Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2022 Sep 1;100(11):skac286. doi: 10.1093/jas/skac286

Insulin-like growth factor-1 is involved in the deteriorated performance of aged laying hens

Qian Xin 1, Victoria Anthony Uyanga 2, Hongchao Jiao 3, Jingpeng Zhao 4, Xiaojuan Wang 5, Haifang Li 6, Yunlei Zhou 7, Hai Lin 8,✉
PMCID: PMC9667965  PMID: 36049215

Abstract

The underlying mechanism behind the deteriorated laying performance of aged laying hens remains unclear. In the present study, the laying performance and gene expression along the hypothalamus-pituitary-gonad axis were determined. A total of 300 healthy 90-wk-old ISA hens with similar body weights were classified into three groups according to their laying rate between 90 and 94 wk of age. The experimental groups were the low laying rate (<60%, LLR), high laying rate (>85%, HLR), and intermediate laying rate (60% < laying rate < 85%, MLR) hens. At the end of 94 wk of age, eight hens were randomly selected from each group for tissue collection. The gene expression of hormones and their receptors were determined in the hypothalamus, pituitary, and follicles. The results showed that the serum 17-β-estradiol had no significant difference among the three groups. However, the level of insulin-like growth factor 1 (IGF1) in LLR hens was significantly decreased in the serum, small white follicles (SWF), and dominant follicles (DF, P < 0.05). Within the hypothalamus and small yellow follicles (SYF), the mRNA expression level of estrogen receptor was higher in the MLR group (P < 0.05). Compared with HLR hens, the steroid hormone-synthesis key gene, CYP19A1 was significantly decreased in the SWF of MLR-hens and DF of MLR- and LLR-hens (P < 0.05). The mRNA expression level of IGF1 receptor was higher in the hypothalamus, pituitary, SWF, large white follicles (LWF), SYF, and DF of LLR hens, compared to the HLR hens (P < 0.05). These results suggest that decreased IGF1 in serum and follicles was associated with the decreased egg production of aged laying hens. The present study provides novel insights into the endocrine changes in aged hens having different egg production.

Keywords: hormone, hypothalamus–pituitary–gonadal axis, insulin-like growth factor-1, laying hen, laying rate

The laying rate and egg quality of laying hens decrease with age. This study showed that the decrease in serum and follicular IGF1 concentration was associated with the relatively low laying rate of aged hens. Importantly, IGF1 is identified as a potential target for follicular development in aged laying hens.

Introduction

Physiologically, the reproductive ability of females deteriorates with age. In poultry production, the laying performance and egg quality decrease markedly with flock age, especially when the hens are older than 300 d of age (Liu et al., 2013). In recent years, it has become a new breeding target to extend the laying period of hens to produce 500 eggs at age of 100 wk (Bain et al., 2016; Gautron et al., 2021). Laying hens start to lay eggs at 18 wk of age, and they reach their peak production at 25 wk of age. After the peak period, the laying rate gradually decreases with the increase of hens’ age. Molnár et al. (2016) showed that the laying rate decreased from 88% to 79% when the hens were between 74 and 92 wk of age. However, the molecular basis underlying reproductive aging in laying hens remains to be elucidated.

Reproduction in chickens is regulated by the hypothalamus-pituitary-gonadal (HPG) axis (Uyanga et al., 2022), which coordinates a feedback loop that consists of gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), and sex steroids. GnRH acts on the pituitary to stimulate the release of gonadotropins, FSH, and LH. It also plays an important role in controlling the reproductive performance of birds (Khairy Zoheir and Ahmed, 2011). FSH and LH regulate gonadal function via follicular maturation and ovulation (Shen et al., 2006; Li et al., 2011). FSH stimulates the proliferation of granulosa cells (McElroy et al., 2004), facilitates the selection of dominant follicles (DF), and promotes ovulation (Hernandez and Bahr, 2003). The growth and development of chicken follicles are directly related to the egg-laying performance of hens (Williams and Sharp, 1978).

Several factors influence the development of chicken follicles, including hormones and cytokines. The release of reproductive hormones changes with age of birds, and most sex hormones are produced at different stages of follicular growth (Biswas et al., 2010; Brady et al., 2020). In chickens, estrogen is synthesized and secreted by theca cells and granulosa cells of the ovary (Ormerod and Galea, 2001). Estrogen plays an important role in follicular development, reproductive tract functions, and ovulation (Heidarzadehpilehrood et al., 2022). Cytochrome family 17 subfamily A polypeptide 1 (CYP17A1) is an enzyme subset belonging to the cytochrome P450 superfamily and it plays a critical role in steroid production (Rosenfield et al., 1991). Another key enzyme in estrogen synthesis is aromatase, the cytochrome P450 family 19 subfamily A (CYP19A1). In females, aromatase is most active in the ovaries (Heidarzadehpilehrood et al., 2022). Louwers et al. (2013) showed that aromatase deficiency can cause a decrease in estrogen levels.

Ovarian endocrine cytokines can regulate the differentiation and development of follicles by paracrine or autocrine actions. Insulin-like factor 1 (IGF1), an active protein polypeptide secreted by the liver, kidney, and spleen, plays a regulatory role in the growth, bone development, and fat deposition of chicken (Kareem et al., 2016). In birds, studies have shown that IGF1 is a key regulator of follicular growth and differentiation (Adashi et al., 1985, 1992; Onagbesan and Peddie, 1995; Onagbesan et al., 1999; Tosca et al., 2008). IGF1 regulates ovulation frequency, ovarian follicle development, and egg production (Kim et al., 2004; Abdalhag et al., 2016; Uyanga et al., 2022).

Aging in laying hens is largely reflected by a lowered egg production and decreased number of follicles. However, the endocrine changes associated with aging in hens having different laying rate remains unclear. Hence, we hypothesized that the expression of genes related to the HPG axis may differ in aged hens with high and low laying rates.

The aim of the present study was to provide new sight into the gene expression profiles of the HPG axis in aged hens with different laying rates. Thus, the mRNA expression levels of GnRH1, FSH, LH, IGF1, and their receptors were determined in the hypothalamus, pituitary, and ovarian follicles of laying hens that possessed high (~90%), medium (~80%), and low (~50%) egg laying rates.

Materials and Methods

All procedures used in this study were approved by the Animal Care Committee of Shandong Agricultural University (SDAUA-2020-046) and were carried out in accordance with the guidelines for experimental animals of the Ministry of Science and Technology (Beijing, China).

Animals

A total of 300, 90-wk-old ISA hens with similar body weights (2.10 ± 0.15 kg) were used in the present study. The hens were reared in individual cages (1 hen per cage, 45 × 35 × 35 cm, length × width × height), and the number of eggs was recorded daily for 4 wk and the laying rate was also calculated. According to the laying rate from 90 to 94 wk of age, the hens were classified as low laying rate (laying rate < 60%, LLR), high laying rate (laying rate > 85%, HLR), and intermediate laying rate (60% < laying rate < 85%, MLR). The mean laying rate of LLR, MLR, and HLR were 51.5 ± 2.03% (N = 50), 81.03 ± 0.96% (N = 122), 90.72 ± 1.56% (N = 128), respectively. All the hens were provided with a commercial layer diet (ME: 2,663 Kcal/kg; CP: 18.03%; Ca, 3.44%; P, 0.52%; Shandong Zhongcheng Feed Technology Co., Ltd, Tai’an, China) and the light regime was 16-h light and 8-h darkness. During the whole experimental period, the hens had free access to feed and water.

Tissue sampling and preparation

At the end of 94 wk of age, eight hens were randomly selected from each experimental group (N= 24). The hens were subjected to overnight feed withdrawal, and afterward, blood was obtained from the wing vein for serum samples. Serum was separated by centrifugation at 1,500 × g for 15 min and stored at −20 °C until analysis. Hens were sacrificed by ex-sanguination after cervical dislocation (Huang et al., 2015). The hypothalamus, pituitary, and follicles were sampled for tissue collection. The follicles were divided into small white follicles (SWF, smaller than 4 mm in diameter), large white follicles (LWF, 4 to 6 mm in diameter), small yellow follicles (SYF, 6 to 8 mm in diameter), and DF (larger than 8 mm in diameter) (Xiao et al., 1992; Lovell et al., 2003). The yolk was drained from each follicle, then the outer membrane layer and inner membrane layer of each follicle were collected. Tissue samples were immediately snap-frozen in liquid nitrogen and stored at −80 °C for further analysis.

Hormonal analysis

Serum concentrations of 17-β-Estradiol (E2) were determined by RIA using kits obtained from Union Medical and Pharmaceutical Tech (Tianjin, China). The E2 sensitivity of the assay was 1.4 pg/mL and all samples were included in the same assay to avoid interassay variability. The intraassay coefficient of variation was less than 10%. The concentration of chicken IGF1 in serum and follicles were determined using an enzyme-linked immunosorbent assay kit (ELISA; Uscn Life Science Inc., Wuhan, China). The maximal intra-assay variation was 10% and the lowest detectable concentration was 0.156 ng/mL. All samples were included in the same assay to avoid interassay variability.

Total RNA extraction and real-time PCR analyses

The total RNA was extracted from the hypothalamus, pituitary, and follicles using TRIzol reagent (TransGen Biotech, China). Reverse transcription PCR and Real-Time Quantitative PCR (qRT-PCR) were performed as previously reported (Song et al., 2020; Wang et al., 2020; Xin et al., 2021). The mRNA values were normalized to the expression of chicken β-actin mRNA. The relative expression level of the mRNA was calculated by the 2−ΔΔCT method (Uerlings et al., 2018; Tang et al., 2019). The primer sequences for the Real-Time PCR were designed using Primer 5.0 software and synthesized by Sangon Biotech (Shanghai, China) as shown in Table 1.

Table 1.

Gene-specific primers used in the study

Gene name Genbank number Primers position Primers sequences (5ʹ→3ʹ)
GAPDH NM_204305 Forward CTACACACGGACACTTCAAG
Reverse ACAAACATGGGGGCATCAG
CYP17A1 NM_001001901.3 Forward GCTGAAGCGATGCCTGAAGGTC
Reverse GGCTCAAGAGGGCTGTTGTTCTC
CYP19A1 XM_046924620.1 Forward GCCAGTTGCCACAGTGCCTATC
Reverse GGCCCAATTCCCATGCAGTATCC
ESR1 NM_205183 Forward TATTGATGATCGGCTTAGTCTGGG
Reverse CGAGCAGCAGTAGCCAGTAGCA
FSHβ NM_204257 Forward GCTTCACAAGGGATCCGGTA
Reverse TGAAGGAGCAGTAGGATGGC
FSHR NM_205079 Forward CACCAATGCCACAGAACTGAGAT
Reverse GCACCTTATGGACGACGGGT
GnIH NM_204363.1 Forward GCCGAGTGCTTATTTGCCTTTGAG
Reverse TCACATCCCTGGTTCAGACTCCTG
GnIHR NM_204362.1 Forward AGTGGCCTGGTACAGGGCATGTCT
Reverse CAATGCGGGCATACATGACGACAA
GnRH1 NM_001080877 Forward TGGGTTTGTTGATGGTGTTGT
Reverse ATTTTCCAGCGGGAAGAGTTG
GnRH1R NM_204653 Forward ACGGAGGGGGACACCAAC
Reverse GCCCAGCACTGCTGTATTGC
IGF1 NM_001004384 Forward TGTACTGTGCTCCAATAAAGC
Reverse CTGTTTCCTGTGTTCCCTCTACTTG
IGF1R NM_205032 Forward TTCAGGAACCAAAGGGCGA
Reverse TGTAATCTGGAGGGCGATACC
LHβ L35519 Forward GTGACAGTGGCGGTGGAGAA
Reverse CCCAAAGGGCTGCGGTA
LHR AB009283 Forward AGCCTTCCTGCTTTGTCTG
Reverse ATCGTTGTGTATCCGCCTG
Open in a new tab

Statistical analyses

Prior to analysis, data were examined for the homogeneity and normal distribution plots of variances among the treatments using the UNIVARIATE procedure. The results were analyzed using one-way ANOVA via the Statistical Analysis Systems statistical software package (Version 8e, SAS Institute, Cary, NC, USA). When the main effect of different laying rates were significant, mean separation was assessed using Duncan’s multiple range analysis. P < 0.05 was considered statistically significant. Trends were reported where 0.05 ≤ P < 0.10.

Results

The number and weight of LWF, SYF, and DF did not differ among the three groups of hens (P > 0.05, Table 2).

Table 2.

Organ index of laying hens with different laying rates

Parameters HLR1 MLR2 LLR3 P value
Number of large white follicles 33.57 ± 3.56 36.71 ± 6.16 29.71 ± 2.30 0.550
Weight of large white follicles, g 0.84 ± 0.10 0.88 ± 0.2 0.83 ± 0.13 0.973
Number of small yellow follicles 16.38 ± 1.75 17.86 ± 1.88 15.00 ± 1.86 0.571
Weight of small yellow follicles, g 2.37 ± 0.30 2.14 ± 0.41 2.43 ± 0.54 0.874
Number of dominant follicles 5.13 ± 0.23 4.63 ± 0.56 4.29 ± 0.47 0.426
Weight of dominant follicles, g 39.46 ± 4.12 31.99 ± 5.14 31.10 ± 5.06 0.409
Open in a new tab

Data were presented as mean ± SD (N = 8).

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

Serum E2 levels did not significantly differ among the hens with different laying rates (P > 0.05, Table 3). The LLR-hens showed a relatively lower serum IGF1 concentration compared to MLR but not HLR (P < 0.05, Table 3). In the SWF, the concentration of IGF1 was significantly lowered in LLR hens compared to the HLR hens (P < 0.05, Table 4). In the LWF, the concentration of IGF1 in LLR hens was lowered, although these results were not statistically significant (P > 0.05, Table 4). In the SYF, the concentration of IGF1 in LLR hens were also lowered, although not statistically significant (P > 0.05, Table 4). In the DF, the concentration of IGF1 was significantly lowered in LLR hens compared to HLR hens (P < 0.05, Table 4).

Table 3.

The serum concentration of 17-β-estradiol (E2) and insulin-like growth factor 1 (IGF1) in laying hens with different laying rate hens

HLR1 MLR2 LLR3 P value
E2, pg/mL 547.20 ± 58.32 471.85 ± 72.81 572.67 ± 51.92 0.494
IGF1, ng/mL 2,273.97 ± 58.25a,b 2,346.32 ± 18.33a 2,254.47 ± 36.82b 0.040
Open in a new tab

Data were presented as mean ± SD (N = 8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

Table 4.

The concentration of IGF1 in the ovarian follicles of laying hens

HLR1 MLR2 LLR3 P value
SWF, ng/mL 2.15 ± 0.14a 1.86 ± 0.19a,b 1.51 ± 0.14b 0.026
LWF, ng/mL 1.40 ± 0.15 1.25 ± 0.09 1.11 ± 0.11 0.252
SYF, ng/mL 1.78 ± 0.10 1.60 ± 0.07 1.52 ± 0.14 0.220
DF, ng/mL 3.21 ± 0.49a 3.11 ± 0.37a,b 2.23 ± 0.17b 0.049
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the hypothalamus, the mRNA expression level of GnRH1, FSHR, and LHR were unchanged among the hens with different laying rates (P > 0.05, Table 5). In contrast, the mRNA level of ESR1 was lowered in LLR hens compared with MLR hens (P < 0.05, Table 5). However, the LLR hens had higher mRNA levels of IGF1R and GnIH compared to HLR hens (P < 0.001; Table 5).

Table 5.

Gene expression in the hypothalamus of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
GnRH1 1.23 ± 0.24 1.00 ± 0.19 0.80 ± 0.14 0.303
ESR1 0.71 ± 0.15a,b 1.00 ± 0.20a 0.42 ± 0.03b 0.022
IGF1R 0.56 ± 0.10b 1.00 ± 0.17b 2.98 ± 0.40a <0.001
FSHR 0.82 ± 0.12 1.00 ± 0.14 1.15 ± 0.23 0.381
LHR 1.02 ± 0.17 1.00 ± 0.19 0.98 ± 0.17 0.988
GnIH 0.64 ± 0.09b 1.00 ± 0.09a 1.19 ± 0.04a <0.001
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the pituitary, the mRNA level of GnRH1R, LHβ, and ESR1 was not affected by the laying rate (P > 0.05, Table 6). However, the LLR and MLR hens, had higher FSHβ expression compared to HLR hens (P < 0.05, Table 6). The LLR hens had higher IGF1R mRNA levels compared to HLR and MLR hens (P < 0.05, Table 6). In contrast, the mRNA level of GnIHR was lowered in LLR hens compared with HLR hens (P < 0.05, Table 6).

Table 6.

Gene expression in the pituitary of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
GnRH1R 0.78 ± 0.12 1.00 ± 0.20 1.32 ± 0.23 0.155
FSHβ 0.37 ± 0.10b 1.00 ± 0.15a 0.95 ± 0.16a 0.007
LHβ 0.83 ± 0.08 1.00 ± 0.08 1.05 ± 0.09 0.149
IGF1R 0.62 ± 0.14b 1.00 ± 0.23b 1.74 ± 0.29a 0.011
ESR1 0.93 ± 0.12 1.00 ± 0.08 0.80 ± 0.08 0.358
GHIHR 1.15 ± 0.04a 1.00 ± 0.13a,b 0.80 ± 0.07b 0.026
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the SWF, the IGF1 and CYP17A1 expression levels did not differ among the three groups of hens (P > 0.05, Table 7). However, the mRNA expression level of IGF1R in the LLR was significantly higher than in the MLR and HLR groups (P < 0.05, Table 7). The CYP19A1 expression was higher in the HLR hens than in the MLR hens (P < 0.05, Table 7). Also, MLR hens had higher ESR1 mRNA expression than the LLR group, whereas, the LLR hens expressed a higher ESR1 expression than the HLR group (P < 0.05, Table 7). There were no differences in the FSHR expression levels among the three groups of hens (P > 0.05, Table 7), whereas, the LLR hens had lowered LHR levels compared to MLR hens (P < 0.05, Table 7).

Table 7.

Gene expression in the small white follicles of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
IGF1 1.14 ± 0.17 1.00 ± 0.17 0.98 ± 0.19 0.777
IGF1R 0.88 ± 0.12b 1.00 ± 0.12b 1.57 ± 0.23a 0.015
CYP17A1 1.28 ± 0.16 1.00 ± 0.23 1.13 ± 0.28 0.658
CYP19A1 2.13 ± 0.36a 1.00 ± 0.17b 1.42 ± 0.20a,b 0.017
ESR1 0.33 ± 0.05c 1.00 ± 0.16a 0.61 ± 0.10b 0.002
FSHR 1.01 ± 0.18 1.00 ± 0.18 0.84 ± 0.17 0.763
LHR 0.79 ± 0.16a,b 1.00 ± 0.11a 0.62 ± 0.10b 0.026
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,b,cMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the LWF, the mRNA expression level of IGF1 and LHR were lower in MLR hens compared to HLR hens (P < 0.05, Table 8). In contrast, the mRNA level of IGF1R was higher in LLR hens compared to HLR (P < 0.05, Table 8). The mRNA level of CYP17A1, CYP19A1, ESR1, and FSHR revealed no significant differences among hens with different laying rates (P > 0.05, Table 8).

Table 8.

Gene expression in the large white follicles of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
IGF1 1.79 ± 0.26a 1.00 ± 0.15b 1.32 ± 0.11a,b 0.025
IGF1R 1.00 ± 0.15b 1.00 ± 0.20b 1.45 ± 0.09a 0.032
CYP17A1 1.01 ± 0.14 1.00 ± 0.17 0.75 ± 0.09 0.394
CYP19A1 1.01 ± 0.12 1.00 ± 0.20 0.90 ± 0.11 0.866
ESR1 0.93 ± 0.14 1.00 ± 0.19 1.21 ± 0.23 0.564
FSHR 1.39 ± 0.10 1.00 ± 0.19 1.32 ± 0.20 0.231
LHR 2.01 ± 0.27a 1.00 ± 0.21b 1.32 ± 0.26a,b 0.024
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the SYF, the IGF1R expression level in LLR hens was higher than that in the HLR hens (P < 0.05, Table 9). The mRNA expression level of ESR1 in MLR hens was higher than that in the HLR hens (P < 0.05, Table 9). However, the mRNA levels of IGF1, CYP17A1, CYP19A1, FSHR, and LHR showed no significant differences among the hens with different laying rates (P > 0.05, Table 9).

Table 9.

Gene expression in the small yellow follicles of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
IGF1 0.90 ± 0.06 1.00 ± 0.16 0.71 ± 0.12 0.229
IGF1R 0.67 ± 0.16b 1.00 ± 0.19a,b 1.34 ± 0.26a 0.027
CYP17A1 1.07 ± 0.12 1.00 ± 0.14 1.17 ± 0.22 0.764
CYP19A1 1.21 ± 0.13 1.00 ± 0.17 1.37 ± 0.23 0.375
ESR1 0.67 ± 0.08b 1.00 ± 0.13a 0.77 ± 0.14a,b 0.041
FSHR 1.26 ± 0.06 1.00 ± 0.09 1.02 ± 0.11 0.092
LHR 1.13 ± 0.08 1.00 ± 0.15 0.97 ± 0.13 0.595
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

In the DF, the expression level of IGF1R was lowered in HLR hens compared with MLR and LLR hens (P < 0.05, Table 10). Similarly, CYP17A1 and CYP19A1 in the HLR hens were significantly increased than in the LLR hens (P < 0.05, Table 10). Compared with MLR hens, HLR lowered the FSHR level while LLR lowered the LHR expression level (P < 0.05, Table 10). There were no differences in the expression levels of IGF1 and ESR1 among hens with different laying rates (P > 0.05, Table 10).

Table 10.

Gene expression in the dominant follicles of hens with different laying rates

Genes HLR1 MLR2 LLR3 P value
IGF1 0.92 ± 0.10 1.00 ± 0.10 0.77 ± 0.10 0.311
IGF1R 0.53 ± 0.13b 1.00 ± 0.11a 1.30 ± 0.20a 0.006
CYP17A1 1.06 ± 0.09a 1.00 ± 0.23a 0.46 ± 0.07b 0.010
CYP19A1 1.60 ± 0.23a 1.00 ± 0.13b 0.90 ± 0.10b 0.017
ESR1 0.74 ± 0.11 1.00 ± 0.19 0.84 ± 0.13 0.448
FSHR 0.71 ± 0.09b 1.00 ± 0.08a 0.79 ± 0.11a,b 0.031
LHR 0.71 ± 0.06a,b 1.00 ± 0.16a 0.55 ± 0.11b 0.049
Open in a new tab

Data were presented as mean ± SD (N = 6–8).

a,bMeans with different superscripts within the same line differ significantly, P < 0.05.

1HLR, hens with high laying rate (laying rate > 85%).

2MLR, hens with intermediate laying rate (60% < laying rate < 85%) from 90 to 94 wk of age.

3LLR, hens with low laying rate (laying rate < 60%).

Discussion

Poor laying hens have decreased ovulation rate, which is attributed to the presence of a few large follicles (greater than 8-mm diameter) due to atresia (Waddington et al., 1985). In the present study, the hens were divided into three groups according to their laying rates from 90 to 94 wk of age (HLR, 90.7% vs. MLR, 81.0% vs. LLR 51.6%). The laying rate of the experimental hens during the peak phase of production was ~ 94.2%, suggesting that the differences in laying rates were caused by other physiological factors other than genetic factors. The laying rate of hens is controlled by the ovary and regulated by the HPG axis (Kang et al., 2012; Mellouk et al., 2018; Zhang et al., 2021). Brady et al. (2020) recently reported that the mRNA expression of key genes related to the functioning and regulation of the HPG axis differed between high and low egg-producing turkeys. It was evident that the high egg-producing hens had increased gonadotropin stimulation and steroidogenesis, whereas, the low egg-producing hens had higher gonadotropin inhibition. Hence, in the present study, we further investigated the mRNA expression of key genes along the HPG axis.

Estrogen promotes the proliferation of ovarian granulosa cells and maintains the development of ovarian follicles by regulating steroid production (Drummond and Findlay, 1999). Saleh et al. (2019) demonstrated that a decrease in the estrogen level during the late laying period will diminish the laying rate of hens. However, this study revealed that the serum E2 content was not influenced by the high, medium, or low laying rate of hens. In line with these results, it had been shown that the serum E2 level did not differ between young hens (28 to 38 wk of age) which laid at least 20 eggs per sequence, and old hens (53 to 63 wk of age) that were laying 3 to 6 eggs per sequence (Johnson et al., 1986). However, these findings contradict Brady et al. (2020), who showed that during the peak laying period, the plasma estradiol concentration was elevated in high egg-producing hens compared with the low egg-producing hens from 28 to 37 wk of age.

The DF is responsible for progesterone production while SWF is responsible for the total estradiol production (Brady et al., 2020). E2 is mainly produced in the theca cells of ovarian follicles, however, E2 concentration (pg/mg protein) in the theca layer of the F4 and F5 follicles of old hens is significantly lower compared to the young hens (Johnson et al., 1986). HLR hens had higher mRNA levels of CYP17A1 and CYP19A1 in the DF, which implied that HLR hens had a greater capacity for E2 synthesis. Collectively, these results suggest that E2 in the theca layer of follicles was largely responsible for follicular development and recruitment into the hierarchy, rather than the E2 in blood circulation. However, further investigations are necessary to ascertain these findings.

The HPG axis governs the hen’s reproductive system and directly controls ovulation, ultimately regulating egg production. Changes to the hypothalamus or pituitary, either alone or simultaneously, will affect reproductive activities including follicular development, ovulation, and spawning (Etches et al., 1984). In the present study, the mRNA expression of genes related to HPG axis function was evaluated. The unchanged GnRH1, FSHR, and LHR expressions in the hypothalamus of hens with different laying rates indicated that the feedback system of gonadotropins was not associated with the reduced laying performance of aged hens. This corroborated with the report that the GnRH expression did not differ between high- and low-egg producing hens (Brady et al., 2020). More so, the low egg-producing hens had lowered hypothalamic ESR1 expression compared to the high egg-producing hens when sampled during the pre-ovulatory surge (Brady et al., 2020). Similarly, the present study demonstrated that LLR hens had a relatively lowered ESR1 expression in the hypothalamus compared to the MLR (−58%) and HLR (−41%) hens. This suggests a role for ESR1 in the regulation of egg production in aged laying hens. However, the ESR1 expression was unchanged in the pituitary of laying hens regardless of the differences in laying rates. Wang and Ma (2019) reported that pituitary ESR1 was highly expressed in low-yield laying hens compared to the high-yield laying Chinese Dagu Chickens. In contrast, Brady et al. (2019) had shown that high egg producing hens had higher basal expression of ESR1, compared to the low egg producing hens (Brady et al., 2019). These reports are controversial, therefore it remains to be ascertained whether the estrogen negative feedback system is involved in the deteriorated laying performance of aged hens.

Compared to the young hens, the decreased sensitivity of the F1 follicle to LH and the decreased E2 in the theca layer of the smaller pre-ovulatory follicles in older hens were suggested as the two major factors responsible for the short sequence length and the long interval between ovulations in older hens (Johnson et al., 1986). In this study, the decreased expression of FSHβ in HLR hens in the pituitary compared with the MLR and LLR hens indicated that FSHβ was influenced differentially in aged hens with different laying rates. However, FSHR expression in the SWF, LWF, SYF, and DF was unaffected by the different laying rates of hens. Furthermore, the decreased LHR expression level in LLR or MLR hens implies that LHR may play a role in the laying performance of aged hens. In turkey hens, the pre-ovulatory surge of progesterone and LH triggers follicle ovulation (Yang et al., 1997) and the pre-ovulatory surge significantly impacts the gene expression in the hypothalamus, pituitary, and ovarian follicles (Brady et al., 2019). At the peak laying period, high egg producing hens express high levels of pituitary FSH during the pre-ovulatory surge, whereas the pituitary LH is highly expressed after the pre-ovulatory surge (Brady et al., 2020). In the present study, the hens were sacrificed in the morning. Therefore, the influence of pre-ovulatory surge on gene expression cannot be excluded and requires further investigation.

In this study, the LLR hens had a relatively lowered serum IGF1 level compared with the MLR hens, whereas, the serum IGF1 concentration did not differ between the MLR and HLR hens. It is well-known that IGF1 stimulates the growth, proliferation, and differentiation of cells. In laying hens, IGF1 plays a major role in the regulation of ovulation frequency, ovarian follicular development, and egg production (Kim et al., 2004; Abdalhag et al., 2016; Uyanga et al., 2022). The increased production performance and egg quality of laying hens using herbal active ingredients were attributed to the elevated serum IGF1 concentration (Dang and Kim, 2021). Similarly, an increased concentration of IGF1, E2, progesterone, FSH, LH, and growth hormone (GH) in quercetin-treated hens improved the production performance of hens (Yang et al., 2018). IGF1 is an important downstream mediator of the anabolic effects of GH, and changes in the GH level is associated with the production performance of hens. GH was shown to increase in laying birds, but it decreased in molting or nonlaying hens (Scanes et al., 1979). Collectively, the result suggests that the lowered circulating IGF1 concentration in LLR-hen was related to the low laying performance of aged hens.

Moreover, like in mammals, IGF1 could act as an autocrine or paracrine regulator of the developing ovarian follicles in domestic hens (Roberts et al., 1994). The IGF system that controls ovarian function in the avian species is complex and involves interactions with the gonadotrophins (LH and FSH), GH, and other growth factors (Onagbesan et al., 2009). Importantly, GH promotes the formation and development of prehierarchical follicles in the hen ovary during a pause in laying by regulating cell proliferation and apoptosis (Socha and Hrabia, 2019). An examination of the IGF1 level in the DF revealed that LLR hens had lowered IGF1 levels. Moreover, the increased expression level of IGF1R in the hypothalamus, pituitary, SWF, LWF, SYF, and DF of LLR hens may be a result of negative feedback mechanisms owing to the decreased IGF1 levels in circulation and follicles. Additionally, IGFs play a crucial role in avian reproduction as they hasten dose-dependent gonadal steroid hormone synthesis, cell proliferation, selection, and inhibition of follicular apoptosis (Lovell et al., 2002; Tosca et al., 2008). During the maturation of Japanese quail, IGF-1 expression in the F3 follicle was higher than in the F1 follicle (Shit et al., 2014). Since there were no differences in the follicle numbers and weights in the present study, it remains to be elucidated whether the decrease in IGF1 concentration was the cause or resultant effect of decreased follicular growth. In sheep, IGF1 in concert with FSH has a synergistic effect on oocyte development in vitro, increasing the percentage of fully-grown oocytes (Monte et al., 2019).

In conclusion, this study demonstrated that the aged hens with low laying rate exhibited relatively lowered IGF1 levels in the serum and DF, along with an upregulated IGF1R expression along the HPG axis and at various follicular stages. The hens with a relatively high laying rate had an increased capacity for estradiol production. Therefore, a decrease in the serum and follicular IGF1 level is associated with the reduction in egg production of aged laying hens. These findings provide novel insights into the inner workings of the HPG axis in aged hens with different laying rates, and it establishes the framework for further studies.

Acknowledgments

We appreciate Mei Zhao for her technical assistance during the experiment. This research was supported by the Key Technologies Research and Development Program (2021YFD1300405), the Key Technology Research and Development Program of Shandong province (2019JZZY020602), and Modern Agro-industry Technology Research System (CARS-40-K09).

Glossary

Abbreviations

CYP17A1

Cytochrome family 17 subfamily A polypeptide 1

CYP19A1

cytochrome P450 family 19 subfamilies A

DF

dominant follicles

E2

17-β-Estradiol

ESR1

estrogen receptor

FSH

follicle-stimulating hormone

FSHR

follicle-stimulating hormone receptor

GnRH

gonadotropin-releasing hormone

GnRHR

gonadotropin-releasing hormone receptor

GnIH

gonadotropin-inhibitory hormone

GnIHR

gonadotropin-inhibitory hormone receptor

HLR

high laying rate group

HPG axis

hypothalamus–pituitary–gonadal axis

IGF1

insulin-like growth factor 1

IGF1R

insulin-like growth factor 1 receptor

LH

luteinizing hormone

LHR

luteinizing hormone receptor

LLR

low laying rate group

LWF

large white follicles

MLR

medium laying rate group

SWF

small white follicles

SYF

small yellow follicles

Contributor Information

Qian Xin, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Victoria Anthony Uyanga, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Hongchao Jiao, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Jingpeng Zhao, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Xiaojuan Wang, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Haifang Li, College of Life Sciences, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Yunlei Zhou, College of Chemistry and Material Science, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Hai Lin, Department of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian, Shandong 271018, P. R. China.

Conflict of Interest Statement

The authors declare no real or perceived conflicts of interest.

Authors’ contributions

All authors contributed to the study’s conception and design. Q.X., V.A.U., X.W., and H.L. conceived and designed the experiments, and wrote the manuscript; Q.X. performed the experiments and analyzed the data; J.Z. designed the experimental diet and gave suggestions for data analysis; H.L., Y.Z., and H.J. provided essential reagents; and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Literature Cited

  1. Abdalhag, M. A., Li T., Duan L., Zhang T., Zhang G., Wang J., and Wang Y... 2016. Association analysis of IGF-I gene expression with growth and reproductive traits in Jinghai yellow chickens. Genet. Mol. Res. 15:1–11. doi: 10.4238/gmr15049205 [DOI] [PubMed] [Google Scholar]
  2. Adashi, E. Y., Resnick C. E., Brodie A. M., Svoboda M. E., and Van Wyk J. J... 1985. Somatomedin-C-mediated potentiation of follicle-stimulating hormone-induced aromatase activity of cultured rat granulosa cells. Endocrinol. 117:2313–2320. doi: 10.1210/endo-117-6-2313 [DOI] [PubMed] [Google Scholar]
  3. Adashi, E. Y., Resnick C. E., Ricciarelli E., Hurwitz A., Kokia E., Tedeschi C., Botero L., Hernandez E. R., Rosenfeld R. G., and Carlsson-Skwirut C... 1992. Granulosa cell-derived insulin-like growth factor (IGF) binding proteins are inhibitory to IGF-I hormonal action. Evidence derived from the use of a truncated IGF-I analogue. J. Clin. Invest. 90:1593–1599. doi: 10.1172/JCI116028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bain, M. M., Nys Y., and Dunn I. C... 2016. Increasing persistency in lay and stabilising egg quality in longer laying cycles. What are the challenges? Br. Poult. Sci. 57:330–338. doi: 10.1080/00071668.2016.1161727 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Biswas, A., Mohan J., and Sastry K. V... 2010. Age-dependent variation in hormonal concentration and biochemical constituents in blood plasma of Indian native fowl. Vet. Med. Int. 29:737292. doi: 10.4061/2010/737292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brady, K., Porter T. E., Liu H. C., and Long J. A... 2019. Characterization of gene expression in the hypothalamo-pituitary-gonadal axis during the preovulatory surge in the turkey hen. Poult. Sci. 98:7041–7049. doi: 10.3382/ps/pez437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brady, K., Porter T. E., Liu H. C., and Long J. A... 2020. Characterization of the hypothalamo-pituitary-gonadal axis in low and high egg producing turkey hens. Poult. Sci. 99:1163–1173. doi: 10.1016/j.psj.2019.12.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dang, X., and Kim I. H... 2021. Effects of dietary supplementation of herbal active ingredients promoting insulin-like growth factor-1 secretion on production performance, egg quality, blood hematology, and excreta gas emission in laying hens. Anim. Biosci. 34:1802–1810. doi: 10.5713/ab.20.0762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Drummond, A. E., and Findlay J. K... 1999. The role of estrogen in folliculogenesis. Mol. Cell. Endocrinol. 151:57–64. doi: 10.1016/s0303-7207(99)00038-6 [DOI] [PubMed] [Google Scholar]
  10. Etches, R. J., Petitte J. N., and Anderson-Langmuir C. E... 1984. Interrelationships between the hypothalamus, pituitary gland, ovary, adrenal gland, and the open period for LH release in the hen (Gallus domesticus). J. Exp. Zool. 232:501–511. doi: 10.1002/jez.1402320317 [DOI] [PubMed] [Google Scholar]
  11. Gautron, J., Réhault-Godbert S., Van de Braak T. G. H., and Dunn I. C... 2021. Review: what are the challenges facing the table egg industry in the next decades and what can be done to address them? Animal 15:100282. doi: 10.1016/j.animal.2021.100282 [DOI] [PubMed] [Google Scholar]
  12. Heidarzadehpilehrood, R., Pirhoushiaran M., Abdollahzadeh R., Binti Osman M., Sakinah M., Nordin N., and Abdul Hamid H... 2022. A review on CYP11A1, CYP17A1, and CYP19A1 polymorphism studies: candidate susceptibility genes for polycystic ovary syndrome (PCOS) and infertility. Genes 13:302. doi: 10.3390/genes13020302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hernandez, A. G., and Bahr J. M... 2003. Role of FSH and epidermal growth factor (EGF) in the initiation of steroidogenesis in granulosa cells associated with follicular selection in chicken ovaries. Reproduction 125:683–691. doi: 10.1530/rep.0.1250677 [DOI] [PubMed] [Google Scholar]
  14. Huang, C., Jiao H., Song Z., Zhao J., Wang X., and Lin H... 2015. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J. Anim. Sci. 93:2144–2153. doi: 10.2527/jas.2014-8739 [DOI] [PubMed] [Google Scholar]
  15. Johnson, P. A., Dickerman R. W., and Bahr J. M... 1986. Decreased granulosa cell luteinizing hormone sensitivity and altered thecal estradiol concentration in the aged hen, Gallus domesticus. Biol. Reprod. 35:641–646. doi: 10.1095/biolreprod35.3.641 [DOI] [PubMed] [Google Scholar]
  16. Kang, L., Zhang Y., Zhang N., Zang L., Wang M., Cui X., and Jiang Y... 2012. Identification of differentially expressed genes in ovaries of chicken attaining sexual maturity at different ages. Mol. Biol. Rep. 39:3037–3045. doi: 10.1007/s11033-011-1066-x [DOI] [PubMed] [Google Scholar]
  17. Kareem, K. Y., Loh T. C., Foo H. L., Akit H., and Samsudin A. A... 2016. Effects of dietary postbiotic and inulin on growth performance, IGF1 and GHR mRNA expression, faecal microbiota and volatile fatty acids in broilers. BMC Vet. Res. 12:163. doi: 10.1186/s12917-016-0790-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Khairy Zoheir, K. M., and Ahmed R. D... 2011. Patterns of folliculogenesis in ducks following the administration of a gonadotropin-releasing hormone1 (GnRH) analogue. J. Genet. Eng. Biotechnol. 10:93–99. doi: 10.1016/j.jgeb.2011.12.002 [DOI] [Google Scholar]
  19. Kim, M. H., Seo D. S., and Ko Y... 2004. Relationship between egg productivity and insulin-like growth factor-I genotypes in Korean native Ogol chickens. Poult. Sci. 83:1203–1208. doi: 10.1093/ps/83.7.1203 [DOI] [PubMed] [Google Scholar]
  20. Li, G., Sun D. X., Yu Y., Liu W. J., Tang S. Q., Zhang Y., Wang Y. C., Zhang S. L., and Zhang Y... 2011. Genetic effect of the follicle-stimulating hormone receptor gene on reproductive traits in Beijing You chickens. Poult. Sci. 90:2487–2492. doi: 10.3382/ps.2010-01327 [DOI] [PubMed] [Google Scholar]
  21. Liu, Y., Li Y., Liu H. N., Suo Y. L., Hu L. L., Feng X. A., Zhang L., and Jin F... 2013. Effect of quercetin on performance and egg quality during the late laying period of hens. Br. Poult. Sci. 54:510–514. doi: 10.1080/00071668.2013.799758 [DOI] [PubMed] [Google Scholar]
  22. Louwers, Y. V., Stolk L., Uitterlinden A. G., and Laven J. S... 2013. Cross-ethnic meta-analysis of genetic variants for polycystic ovary syndrome. J. Clin. Endocrinol. Metab. 98:E2006–E2012. doi: 10.1210/jc.2013-2495 [DOI] [PubMed] [Google Scholar]
  23. Lovell, T. M., Gladwell R. T., Groome N. P., and Knight P. G... 2002. Modulatory effects of gonadotrophins and insulin-like growth factor on the secretion of inhibin A and progesterone by granulosa cells from chicken preovulatory (F1-F3) follicles. Reproduction 123:291–300. doi: 10.1530/rep.0.1230291 [DOI] [PubMed] [Google Scholar]
  24. Lovell, T. M., Gladwell R. T., Groome N. P., and Knight P. G... 2003. Ovarian follicle development in the laying hen is accompanied by divergent changes in inhibin A, inhibin B, activin A and follistatin production in granulosa and theca layers. J. Endocrinol. 177:45–55. doi: 10.1677/joe.0.1770045 [DOI] [PubMed] [Google Scholar]
  25. McElroy, A. P., Caldwell D. J., Proudman J. A., and Hargis B. M... 2004. Modulation of in vitro DNA synthesis in the chicken ovarian granulosa cell follicular hierarchy by follicle-stimulating hormone and luteinizing hormone. Poult. Sci. 83:500–506. doi: 10.1093/ps/83.3.500 [DOI] [PubMed] [Google Scholar]
  26. Mellouk, N., Ramé C., Barbe A., Grandhaye J., Froment P., and Dupont J... 2018. Chicken is a useful model to investigate the role of adipokines in metabolic and reproductive diseases. Int. J. Endocrinol. 2018:4579734. doi: 10.1155/2018/4579734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Molnár, A., Maertens L., Ampe B., Buyse J., Kempen I., Zoons J., and Delezie E... 2016. Changes in egg quality traits during the last phase of production: is there potential for an extended laying cycle? Br. Poult. Sci. 57:842–847. doi: 10.1080/00071668.2016.1209738 [DOI] [PubMed] [Google Scholar]
  28. Monte, A. P. O., Barros V. R. P., Santos J. M., Menezes V. G., Cavalcante A. Y. P., Gouveia B. B., Bezerra M. E. S., Macedo T. J. S., and Matos M. H. T... 2019. Immunohistochemical localization of insulin-like growth factor-1 (IGF-1) in the sheep ovary and the synergistic effect of IGF-1 and FSH on follicular development in vitro and LH receptor immunostaining. Theriogenology 129:61–69. doi: 10.1016/j.theriogenology.2019.02.005 [DOI] [PubMed] [Google Scholar]
  29. Onagbesan, O. M., and Peddie M. J... 1995. Effects of insulin-like growth factor I and interactions with transforming growth factor alpha and LH on proliferation of chicken granulosa cells and production of progesterone in culture. J. Reprod. Fertil. 104:259–265. doi: 10.1530/jrf.0.1040259 [DOI] [PubMed] [Google Scholar]
  30. Onagbesan, O. M., Vleugels B., Buys N., Bruggeman V., Safi M., and Decuypere E... 1999. Insulin-like growth factors in the regulation of avian ovarian functions. Domest Anim. Endocrinol. 17:299–313. doi: 10.1016/s0739-7240(99)00046-6 [DOI] [PubMed] [Google Scholar]
  31. Onagbesan, O., Bruggeman V., and Decuypere E... 2009. Intra-ovarian growth factors regulating ovarian function in avian species: a review. Anim. Reprod. Sci. 111:121–140. doi: 10.1016/j.anireprosci.2008.09.017 [DOI] [PubMed] [Google Scholar]
  32. Ormerod, B. K., and Galea L. A... 2001. Reproductive status influences cell proliferation and cell survival in the dentate gyrus of adult female meadow voles: a possible regulatory role for estradiol. Neuroscience 102:369–379. doi: 10.1016/s0306-4522(00)00474-7 [DOI] [PubMed] [Google Scholar]
  33. Roberts, R. D., Sharp P. J., Burt D. W., and Goddard C... 1994. Insulin-like growth factor-I in the ovary of the laying hen: gene expression and biological actions on granulosa and thecal cells. Gen. Comp. Endocrinol. 93:327–336. doi: 10.1006/gcen.1994.1037 [DOI] [PubMed] [Google Scholar]
  34. Rosenfield, R. L., Barnes R. B., Cara J. F., and Lucky A. W... 1991. Dysregulation of cytochrome P450c17α as the cause of polycystic ovarian syndrome. Int. J. Gynecol. Obstet. 34:286–287. doi: 10.1016/0020-7292(91)90373-D [DOI] [Google Scholar]
  35. Saleh, A. A., Ahmed E. A. M., and Ebeid T. A... 2019. The impact of phytoestrogen source supplementation on reproductive performance, plasma profile, yolk fatty acids and antioxidative status in aged laying hens. Reprod. Domest. Anim. 54:846–854. doi: 10.1111/rda.13432 [DOI] [PubMed] [Google Scholar]
  36. Scanes, C. G., Sharp P. J., Harvey S., Godden P. M., Chadwick A., and Newcomer W. S... 1979. Variations in plasma prolactin, thyroid hormones, gonadal steroids and growth hormone in turkeys during the induction of egg laying and moult by different photoperiods. Br. Poult. Sci. 20:143–148. doi: 10.1080/00071667908416561 [DOI] [PubMed] [Google Scholar]
  37. Shen, S. T., Cheng Y. S., Shen T. Y., and Yu Y. L... 2006. Molecular cloning of follicle-stimulating hormone (FSH)-β subunit cDNA form duck pituitary. Gen. Comp. Endocrinol. 148:388–394. doi: 10.1016/j.ygcen.2006.03.013 [DOI] [PubMed] [Google Scholar]
  38. Shit, N., Sastry K. V., Singh R. P., Pandey N. K., and Mohan J... 2014. Sexual maturation, serum steroid concentrations, and mRNA expression of IGF-1, luteinizing and progesterone hormone receptors and survivin gene in Japanese quail hens. Theriogenology 81:662–668. doi: 10.1016/j.theriogenology.2013.12.011 [DOI] [PubMed] [Google Scholar]
  39. Socha, J. K., and Hrabia A... 2019. Response of the chicken ovary to GH treatment during a pause in laying induced by fasting. Domest Anim. Endocrinol. 69:84–95. doi: 10.1016/j.domaniend.2019.05.001 [DOI] [PubMed] [Google Scholar]
  40. Song, M., Lin X., Zhao J., Wang X., Jiao H., Li H., Sun S., and Lin H... 2020. High frequency vaccination-induced immune stress reduces bone strength with the involvement of activated osteoclastogenesis in layer pullets. Poult. Sci. 99:734–743. doi: 10.1016/j.psj.2019.12.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tang, D., Wu J., Jiao H., Wang X., Zhao J., and Lin H... 2019. The development of antioxidant system in the intestinal tract of broiler chickens. Poult. Sci. 98:664–678. doi: 10.3382/ps/pey415 [DOI] [PubMed] [Google Scholar]
  42. Tosca, L., Chabrolle C., Crochet S., Tesseraud S., and Dupont J... 2008. IGF-1 receptor signaling pathways and effects of AMPK activation on IGF-1-induced progesterone secretion in hen granulosa cells. Domest Anim. Endocrinol. 34:204–216. doi: 10.1016/j.domaniend.2007.03.001 [DOI] [PubMed] [Google Scholar]
  43. Uerlings, J., Song Z. G., Hu X. Y., Wang S. K., Lin H., Buyse J., and Everaert N... 2018. Heat exposure affects jejunal tight junction remodeling independently of adenosine monophosphate-activated protein kinase in 9-day-old broiler chicks. Poult. Sci. 97:3681–3690. doi: 10.3382/ps/pey229 [DOI] [PubMed] [Google Scholar]
  44. Uyanga, V. A., Xin Q., Sun M., Zhao J., Wang X., Jiao H., Onagbesan O. M., and Lin H... 2022. Research note: Effects of dietary L-arginine on the production performance and gene expression of reproductive hormones in laying hens fed low crude protein diets. Poult. Sci. 101:101816. doi: 10.1016/j.psj.2022.101816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Waddington, D., Perry M. M., Gilbert A. B., and Hardie M. A... 1985. Follicular growth and atresia in the ovaries of hens (Gallus domesticus) with diminished egg production rates. J. Reprod. Fertil. 74:399–405. doi: 10.1530/jrf.0.0740399 [DOI] [PubMed] [Google Scholar]
  46. Wang, C., and Ma W... 2019. Hypothalamic and pituitary transcriptome profiling using RNA-sequencing in high-yielding and low-yielding laying hens. Sci. Rep. 9:10285. doi: 10.1038/s41598-019-46807-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wang, H., Wang X., Zhao J., Jiao H., and Lin H... 2020. Low protein diet supplemented with crystalline amino acids suppressing appetite and apo-lipoprotein synthesis in laying hens. Anim. Feed. Sci. Tech. 266:114533. doi: 10.1016/j.anifeedsci.2020.114533 [DOI] [Google Scholar]
  48. Williams, J. B., and Sharp P. J... 1978. Ovarian morphology and rates of ovarian follicular development in laying broiler breeders and commercial egg-producing hens. Br. Poult. Sci. 19:387–395. doi: 10.1080/00071667808416490 [DOI] [Google Scholar]
  49. Xiao, S., Robertson D. M., and Findlay J. K... 1992. Effects of activin and follicle-stimulating hormone (FSH)-suppressing protein/follistatin on FSH receptors and differentiation of cultured rat granulosa cells. Endocrinol. 131:1009–1016. doi: 10.1210/endo.131.3.1505447 [DOI] [PubMed] [Google Scholar]
  50. Xin, Q., Wang M., Jiao H., Zhao J., Li H., Wang X., and Lin H... 2021. Prolonged scotophase within a 24 hour light regime improves eggshell quality by enhancing calcium deposition in laying hens. Poult. Sci. 100:101098. doi: 10.1016/j.psj.2021.101098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yang, J., Long D. W., and Bacon W. L... 1997. Changes in plasma concentrations of luteinizing hormone, progesterone, and testosterone in turkey hens during the ovulatory cycle. Gen. Comp. Endocrinol. 106:281–292. doi: 10.1006/gcen.1997.6884 [DOI] [PubMed] [Google Scholar]
  52. Yang, J. X., Chaudhry M. T., Yao J. Y., Wang S. N., Zhou B., Wang M., Han C. Y., You Y., and Li Y... 2018. Effects of phyto-oestrogen quercetin on productive performance, hormones, reproductive organs and apoptotic genes in laying hens. J. Anim. Physiol. Anim. Nutr. (Berl) 102:505–513. doi: 10.1111/jpn.12778 [DOI] [PubMed] [Google Scholar]
  53. Zhang, Q., Wang P., Cong G., Liu M., Shi S., Shao D., and Tan B... 2021. Comparative transcriptomic analysis of ovaries from high and low egg-laying Lingyun black-bone chickens. Vet. Med. Sci. 7:1867–1880. doi: 10.1002/vms3.575 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES