Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 18.
Published in final edited form as: J Neurosci Methods. 2021 Nov 9;366:109406. doi: 10.1016/j.jneumeth.2021.109406

Severe acute neurotoxicity reflects absolute intra-carotid 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine dose in non-human primates

SA Norris a,b,*, HCB White a, A Tanenbaum a, EL Williams a, C Cruchaga c, L Tian a, RE Schmidt d, JS Perlmutter a,b,e,f,g
PMCID: PMC9673039  NIHMSID: NIHMS1849546  PMID: 34767855

1. Introduction

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) produces neurotoxic effects first discovered following accidental human exposure causing parkinsonism (Davis et al., 1979; Langston et al., 1983). This observation led to development of non-human primate (NHP) MPTP models of parkinsonism that have substantially improved our understanding of mechanisms related to nigrostriatal injury and facilitated therapeutic development in Parkinson disease (Bankiewicz et al., 1986). MPTP’s toxic effects relate to its high lipophilic nature, nearly complete first-pass extraction across the blood-brain barrier, and conversion to the toxic metabolite, MPP+ , by monoamine oxidase type B. MPP+ has high affinity for the dopamine transporter and neuromelanin (D’Amato et al., 1986), that enhances toxic specificity for nigrostriatal dopaminergic neurons, potentially mediated by MPP+ inhibition of mitochondrial complex I. The subsequent nigrostriatal injury causes parkinsonism that responds to dopaminergic drugs (Fox and Brotchie, 2010).

MPTP related neurotoxicity produces predominant loss of dopaminergic nigral neurons and their striatal terminals (Burns et al., 1983; Langston et al., 1984). Additionally, there may be lesser effect on non-dopaminergic neurotransmitter systems and extra-striatal regions (Fukuda et al., 1992; Kanazawa et al., 2017; Pifl et al., 1991). There are numerous methods for MPTP administration, but unilateral intra-carotid administration poses distinct advantages for many research applications due to the ipsilateral loss of nigrostriatal neurons associated with contralateral parkinsonism since each animal does not require symptomatic treatment to maintain ability to care for itself with minimal functional impairment. This allows many research investigations to be completed without confounds of symptomatic treatment. For some studies, contralateral brain regions may serve as a within subject internal control, at least for presynaptic measures (Karimi et al., 2013). However, contralateral effects on post-synaptic specific binding sites may occur (Todd et al., 1996). The unilateral, intra-carotid approach also permits dose response studies (Karimi et al., 2013; Brown et al., 2013), however, unilateral administration of higher MPTP doses may cause severe acute neurotoxicity with grossly identified edematous striatal injury (Emborg, 2007; Miletich et al., 1994). Dose thresholds related to severe acute neurotoxicity outcomes remain unknown.

Animal weight-based dose strategies (i.e. the administered MPTP dose is delivered in proportion to body weight, assuming proportional pharmacokinetic parameters) classically predict MPTP outcomes related to speed of histopathologic and phenotypic effects following unilateral intra-carotid administration. There is additional emphasis on weight-based dose adjustments related to variable age and species related toxicity, specifically dose reductions in older animals (Emborg, 2007; Ovadia et al., 1995). However, others have demonstrated stable brain weights across the adult age-spectrum in NHPs (Pardo et al., 2012; Sakamoto et al., 2014). Given that major determinants of a drug’s volume of distribution include physiologic space and drug clearance, use of animal weight as a determinant of direct intra-carotid MPTP dosing may not properly estimate the volume of relevant distribution in animals with brain volume that do not relate to body weight (Alavijeh et al., 2005). This may be particularly relevant given the high first-pass extraction of MPTP with direct intra-carotid administration. Thus, we hypothesized that absolute MPTP dose, defined as the total amount of MPTP salt administered, better predicts severe acute neurotoxicity following unilateral intra-carotid administration.

2. Materials and methods

2.1. Animals

All data presented within this manuscript represent retrospective cross-sectional analysis of data collected from a consecutive series of 78 of 80 male Macaca fascicularis monkeys injected with MPTP and two additional animals that did not receive MPTP. Data are extracted from independent research studies spanning from 2003 to 2020 at Washington University in St. Louis. Two animals were excluded from analysis due to independent health issues unrelated to MPTP administration (pancreatic cancer and Acute Respiratory Distress Syndrome secondary to aspiration pneumonia). All experiments relied on the minimum number of animals necessary for adequate statistical power in the respective study. In accordance with the recommendations of the Weatherall report “The Use of Non-Human Primates in Research,” all steps were taken to ameliorate suffering in these studies. Guidelines prescribed by the NIH Guide for the Care and Use of Laboratory Animals (NIH Publications No. 8023, revised 1978) were followed, and all studies were approved by the institutional animal care and use committee at Washington University in St Louis (protocols: 20170100; 20180316; 20170162). All animals were housed individually; maintained in facilities with 12–hour dark and light cycles; provided access to food and water ad libitum; and equally engaged with a variety of psychologically enriching tasks, such as watching movies or playing with appropriate toys.

2.2. MPTP administration

Animal age and weight were recorded at the time of MPTP administration. Unilateral internal carotid artery infusion was performed under fluoroscopic guidance in anesthetized animals, as described elsewhere (Dugan et al., 2014; Tabbal et al., 2006). Anesthesia was induced with ketamine (10–15 mg/kg intramuscularly), followed by endotracheal intubation and maintenance of anesthesia using inhaled isoflurane (1.2–3.5%) alone or in combination with nitrous oxide (40–50%, n = 21). MPTP (Sigma, St Louis, MO) in 0.9% sodium chloride injection, USP (0.1 mg/ml) was infused at variable doses ranging from 0.06 to 0.25 mg/kg (weight based), not faster than 1 ml/min into the internal carotid artery (Tabbal et al., 2006). The dose range reflects randomization of a subset of animals (n = 17) in attempt to produce a broader range of nigrostriatal injury and neurotoxic effect. All animals received a single dose of MPTP; there was a single exception that received a second dose (0.25 mg/kg) following absent clinical and neuroimaging characteristics to support MPTP induced nigrostriatal injury following the initial 0.25 mg/kg dose. All animals received MPTP in the right internal carotid artery, with two exceptions receiving MPTP in the left internal carotid artery. Location of the infusion catheter was confirmed with angiograms before and after all MPTP infusion. Absolute MPTP dose was calculated as the sum of infused MPTP salt. The supplementary table reflects demographics, MPTP dosing, and experimental outcomes for all included animals.

2.3. MPTP recovery

Each animal was allowed to recover with constant observation until able to drink, eat and independently care for itself. If the animal 1) did not recover in this manner or 2) exhibited declining level of consciousness, autonomic stability, or focal neurological exam deficits (including hemiparesis, but not dystonia, or ipsiversive [with respect to side of MPTP infusion] spontaneous circling) in the immediate recovery period, we euthanized the animals in consultation with the staff veterinarian to ameliorate animal suffering. This outcome was considered a severe acute neurotoxic outcome from MPTP administration, as supported by gross brain inspection and histopathological analysis (see Results).

Full biohazard/neurotoxin precautions for MPTP were taken prior to, during, and after the injection, and all excretions for the 24 h following MPTP infusion were isolated and disposed of appropriately. Proper safety procedures were followed for handling MPTP and all contaminated tissues and waste products (Tian et al., 2012).

2.4. Deferred MPTP dosing

Two animals underwent catheterization of the right internal carotid artery with intent to administer MPTP, but infusion was deferred following observation of change in vital signs and flow voids distal to the infusion catheter on pre-infusion angiogram raising concerns about an ongoing cerebral ischemic event. Thus, the procedure was aborted when the animals had changes in vital signs and evidence of flow voids on cerebral angiography raising concern about a procedural related ischemic event. The animals were then allowed to recover from anesthesia in their cage while observed closely for clinical signs related to the observed flow voids.

2.5. Study completion and sample preparation

At completion of the respective experiment or with a severe acute neurotoxic MPTP outcome, animals were euthanized with intravenous pentobarbital (100–150 mg/kg; Somnasol Euthanasia; Butler Schein Animal Health, Dublin, OH). Brain tissue was removed within 10 min of euthanasia and handled and prepared as described previously (Tabbal et al., 2012).

2.6. Brain volume calculation

Magnetization-prepared rapid acquisition with gradient echo (MPRAGE) structural images were obtained for all animals prior to MPTP. Animals were anesthetized during image acquisition. MPRAGE images were acquired via an 8- or 15-channel extremity coil on a Siemens (Erlangen, Germany) MAGNETOM Sonata (1.5T, n = 22), Trio (3T, n = 25) or Prisma (3T, n = 31) magnetic resonance image (MRI) machine, respectively. TE ranged from 0.00351 to 0.00396, T1: 0.88 (Sonata™) to 1.0 (Trio and Prisma), TR: 1.52–2.4, and flip angle: 7 (Trio and Prisma) or 15 (Sonata™). The resulting image for all animals maintained an x,y,z, spatial resolution of approximately 0.8 mm3. Whole brain volumes were calculated in the following manner: First, individual MPRAGE images were bias field corrected using N4ITK1, then manually cropped to reduce the search window for registration. We then linearly registered images to a target in MNI macaque space(2,3,4) using in-house software. Using the linear transform, unregistered images were non-linearly registered to MNI macaque space using FNIRT(5,6,7,8) with a 6-mm warp resolution. The warp was then inverted to form a subject specific brain mask in MNI macaque space. Individual brain volumes were computed by volume of the subject specific brain mask.

2.7. Observations of the fresh brain

At the time of brain extraction, observations were made that included appearance of each hemisphere, cortical surfaces, brainstem and cerebellum. The brainstem and cerebellum were dissected free from the hemispheres. The hemispheres of the cerebrum were split in the midsagittal plane and each hemisphere was sliced in the coronal plane. Any observed abnormalities including tissue softening were documented. About half of the brain tissues from individual animals with acute recovery were fixed for histology and the other half used for biochemical analyses and various autographic measures.

2.8. Histopathology

In four animals (two with severe acute MPTP neurotoxicity and two with acute iatrogenic ischemic stroke, tissue was fixed in formalin for more than 2 weeks and coronal sections prepared by sectioning the cerebral hemispheres, basal ganglia, thalamus, cerebellum and brainstem. Samples of bilateral basal ganglia and adjacent cerebral hemisphere in these four animals were sectioned, processed in graded alcohols, xylene and paraffin embedded. Seven micron sections were stained with hematoxylin and eosin (H&E) and examined by a neuropathologist (author RES).

2.9. MAO-B genotyping

Monoamine oxidase B (MAO-B) converts MPTP to its toxic metabolite MPP+ , as supported by MAO-B inhibitors blocking MPTP-induced nigrostriatal injury (Kupsch et al., 2001). In humans, the rs1799836 polymorphism is associated with varying levels of enzyme activity and could contribute to altered acute MPTP response in our NHP model. The G allele of MAO-B polymorphism rs1799836 (A644G) is associated with lower brain MAO-B activity, while the A-allele is associated with higher mRNA levels of MAO-B (Balciuniene et al., 2002). The MAO-B gene contains single- stranded conformational polymorphisms that are preserved across NHP species (Jones et al., 2020; Hong et al., 2008). Thus, we assayed MAO-B genotype (rs1799836: A/G) in 43 NHPs in the current study, 5 with severe acute neurotoxicity. Genotyping was performing using the KASPAR technology. Allele specific primers (rs1799836_A: GAAGGTGACCAAGTTCATGCTGAGCAGATTAGAAGAAAGATGATGTCA and rs1799836_G: GAAGGTCGGAGTCAACGGATTAGCAGATTAGAAGAAAGATGATGTCG) as well as a common forward primer (rs1799836_C1: CTTCATCCTCTGGAATCTTCCCCAT) were designed. Genotyping was performing using 10 ng of DNA following the K-bioscience competitive Allele-Specific Polymerase chain reaction (KASPar) protocol as well as PCR cycles. In each run, positive controls for each genotypes as well as negative controls were included.

2.10. Statistics

All statistics were performed using IBM SPSS statistics for Windows, Version 27. Plots were generated using GraphPad Prism, version 9.0.0. Weight-based and absolute MPTP dose medians were compared across outcomes using Mann-Whitney U for independent samples. Mean brain volume and animal age was compared across outcomes using a 2-tailed Student t-test for independent samples. We performed Pearson correlation to determine the association between brain volume and animal weight, or absolute MPTP dose. Logistic regression, using the maximum likelihood estimation model, was performed to ascertain the effects of absolute MPTP dose, age, weight, and brain volume on the likelihood that animals develop severe acute neurotoxicity immediately following MPTP. We additionally performed a test for multicollinearity prior to logistic regression. Odds ratios were calculated for comparison of acute outcomes (acute recovery versus severe acute neurotoxicity) in relation to the absolute MPTP dose, where the value of 2 mg was arbitrarily selected based on visual inspection of the separation of analyzed outcomes. Significance was defined as p < 0.05 for all analyses.

3. Results

3.1. Striatal softening following severe acute neurotoxicity

For animals with severe acute neurotoxicity, all brains were extracted within 48 h of MPTP administration (median 9 h, range 3–48). Detailed brain extraction records were available in 15 of 17 animals with severe acute neurotoxicity. Thirteen of these were noted to have softening of brain tissue in the striatum, only on the side for which MPTP was administered (Fig. 1).

Fig. 1.

Fig. 1.

Gross brain pathology 10 h post-MPTP from the same animal. Sections demonstrate an anterior striatal coronal section (top = superior, bottom = inferior brain) for A) right (MPTP infused) striatum and B) left (no MPTP) striatum. White arrows indicate regions of MPTP infused striatum with striatal edema associated with softening when palpated.

3.2. Iatrogenic ischemic stroke

We identified distal flow voids in the internal carotid artery of two animals and then did not infuse MPTP in either one. In recovery from anesthesia, both had clinical signs of acute ischemic stroke, including dense hemiplegia and fixed gaze with progressive lethargy. These two animals were euthanized and brains extracted within 3.25 (MOVe) and 4 (MOJe) hours post-catheterization, respectively. Detailed records noted normal brain anatomy without cortical or striatal softening despite subtle histologic evidence of acute stroke on formal pathology review (see subsection below). This outcome was considered an acute iatrogenic ischemic stroke.

3.3. Histopathological dissociation of acute neurotoxicity and ischemic stroke

In context of the key goal to differentiate severe acute neuronal injury from potential ischemic from neurotoxic injury, we performed H&E staining to improve neuropathology along these lines to differentiate acute neurotoxicity versus acute stroke.

Acute neurotoxicity: Prominent histopathology was seen in basal ganglia and adjacent cortex of two animals, only on the side of MPTP administration. Areas of the basal ganglia (blue arrows, Fig. 2A) for MMo showed discrete regions of pallor involving basal ganglia and overlying cerebral hemisphere. Higher magnification of the right caudate, putamen and thalamus showed discrete separation between normal tissue and involved tissue (arrowheads, Fig. 2B). Higher magnification shows the junction of normal tissue with prominent neuronal cell bodies (blue arrow, Fig. 2C) and an infarct, the latter area characterized by pallor, edema, and eosinophilic neurons (red arrow, Fig. 2C). There were no marginated or parenchymal polymorphonuclear leukocytes, macrophages, intravascular embolic material, or vasculitis. While this microscopic appearance is consistent with an acute infarct, these findings would be unusual this soon after the infarct (< 6 h post-catheterization with MPTP administration). A second animal (MOLa) showed grossly and microscopically comparable involvement of basal ganglia and cortex on the injected side.

Fig. 2.

Fig. 2.

Hematoxylin and Eosin staining in a single animal (MMo) 5.5 h following MPTP administration (A-C): A) whole mount image of basal ganglia and adjacent cortex with pale basal ganglia lesions (arrows); B) 4X magnification, lesion margin with normal tissue (arrows demarcate separation), C) 20X magnification, junction of normal cortex (left, blue arrow) and neurons undergoing esosinophilic neuronal necrosis (right, red arrow). These abnormalities are greater than expected 5.5 h following acute ischemic stroke, thus representing toxic injury; D-F) Similar images for a separate animal (MJe) 3.25 h following iatrogenic ischemic stroke demonstrating normal histology as would be anticipated in this time period.

Acute stroke: In contrast, two animals with intracranial flow voids post-catheterization (without administration of MPTP) failed to show gross or microscopic pathology that would be typical of a stroke, but the animals were euthanized less than 4 h after the event. This may be too soon to develop the typical histologic features of ischemic infarct (Fig. 2D–F).

In summary, the gross and microscopic appearance of the brain reveal confluent areas of pallor, edema and eosinophilic neuronal necrosis consistent with acute neurotoxicity in animals that received MPTP. This contrasts with animals that did not receive MPTP but had clinical infarcts consistent with angiographically identified flow-voids in the internal carotid artery without histopathologic evidence of acute ischemia that is anticipated in this short clinical time course.

3.4. Absolute MPTP dose predicts acute outcome

The median absolute MPTP dose was 1.84 mg (range: 0.294–3.15 mg) across 78 male Macaca fascicularis NHPs. 17/78 (22%) of animals experienced severe acute neurotoxicity during the recovery period following intra-carotid MPTP administration. 16/17 (94%) of those with severe acute neurotoxicity received the highest (0.25 mg/kg) weight-based dose, while 45/61 (74%) of animals that received 0.25 mg/kg did not experience severe acute neurotoxicity. In contrast, severe acute neurotoxicity occurred in 1 (6%) of 17 animals receiving a dose ≤ 0.2 mg/kg. There was a difference in the median (U[Nacute recovery=61, Nsevere acute neurotoxicity=17]=801.5, z = 3.4, p = 0.0492) absolute MPTP dose between animals with acute recovery and severe acute neurotoxicity (Fig. 3A).

Fig. 3.

Fig. 3.

MPTP dosing strategy and immediate post-procedural recovery. A) Absolute MPTP dose is significantly different in animals with acute recovery versus severe acute neurotoxicity. B) Weight-based MPTP dose is not significantly different across the same outcomes.

The logistic regression model to ascertain effects of absolute MPTP dose, age, weight, and brain volume on the likelihood that animals develop severe acute neurotoxicity immediately following MPTP was statistically significant, X2(4) = 16.7, p < 0.001. The model explained 29.6% (Nagelkerke R2) of the variance of MPTP immediate outcomes and correctly identified 82.1% of cases with acute recovery versus severe acute neurotoxicity. The predictor variable, absolute MPTP dose, was found to contribute to the maximum likelihood estimation model with an unstandardized Beta weight of the Constant: B = (−7.23), S.E. = 1.94, Wald = 13.9, p < 0.001; the unstandardized Beta weight for absolute MPTP dose: B = 2.95, S.E. 0.90, Wald = 10.7, p = 001. Thus, increasing absolute MPTP dose related to an increased likelihood of severe acute neurotoxicity while age (B = 0.19, S.E. = 0.25, Wald = 0.61, p = 0.308), weight (B = 0.39, S.E. = 0.32, Wald = 2.97, p = 0.211), and brain volume (B = 0.03, S.E. = 0.04, Wald = 0.41, p = 0.445) did not significantly predict this outcome variable in the logistic model. A test for multicollinearity of age (VIF = 1.28), weight (VIF = 1.94), and brain volume (VIF = 1.03) demonstrated lack of redundancy across these variables in the regression model. The odds ratio for severe acute neurotoxicity was 8.4 (95% CI[2.4,29.4]) for animals receiving less than 2 mg compared to those receiving more than 2 mg of MPTP.

3.5. Acute outcome does not differ based on weight-based MPTP dose

The median weight-based dose was 0.25 mg/kg (range 0.06 mg/kg to 0.25 mg/kg) across 78 male Macaca fascicularis NHPs. There was no difference in the median (U[Nacute recovery=61, Nsevere acute neurotoxicity=17]=629, z = 1.8, p = 0.076) weight-based MPTP dose between animals with acute recovery and severe acute neurotoxicity (Fig. 3B).

3.6. Brain volume does not differ based on acute clinical outcome

Mean total brain volume at the time of MPTP administration did not differ (t = 0.7984, p = 0.427) between animals with acute recovery (83.4 cm3, standard deviation = 8.3) and severe acute neurotoxicity (81.6 cm3 ± 6.5 standard deviation) (Fig. 4A). Total brain volume did not correlate with absolute MPTP dose (r[78] = −0.001, p = 0.995) or animal weight (r[78] = 0.025, p = 0.828) (Fig. 4B–C). The relationship of animal weight versus age was non-linear, particularly for animals with acute recovery (Fig. 4D). Mean age of animals did not differ between those with acute recovery (7.2 years ± 1.5 standard deviation) versus severe acute neurotoxicity (7.9 years ± 1.3 standard deviation) outcomes following MPTP (t = −1.81, p = 0.075).

Fig. 4.

Fig. 4.

A) scatter plots of brain volume for both MPTP outcome groups. Horizontal bars represent mean brain volumes which do not differ between groups. Scatterplots of B) brain volume versus absolute dose, C) brain volume versus weight, and D) animal weight versus age with independent linear fits for recovery (solid line) and severe neurotoxicity (dashed line) groups.

3.7. MAO-B genotype

Thirty-seven of 38 animals with MAO-B genotype and acute recovery, and 4 of 5 with severe acute neurotoxicity were homozygous for the allele A. A single animal with acute recovery was heterozygous for allele A and G, and a single animal with severe acute neurotoxicity was homozygous for the allele G. All animals with MAO-B genotype and severe acute neurotoxicity received 0.25 mg/kg and a mean absolute dose of 2.31 mg ( ± 0.12 standard deviation; range = 2.08–2.425). The MPTP dose for the single animal with a homozygous allele G polymorphism and severe acute neurotoxicity was 2.08 mg.

4. Discussion

We demonstrate that absolute MPTP dosing (defined as the sum of MPTP salt administered) improves prediction of severe acute neurotoxicity in Macaca fascicularis following unilateral intra-carotid administration compared to weight-based dosing. The mean brain volume of animals did not differ between those with acute recovery versus severe acute neurotoxicity during the immediate post-procedural period. When accounting for animal weight, brain volume, our findings indicate that an absolute dosing strategy substantially improves estimation of risk of severe acute MPTP-related neurotoxicity. Based on our observations, we propose application of absolute- rather than weight-based dosing for unilateral intra-carotid MPTP administration in NHPs.

Animals receiving > 2.0 mg of MPTP were 8.4 times more likely to experience severe acute neurotoxicity than those receiving < 2.0 mg. In contrast, weight-based MPTP dosing did not predict nearly as well as whether the animal would have recovered well or sustain severe acute neurotoxicity. In general, prognosis following drug-induced neurotoxicity depends on the duration and degree of drug exposure. Our systematic application of single, slow intra-carotid MPTP infusions inherently controlled for exposure duration. Thus, degree of exposure, as measured by absolute MPTP dose, appears to represent a sensitive predictor of dose-related neurotoxicity contributing to acute outcomes and survivability.

It is not surprising that weight-based strategies historically offer a surrogate dose estimate given observations that NHP weight closely relates to brain weight (Herndon et al., 1998). However, one would anticipate potentially overestimating the absolute MPTP dose in an animal with increased bodyweight relative to nearly constant brain volumes as observed in our study. This is particularly relevant in context of direct intra-carotid application, given the high first-pass extraction of MPTP. In other words, intra-carotid administration bypasses typical weight-based considerations meant to account for potential influences on distribution volume. Thus, while animal weight-based dosing strategies may remain imperative for systemic applications that account for variable distribution volumes, our data support use of absolute dosing strategies for direct intra-carotid MPTP administration.

Our data demonstrate that brain volume does not vary with body weights, consistent with prior reports of consistent brain weights across the adult Macaca fascicularis population (Pardo et al., 2012; Sakamoto et al., 2014). However, a lack of relationship between animal weight and brain volume contrasts with prior observations in Macaca mulatta NHPs (Herndon et al., 1998). This discrepancy, while biased by potential species differences and a reduced age range in our study, may remain relevant in context of age-related observations in our data. Specifically, others have reported increased MPTP susceptibility with increasing age across a much larger age range (Ovadia et al., 1995), recommending dose reductions in older rhesus monkeys29Relative MPTP dose also appears lower in our male Macaca fascicularis cohort compared to reported toxicity in rhesus macaques (Emborg, 2007; Miletich et al., 1994). It remains unclear if this relates to interspecies differences or brain volume discrepancies across the species where the average cynomolgus brain weighs approximately 68–74 g in the studied age range (Pardo et al., 2012; Mandikian et al., 2018) compared to 96.1 g in adult male rhesus monkeys (Herndon et al., 1998). While there is a trend toward age related effects and acute MPTP-related outcomes in our data, this does not achieve significance. Interpretation of age contributions to acute neurotoxicity is limited in our study where the maximum age is 12 years, compared to 23 and 31 in prior studies that demonstrate effects of age (Ovadia et al., 1995; Collier et al., 2005). Interestingly, our animals demonstrate a precipitous relative weight shift (reduction) at approximately 8.5 years of age that appears related to reduced acute neurotoxic outcomes in this older, relatively lighter component of our cohort (Fig. 4D). Thus, our cohort, with a limited adult age-range relative to other studies, indicates that animal weight (the determinant of MPTP dosing in our study) more specifically relates to acute MPTP-related outcomes than age.

While absolute MPTP dose predicts acute outcomes, severe acute neurotoxicity does not appear related to a lethal dose per se. All animals with severe acute neurotoxicity recovered from anesthesia following intra-carotid administration despite signs of severe neurological injury in the immediate post-procedural recovery period prompting critical clinical decisions regarding overall animal welfare and long-term survivability. All of our animals with severe acute neurotoxicity demonstrated grossly visible destruction and softening isolated to the striatum on the side of MPTP injection immediately following brain extraction. There were no signs of acute infarct or additional regional injury on gross dissection of the brain. These observations are similar to an independent small sample of Macacca mulatta receiving high weight-based MPTP doses, and may represent a similar pathophysiologic process that resulted in MRI findings consistent with acute edema of the neostriatum following intra-carotid MPTP administration (Miletich et al., 1994). Regarding the pathophysiological mechanism for acute decline following MPTP, others have debated potential mechanisms to include MPTP overdose, individual sensitivity, or ischemic insult (Emborg, 2007). Similar to this prior report, we did not measure MPTP or MPP+ brain levels and cannot conclusively establish pathophysiological mechanisms regarding striatal injury. However, we did not observe similar striatal softening in two animals with iatrogenic strokes that were not administered MPTP. Clinical signs and histopathology supported extensive ischemic stroke on the side of instrumentation in these animals that differed from changes observed in animals with severe acute neurotoxicity. Thus, our data support the notion that striatal injury as observed in severe acute neurotoxicity represents a direct toxic effect of MPTP rather than isolated ischemia. Future studies are necessary to determine if the degree of global striatal injury extends upon a spectrum of focal necrotic striatal lesions observed in a small sample of animals with acute recovery following intra-carotid MPTP administration (Emborg, 2007). Our data do not preclude modest histopathological damage to other parts of the brain, but rather reflect investigation of areas with gross injury resulting from acute MPTP toxicity.

Additional intrinsic factors may play a role with regard to the degree of toxic MPP+ exposure, including MAO-B levels. This is of particular interest given known heterogeneity in expression across NHPs and the potential role MAO-B may contribute to MPTP toxicity. In a subpopulation of our cohort, we demonstrated that only two of 43 animals exhibited a polymorphism in the MAO-B genotype. It is unclear if this may have contributed to increased susceptibility in the single animal that developed severe acute neurotoxicity following a relatively high absolute MPTP dose with a homozygous G allele. However, the observation that 4 additional animals without this polymorphism developed similar outcomes goes against MAO-B polymorphisms as the sole determining factor regarding severe acute neurotoxicity. Because MAOB is predominantly located in glial cells, the large increase in MAOB with aging may be attributable to the proliferation of these cells (Youdim et al., 2006). This may independently contribute to higher MPTP toxicity in aged animals (Ovadia et al., 1995; Collier et al., 2005), independent of absolute dose.

We previously reported clinical ratings in animals following acute recovery from unilateral intra-carotid MPTP (Tabbal et al., 2012). Specifically, striatal dopamine depletion appears to be greater than substantia nigra cell body injury. All of our clinical outcome measures are confounded by various experimental manipulations related to MPTP dosing in respective experimental designs. Thus, accurate interpretation of differences in clinical outcome measures across weight-based and absolute dosing is not possible in our current sample. Future studies should consider the relationship of dose-response and relevant biomarkers against risk of severe acute neurotoxicity following administration of higher absolute MPTP doses. This is particularly relevant given that most NHP MPTP experiments rely on MPTP-related neurotoxic effects without rendering experimentation failure due to animal disability or death disproportionate to the desired effect.

In conclusion, absolute MPTP dose predicts severe acute neurotoxicity in Macaca fascicularis, superior to standard weight-based dosing. Thus, use of absolute MPTP dose increases the likelihood of successful experimentation by reducing the risk of undesired outcomes related to inordinate MPTP exposure. Our study is limited by the retrospective nature and clinical measures spanning across experimental interventions that may variably affect clinical outcomes. Regardless, absolute MPTP dose should be considered for intra-carotid application in non-human primates in context of high first pass extraction and relatively stable brain volumes to improve experimental yield and reduce undesired outcomes.

Acknowledgements

This work was supported by NIH NINDS/NIA NS075321, NS103957, NS107281, NS075527, NS058714, NS050425, NS039913, the Barnes Jewish Hospital Foundation (including the Elliot Stein Family Fund and Parkinson Disease Research Fund); the American Parkinson Disease Association (APDA) Advanced Research Center for Parkinson Disease at Washington University in St. Louis; the Greater St. Louis Chapter of the APDA; the Barbara & Sam Murphy Fund; the McDonnell Center for Systems Neuroscience; the Oertli Fund for Parkinson Disease Research, the Paula and Rodger Riney Fund for Parkinson disease research.

The authors would like to thank the following individuals for their contributions to this work: Darryl Craig, Susan Donovan, Chad Faulkner, Emily Flores, John Hood, Axiao Li, Susan Loftin, and Christina Zukas.

Footnotes

CRediT authorship contribution statement

Scott Norris: Investigation, Formal analysis, Writing – original draft. Hannah White: Investigation, Data curation, Formal analysis. Aaron Tanenbaum: Conceptualization, Investigation, Data analysis. Emily Williams: Investigation, Data curation, Project administration. Carlos Cruchaga: Methodology. Resources. LinLin Tian: Investigation, Data curation. Robert Schmidt: Methodology, Resources. Joel Perlmutter: Funding Acquisition, Conceptualization, Supervision, Resources, Investigation. All authors reviewed, edited and agreed to the final version submitted for publication.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Alavijeh MS, Chishty M, Qaiser MZ, Palmer AM, 2005. Drug metabolism and pharmacokinetics, the blood-brain barrier, and central nervous system drug discovery. NeuroRx 2 (4), 554–571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Balciuniene J, Emilsson L, Oreland L, Pettersson U, Jazin E, 2002. Investigation of the functional effect of monoamine oxidase polymorphisms in human brain. Hum. Genet 110 (1), 1–7. [DOI] [PubMed] [Google Scholar]
  3. Bankiewicz KS, Oldfield EH, Chiueh CC, Doppman JL, Jacobowitz DM, Kopin IJ, 1986. Hemiparkinsonism in monkeys after unilateral internal carotid artery infusion of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Life Sci 39 (1), 7–16. [DOI] [PubMed] [Google Scholar]
  4. Brown CA, Karimi MK, Tian L, Flores H, Su Y, Tabbal SD, Loftin SK, Moerlein SM, Perlmutter JS, 2013. Validation of midbrain positron emission tomography measures for nigrostriatal neurons in macaques. Ann. Neurol 74 (4), 602–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Burns RS, Chiueh CC, Markey SP, Ebert MH, Jacobowitz DM, Kopin IJ, 1983. A primate model of parkinsonism: selective destruction of dopaminergic neurons in the pars compacta of the substantia nigra by N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Proc. Natl. Acad. Sci. USA 80 (14), 4546–4550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Collier TJ, Dung Ling Z, Carvey PM, Fletcher-Turner A, Yurek DM, Sladek JR, Kordower JH, 2005. Striatal trophic factor activity in aging monkeys with unilateral MPTP-induced parkinsonism. Exp. Neurol 191 (1), S60–67 (Suppl). [DOI] [PubMed] [Google Scholar]
  7. D’Amato RJ, Lipman ZP, Snyder SH, 1986. Selectivity of the parkinsonian neurotoxin MPTP: toxic metabolite MPP+ binds to neuromelanin. Science 231 (4741), 987–989. [DOI] [PubMed] [Google Scholar]
  8. Davis GC, Williams AC, Markey SP, Ebert MH, Caine ED, Reichert CM, Kopin IJ, 1979. Chronic Parkinsonism secondary to intravenous injection of meperidine analogues. Psychiatry Res 1 (3), 249–254. [DOI] [PubMed] [Google Scholar]
  9. Dugan LL, Tian L, Quick KL, Hardt JI, Karimi M, Brown C, Loftin S, Flores H, Moerlein SM, Polich J, Tabbal SD, Mink JW, Perlmutter JS, 2014. Carboxyfullerene neuroprotection postinjury in Parkinsonian nonhuman primates. Ann. Neurol 76 (3), 393–402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Emborg ME, 2007. Nonhuman primate models of Parkinson’s disease. ILAR J 48 (4), 339–355. [DOI] [PubMed] [Google Scholar]
  11. Fox SH, Brotchie JM, 2010. The MPTP-lesioned non-human primate models of Parkinson’s disease. Past, present, and future. Prog. Brain Res 184, 133–157. [DOI] [PubMed] [Google Scholar]
  12. Fukuda T, Tanaka J, Hasumura M, 1992. [Tyrosine hydroxylase-immunohistochemical study in the midbrain of experimental MPTP parkinsonism]. Rinsho Shinkeigaku 32 (2), 161–165. [PubMed] [Google Scholar]
  13. Herndon JG, Tigges J, Klumpp SA, Anderson DC, 1998. Brain weight does not decrease with age in adult rhesus monkeys. Neurobiol. Aging 19 (3), 267–272. [DOI] [PubMed] [Google Scholar]
  14. Hong KW, Hayasaka I, Murayama Y, Ito S, Inoue-Murayama M, 2008. Comparative analysis of monoamine oxidase intronic polymorphisms in primates. Gene 418 (1–2), 9–14. [DOI] [PubMed] [Google Scholar]
  15. Jones DN, Ruiz CA, Raghanti MA, Tosi AJ, Tanaka H, Goto Y, 2020. Monoamine oxidase polymorphisms in rhesus and Japanese macaques (Macaca mulatta and M. fuscata). J. Chem. Neuroanat 103, 101726. [DOI] [PubMed] [Google Scholar]
  16. Kanazawa M, Ohba H, Nishiyama S, Kakiuchi T, Tsukada H, 2017. Effect of MPTP on serotonergic neuronal systems and mitochondrial complex i activity in the living brain: a PET study on conscious Rhesus monkeys. J. Nucl. Med 58 (7), 1111–1116. [DOI] [PubMed] [Google Scholar]
  17. Karimi M, Tian L, Brown CA, Flores HP, Loftin SK, Videen TO, Moerlein SM, Perlmutter JS, 2013. Validation of nigrostriatal positron emission tomography measures: critical limits. Ann. Neurol 73 (3), 390–396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kupsch A, Sautter J, Götz ME, Breithaupt W, Schwarz J, Youdim MB, Riederer P, Gerlach M, Oertel WH, 2001. Monoamine oxidase-inhibition and MPTP-induced neurotoxicity in the non-human primate: comparison of rasagiline (TVP 1012) with selegiline. J. Neural Transm. (Vienna) 108, 985–1009, 8–9. [DOI] [PubMed] [Google Scholar]
  19. Langston JW, Ballard P, Tetrud JW, Irwin I, 1983. Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science 219 (4587), 979–980. [DOI] [PubMed] [Google Scholar]
  20. Langston JW, Forno LS, Rebert CS, Irwin I, 1984. Selective nigral toxicity after systemic administration of 1-methyl-4-phenyl-1,2,5,6-tetrahydropyrine (MPTP) in the squirrel monkey. Brain Res 292 (2), 390–394. [DOI] [PubMed] [Google Scholar]
  21. Mandikian D, Figueroa I, Oldendorp A, Rafidi H, Ulufatu S, Schweiger MG, Couch JA, Dybdal N, Joseph SB, Prabhu S, Ferl GZ, Boswell CA, 2018. Tissue physiology of Cynomolgus monkeys: cross-species comparison and implications for translational pharmacology. AAPS J 20 (6), 107. [DOI] [PubMed] [Google Scholar]
  22. Miletich RS, Bankiewicz KS, Quarantelli M, Plunkett RJ, Frank J, Kopin IJ, Di Chiro G, 1994. MRI detects acute degeneration of the nigrostriatal dopamine system after MPTP exposure in hemiparkinsonian monkeys. Ann. Neurol 35 (6), 689–697. [DOI] [PubMed] [Google Scholar]
  23. Ovadia A, Zhang Z, Gash DM, 1995. Increased susceptibility to MPTP toxicity in middle-aged rhesus monkeys. Neurobiol. Aging 16 (6), 931–937. [DOI] [PubMed] [Google Scholar]
  24. Pardo ID, Garman RH, Weber K, Bobrowski WF, Hardisty JF, Morton D, 2012. Technical guide for nervous system sampling of the cynomolgus monkey for general toxicity studies. Toxicol. Pathol 40 (4), 624–636. [DOI] [PubMed] [Google Scholar]
  25. Pifl C, Schingnitz G, Hornykiewicz O, 1991. Effect of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine on the regional distribution of brain monoamines in the rhesus monkey. Neuroscience 44 (3), 591–605. [DOI] [PubMed] [Google Scholar]
  26. Sakamoto K, Sawada K, Fukunishi K, Noritaka I, Sakata-Haga H, Yoshihiro F, 2014. Postnatal change in sulcal length asymmetry in cerebrum of cynomolgus monkeys (Macaca fascicularis). Anat. Rec. (Hoboken) 297 (2), 200–207. [DOI] [PubMed] [Google Scholar]
  27. Tabbal SD, Mink JW, Antenor JA, Carl JL, Moerlein SM, Perlmutter JS, 2006. 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine-induced acute transient dystonia in monkeys associated with low striatal dopamine. Neuroscience 141 (3), 1281–1287. [DOI] [PubMed] [Google Scholar]
  28. Tabbal SD, Tian L, Karimi M, Brown CA, Loftin SK, Perlmutter JS, 2012. Low nigrostriatal reserve for motor parkinsonism in nonhuman primates. Exp. Neurol 237 (2), 355–362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tian L, Karimi M, Loftin SK, Brown CA, Xia H, Xu J, Mach RH, Perlmutter JS, 2012. No differential regulation of dopamine transporter (DAT) and vesicular monoamine transporter 2 (VMAT2) binding in a primate model of Parkinson disease. PloS One 7 (2), e31439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Todd RD, Carl J, Harmon S, O’Malley KL, Perlmutter JS, 1996. Dynamic changes in striatal dopamine D2 and D3 receptor protein and mRNA in response to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) denervation in baboons. J. Neurosci 16 (23), 7776–7782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Youdim MB, Edmondson D, Tipton KF, 2006. The therapeutic potential of monoamine oxidase inhibitors. Nat. Rev. Neurosci 7 (4), 295–309. [DOI] [PubMed] [Google Scholar]

RESOURCES