanodrop spectrophotometer (Thermo NanoDrop 2000, United States). TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, China) were used to reverse-transcribe cDNA from 1 μg of RNA according to the manufacturer's instructions. PCR primer sequences for the test genes are shown in Table 2. Transcription levels of gene mRNA were analyzed on a lightcycler 96 fluorescent quantitative PCR (qRT-PCR) system (Roche, Switzerland) using specific primers and SYBR Premix Ex Taq (TaKaRa, Japan). Cycling consisted of 95°C for 10 min, 95°C for 15 s, 58°C for 30 s, and 72°C for 30 s (40 cycles). Relative gene expression levels were calculated by the 2^-ΔΔCt protocol using 18S gene as internal control.

TABLE 2.

List of qRT-PCR primer sequences analysis

Oligo name	Forward primer (5′–3′)	Reverse primer (5′–3′)
18S	GTGCCAGCAGCGCGGTA	TGGACCGGCCAGCCAAGC
CEK1	AGCTTCAACAGCAACATCAACA	GCTGCTGCCTGTTGTTGTTG
ALS1	CCAGGTGGTACTGACACTGTGA	AATCGGAGGTTGTGCTGTTGAC
ALS3	CGCAACCACCACTACCATTACC	CACCTGGAGGAGCAGTGATTGT
CPH1	TGCTGCCACTGCTCCAATGTA	TGCTGTTGTTGTTGGTGAGGTG

Statistical analysis.

Data sets of at least three replicates were shown as M ± SD (mean ± standard deviation). One-way analysis of variance (ANOVA) was utilized to examine if there were statistically significant differences between the means of different independent groups, and post hoc tests for comparison between groups were utilized for statistical comparisons performed by GraphPad Prism 8. P < 0.05 indicates that the difference was considered statistically significant.