Abstract
Background
Type 2 diabetes mellitus (T2DM) approximately constitutes 90% of the reported cases. 30-40% of diabetics eventually develop diabetic nephropathy (DN); accounting for one of the major causes of morbidity and mortality. Increased glucose autoxidation and non-enzymatic glycation of proteins in diabetic kidneys lead to the excessive generation of reactive oxygen species (ROS) that results in lipid peroxidation and activation of inflammatory mediators which overwhelms the scavenging capacity of the antioxidant defense system (Nrf2/Keap1/HO-1). Centratherum anthelminticum commonly called as kali zeeri (bitter cumin) and its seeds are well known for culinary purposes in Asia (Pakistan). It has reported anti-inflammatory, antioxidant, and anti-diabetic activities. The present study has attempted to explore the in-vivo anti-inflammatory, antioxidant and antihyperglycemic potential of the C. anthelminticum seed’s fixed oil (FO) and its fractions in high fat-high fructose-streptozotocin (HF-HFr-STZ) induced T2DM rat model.
Methods
The T2DM rat model was developed by giving a high-fat and high-fructose diet followed by a single intraperitoneal injection of streptozotocin (STZ 60 mg/kg) on 28th day of the trial. After 72 hours of this injection, rats showing fasting blood glucose (FBG) levels≥230 mg/dL were recruited into six groups. These groups were orally administered distilled water (1 mL/kg), Gliclazide (200 mg/kg), Centratherum anthelminticum seed (FO) and its hexane (HF), chloroform (CF) and ethanol (EF) soluble fractions (200 mg/kg each), respectively for 4 weeks (i.e. 28 days). Blood, serum, and kidney tissue samples of euthanized animals were used for biochemical, pro-inflammatory, and antioxidant markers (ELISA, qRT-PCR, and spectrophotometric assays) and histology, respectively.
Results
C. anthelminticum FO and its fractions reduced the lipid peroxidation, and improved the antioxidant parameters: enzymatic (SOD, CAT, and GPx), non-enzymatic (GSH), and mRNA expression of anti-inflammatory markers (Nrf-2, keap1, and HO-1). mRNA expression of inflammatory and apoptotic markers (TNF-α, IL-1β, COX-1, NF-κB, Bax, and Bcl-2) were attenuated along with improved kidney architecture.
Conclusion
C. anthelminticum can mitigate inflammation and oxidative stress in early DN. The anti-nephropathic effect can be attributed to its ability to down-regulate NF-κB and by bringing the Nrf-2 expression levels to near normal.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12906-022-03776-x.
Keywords: Centratherum anthelminticum, Fixed oil, Diabetes mellitus, Nephropathy, Nrf-2/Keap1/HO-1, NF-κB
Introduction
The prevalence and incidence of diabetes mellitus (DM) are steadily increasing globally. According to the International Diabetes Federation (IDF), the prevalence of this multifactorial metabolic pandemic will increase to 10.2% (578 million) and 10.9% (700 million) by the year 2030 and 2045, respectively [1]. It is exerting a heavy toll on both the individual and society in the form of associated microvascular and macrovascular complications, especially diabetic nephropathy (DN). 30-40% of diabetics eventually develop DN, one of the most common and major causes of morbidity and mortality that eventually causes end-stage renal disease (ESRD) requiring either hemodialysis or renal transplant [2, 3].
Complex and multifactorial pathogenesis of DN is attributed to persistent hyperglycemia due to insufficient secretion or action of endogenous insulin [4]. The imbalance between secretion and action of insulin leads to increased glucose autoxidation, non-enzymatic glycation of proteins, and lipid peroxidation. Damaged biomolecules trigger excess generation of reactive oxygen species (ROS) that overwhelms the scavenging capacity of antioxidant defense systems: Nrf-2/Keap1/HO-1. This reflects not only in the form of cellular damage by hampering the endoplasmic reticulum (ER) and mitochondrial function rather also simultaneously triggering pro-inflammatory nuclear factor-kappa B (NF-κB), apoptotic (Bcl-2 and Bax), and pro-oxidant signaling cascade [5–9]. Hence, these cellular perturbations exert significant abnormalities on renal structure (podocytes, mesangial and tubular cells) which phenotypically presents as increased urinary albumin excretion, decreased glomerular filtration rate (GFR), and increased peripheral arterial blood pressure with subsequent ESRD [10–13]. Currently employed anti-glycemic, anti-hypertensive and management modalities have failed to slow the progression of DN and improve the patient’s survival due to limited efficacy and side effects. This calls for holistic treatment and management approaches more towards natural and medicinal plant-derived products with a focus on both cellular and molecular switches/signaling pathways that are involved in the pathogenesis of DN. The outlook mentioned above has the capacity to address metabolic, oxidative, and inflammatory insults which lie at the crux of pathogenesis; with the additive benefit of being relatively safe, with fewer side effects, and available at low cost. Moreover, several studies support the hypothesis that phyto-molecules with potent antioxidant and anti-inflammatory activities can delay and/or halt the progression of DN [14, 15].
Twenty-six plants for the management of Diabetes mellitus have been identified in folk medicine from Rayalaseema [16]. Centratherum anthelminticum (synonym: Vernonia anthelmintica, plant name corresponds to the latest revision mentioned in www.theplantlist.org and http://mpns.kew.org), an annual, erect, robust herb is one of them. It is commonly known as kalijiri, bitter cumin or Purple Fleabane. Seeds of this herb are most widely used to treat skin conditions, gastrointestinal problems, diabetes, fever, pulmonary fibrosis, and in the removal of worms and parasites, etc. [17]. It is also widely used as an ingredient in polyherbal formulations (PF) from India (Krumighattini, Rasaganthi Mezhugu, Perukala rasayanam and Kayakalp) [18–22], Sri Lanka (Navratri Kalka) [23] and China [24, 25].. It has been used in the traditional system of medicine to treat diabetes [26]. Sabu MC and Bhatia et al. had claimed that oral administration of the aqueous extract (100, 200, and 500 mg/kg, respectively) of seeds for more than 7 days in alloxan-induced diabetic rats significantly decreased (39%) serum glucose levels [27, 28]. However, Bhatia et al. found no significant change in glucose levels at higher doses; and he also found that polyphenolic enriched fraction of seed (50–200 mg/kg) containing quercetin, kaempferol, caffeic acid, gallic acid, proto-catechuic acid, ellagic acid, and ferulic acid exerted antidiabetic effect by inhibiting α-amylases and intestinal α-glucosidases in rat models [29]. Similarly, in 2010 Fatima et al., using streptozotocin-induced diabetic rat models showed significant antidiabetic (decreased levels in plasma glucose, HbA1c, plasma insulin, and hepatic glycogen) and antihyperlipidemic (decreased levels in cholesterol, triglycerides, LDL, VLDL, HDL, free fatty acids, phospholipids, and HMG-CoA reductase) activity of ethanolic extract and bioassay-directed fractions of C. anthelminticum (20 mg/kg) as compared to glibenclamide [30]. Antihyperlipidemic, antiatherogenic and antioxidant activities of ethanolic and crude extract of the seeds were also explored in high-fat diet-induced hyperlipidemic animal models with increasing doses from 200 to 600 mg/kg [31]. Carrageenan, cotton pellet and Freund’s adjuvant-induced paw edema, granuloma and arthritis in rats were the inflammatory models used by Otari et al. group to explore the effect of C. anthelminticum on inflammation [32]. The seed extracts also inhibited increasing levels of nitric oxide and inflammatory markers like IL-1β, IL-6, and TNF-α. Furthermore, the antioxidant potential explored by various groups in different time frames have shown that seeds extracted with methanol and ethanol and leaves extracted with hexane, chloroform, acetone, and methanol have free radical scavenging activity evident by DPPH and FRAP assays [19, 27, 33]. No in-vivo study exists in which the effect of C. anthelminticum on the innate antioxidant defense mechanisms has been explored at molecular level. Similarly, in the literature, only one ethno-medicinal study has been documented in which the oil from the seed of C. anthelminticum has been employed to treat skin disorders [34]. Therefore, the present study has attempted to explore the in-vivo antidiabetic, anti-inflammatory, antioxidant and anti-apoptotic potential of fixed oil (FO) extracted from C. anthelminticum and its hexane (HF), chloroform (CF), and ethanol (EF) in high fat-high-fructose-streptozotocin (HF-HFr-STZ)-induced T2DM rat model. Special attention was given to explore the nephroprotective effect of C. anthelminticum at the molecular/cellular level using a high fat-high-fructose-streptozotocin (HF-HFr-STZ)-induced T2DM rat model. Hence, the aim of the present study was to examine the effect of C. anthelminticum seed oil in mitigating the risk of end-organ complications observed in DM.
Materials and methods
Plant material
Seeds of C. anthelminticum were purchased from Hamdard Dawakhana, Saddar, Karachi. Identification was confirmed by the experts from the Department of Botany, University of Karachi, Karachi-75,270, Pakistan (voucher specimen: KU/BCH/SAQ/02).
Reagents
Chloroform (Cat. no: 102447), glucose (Cat. no: D9434, dextrose), and trichloroacetic acid (TCA, Cat. no: T6399) were obtained from Merck & Co (New Jersey, US). Hexane (Cat. no: 296090, ethanol (Cat. no: V001229), DMSO (Cat. no: 276855), STZ (Cat. no: S0130), ketamine (Cat. no: K1884), xylazine (Cat. no: X1126), gliclazide (Cat. no: G2167), hydrochloric acid (HCl, Cat. no: 320331), hydrogen peroxide (H2O2, Cat. no: H1009), Ellman’s reagent (DTNB, 5,5′-dithiobis nitrobenzoic acid, Cat. no: D8130), glutathione (Cat. no: G4251), sodium azide (Cat. no: 13412), sodium arsenate (Cat. no: A6756), perchloric acid (Cat. no: V001526), hydroxylamine reagent (Cat. no: 159417), dichromate-acetic acid reagent (Cat. no: 223964), epinephrine (Cat. no: E4250), thiobarbituric acid (TBA, Cat. no: T5500) and TRIzol® Reagent (Cat.no: T9424) were procured from Sigma Aldrich Corp (St. Louis, MO, USA).
Extraction and fractionation
The purchased and identified seeds were thoroughly cleaned and weighed. The fixed oil of seeds was extracted using the Cold-press method at low temperature (below 50 °C) [35]. The extracted fixed oil was defatted twice with hexane to obtain hexane soluble fraction and the hexane insoluble residues were fractionated with chloroform to obtain chloroform soluble and insoluble fractions, the insoluble fraction was further fractionated with ethanol. The obtained fractions (hexane, chloroform, and ethanol) were subject to evaporation, and concentration using Büchi Rotavapor R-200 (62-65 °C). The fractions were kept in separate small vials labeled as HF (Hexane fraction), CF (Chloroform faction), and EF (Ethanol fraction) for further use (Fig. 1C).
Fig. 1.
Schematic presentation of A experimental design of the study, B animal groups, and C cold press extraction of C. anthelminticum seed fixed oil (FO) followed by preparation of hexane (HF), chloroform (CF), and ethanol (CF) fractions of FO
Acute toxicity study
An acute toxicity study of C. anthelminticum’s FO and its fractions were performed on Wistar Albino rats of both sexes, aged 6-10 weeks after they were fasted for 14-16 hours. The study was conducted in compliance with the Organization of Economic Co-Operation and Development (OECD) guideline 420 for testing of chemicals [36]. The FO of C. anthelminticum and its fractions were dissolved in 0.05% dimethyl sulfoxide (DMSO) and orally administered once at a dose of 500, 1000, 1500, and 2000 mg/kg, to their respective to groups rats (n = 6; 3 males, 3 females); whereas the control group only received 0.05% DMSO (1 mL/kg) as a vehicle. The animals were allowed free access to water and food, they were followed for 24 hours with strict observation in the initial 6 hours and daily thereafter for 2 weeks for signs of acute toxicity. Once daily for 14 days, the animals were observed for changes in physical appearance, behavior, mortality, (i.e. salivation, lethargy, etc.), and acute illness/injury. On the 15th day, animals were euthanized through intraperitoneal injections of Ketamine 60 mg/kg and Xylazine 7 mg/kg body weight [37]. The cardiac puncture was performed on euthanized animals to collect blood in EDTA-containing (plasma) and non-heparinized (serum) vacutainer tubes for hematological (CBC, HbA1c) and biochemical (Urea, creatinine, and LFT) analysis, respectively.
Oral glucose tolerance test (OGTT)
The experimental rats were divided into 7 groups each having 3 males and 3 females and they were fasted for 12 hours (for food). The animals were divided into control (glucose 2 g/kg), negative (glucose 2 g/kg + DMSO1mL/kg), and positive control (glucose 2 g/kg + standard drug: Gliclazide 200 mg/kg), and treatment groups divided on the basis of doses of FO and its fractions mentioned below).
Five doses (50, 100, 200,400, and 600 mg/kg) of each of C.anthelminticum FO and its fraction (HF, CF, and EF) were orally administered to their respective groups followed by a glucose load of 2 g/kg. Blood from the tail veins of rats was used to evaluate glucose levels at various time intervals (0, 30, 60, and 120 minutes) using a glucometer (ACCU-CHEK Roche, Switzerland) [38]. Upon completion of the OGTT study percent glycemic change between the control and test, groups were calculated [39].
Animals
Male Albino Wistar rats (n = 65, body weight = 180-280 ± 20 g) were procured from DUHS (Dow University of Health Sciences, Karachi). Polycarbonate cages were used to house the rats individually; they were acclimated to 12 hours of light and dark cycle for a week at a 22 ± 3 °C temperature and 50 ± 10% humidity. During the acclimatization period and before dietary intervention rats had free access to sterilized water and a standard rat diet. The Ethical Review Board for Animal Research and Ethics, Dow University of Health Sciences approved the study (AR.IRB-21/DUHS/Approval/2021/037).
Induction of diabetes in male Wistar rats
Male Wistar rats (10-12 weeks old; body weight 180-230 g) were separated into 6 treatment groups (n = 10 each) and a control group (n = 5). According to the groupings, the rats in the control group were fed with a normal diet whereas the ones in the other six treatment groups were fed a high-fat high-fructose (HF-HFr) diet for 28 days (i.e. 4 weeks). The HF-HFr diet used in this study mentioned in (Table 1) was the modification of protocol described by Yoo S et.al [40]. At the end of the 28th day, a single dose of STZ (60 mg/kg) in a citrate buffer (0.1 M, pH 4.5) was injected intraperitoneally into the 12-hour fasted rats in the treatment groups to develop T2DM. On the third day (i.e.72 hours) after STZ injection, FBG levels were measured from the tail vein of each rat using a glucometer, and rats having (FBG) levels of 230 mg/dL and above were considered as diabetic and randomly divided into 6 treatment groups (Fig. 1A).
Table 1.
Composition and ingredients of experimental diet. RD: rats received a regular diet and 30 Frc + 45 Fat: rats received a 45 kcal% fat with a 30% fructose diet
% | RD | 30 Frc | 45 Fat | 30 Frc + 45 Fat | ||||
---|---|---|---|---|---|---|---|---|
g | kcal | g | kcal | g | kcal | g | kcal | |
Protein | 20 | 20 | 20 | 20 | 24 | 20 | 24 | 20 |
Carbohydrate | 64 | 64 | 64 | 64 | 41 | 35 | 41 | 35 |
Fat | 7 | 16 | 7 | 16 | 24 | 45 | 24 | 45 |
Total | 100 | 100 | 100 | 100 | ||||
kcal/gm | 4 | 4 | 4.8 | 4.8 | ||||
Ingredient | g | kcal | g | kcal | g | kcal | g | kcal |
Casein, 80 Mesh | 200 | 800 | 200 | 800 | 200 | 800 | 200 | 800 |
Soybean Oil | 70 | 630 | 70 | 630 | 26 | 234 | 26 | 234 |
L-Cystine | 3 | 12 | 3 | 12 | 3 | 12 | 0 | 0 |
Lard | 0 | 0 | 0 | 0 | 174 | 1566 | 174 | 1566 |
Corn Starch | 397.5 | 1590 | 229.5 | 918 | 137 | 548 | 0 | 0 |
Mineral Mix | 35 | 0 | 35 | 0 | 35 | 0 | 0 | 0 |
Maltodextrin 10 | 132 | 528 | 100 | 400 | 100 | 400 | 37 | 148 |
t-Butylhydroquinone | 0.014 | 0 | 0.014 | 0 | 0.014 | 0 | 0 | 0 |
Sucrose | 100 | 400 | 0 | 0 | 100 | 400 | 0 | 0 |
Cellulose | 50 | 0 | 50 | 0 | 50 | 0 | 50 | 0 |
Fructose | 0 | 0 | 300 | 1200 | 0 | 0 | 300 | 1200 |
Choline Bitartrate | 2.5 | 0 | 2.5 | 0 | 2.5 | 0 | 0 | 0 |
Vitamin Mix | 10 | 40 | 10 | 40 | 10 | 40 | 10 | 40 |
Total | 1000 | 4000 | 1000 | 4000 | 837.5 | 4000 | 797 | 3988 |
Experimental design
Sixty-five male Wistar rats were divided into seven groups: 10 animals in each group, except the normal control group (5 animals). The C. anthelminticum FO and its fractions were administered orally at a dose of 200 mg/kg to treatment groups from day 31-63 (i.e. 4 weeks). The dosage for C. anthelminticum oil was calculated on the basis of the acute toxicity study and oral glucose tolerance test results. The treatment was given daily for 4 weeks. During the study, body weight and FBG were measured weekly using a weighing machine and ACCU-CHEK glucometer, respectively.
Group 1(NC) - Normal control rats; normal diet and treated with distilled water (1 mL/kg).
Group 2 (DM Control) - Diabetic control rats; rats were fed HF-HFr diet and were administered 60 mg/kg of STZ and orally administered 0.01% DMSO (1 mL/kg).
Group 3 (DM Glic); Diabetic rats (fed HF-HFr diet and administered 60 mg/kg of STZ) were treated with the reference drug; Gliclazide (200 mg/kg).
Group 4 (FO); rats with DM (fed HF-HFr diet and administered 60 mg/kg of STZ) were treated with FO (200 mg/kg) of C. anthelminticum seeds.
Group 5 (HF); rats with DM (fed HF-HFr diet and administered 60 mg/kg of STZ) were treated with HF (200 mg/kg) of C. anthelminticum seed oil.
Group 6 (CF); rats with DM (fed HF-HFr diet and administered 60 mg/kg of STZ) were treated with CF (200 mg/kg) of C. anthelminticum seed oil.
Group 7 (EF); rats with DM (fed HF-HFr diet and administered 60 mg/kg of STZ) were treated with EF (200 mg/kg) of C. anthelminticum seed oil.
Biochemical analysis
On the 63rd day, the animals were sacrificed by intraperitoneal injection of Xylazine 7 mg/kg and Ketamine 60 mg/kg [37]. The blood samples were collected by cardiac puncture and centrifuged at 2000 x g for 15 minutes to separate serum for biochemical analysis. Serum insulin concentrations were determined according to the manufacturer’s instructions using a rat enzyme-linked immunoassay (ELISA) test kit (Bioassay Technology Laboratory Insulin ELISA kit Catalog no e0707RA). Glycated hemoglobin (HbA1c) and renal function assessment biomarkers such as serum creatinine and urea (mg/dL) were evaluated using commercially available spectrophotometric assay kits (Atellica Solutions, Siemens Healthcare). Homeostatic Model Assessment of Insulin Resistance (HOMA-IR), pancreatic β-cell function (HOMA β) and insulin sensitivity were calculated using the formulae: HOMA-IR = fasting insulin (μU/mL) × fasting glucose (mmol/L)/22.5 [41], HOMA β-cell (20 x insulin U/L/blood glucose - 3.5) and Insulin sensitivity = 1/log (fasting insulin U/L) x log (Fasting glucose mg/dl), respectively [41, 42]. The kidney tissues were excised, washed with ice-cold saline, and preserved in formalin 10% and phosphate buffer saline (PBS) for histopathological and PCR analysis, respectively.
Histopathology of renal tissues
After animals were sacrificed, the collected renal tissue was harvested, sectioned longitudinally, and fixed with 10% neutral buffer formalin for 48 hours. Followed by dehydration with gradient alcohol and transparentize with xylene, waxed, embedded, and sectioned. The 3 to 4 μm thick sections were Hematoxylin-Eosin (H&E) stained for general morphological analysis. The pathological changes in the kidney were observed under a compound microscope [43].
Homogenate preparation of renal tissue
All the tissues excised from both the control and experimental rats were placed in PBS and kept at − 80 °C. For homogenization, a 100 mM phosphate buffer with neutral pH was used. After complete tissue homogenization, the clear solution was centrifuged at 10,000×g for 15 minutes in order to remove any debris. The collected supernatant was used for further experimentation.
Determination of renal lipid peroxidation (LPO)
The reagent TBA:HCl:TCA (15%:0.2 N:0.37%) was mixed with the kidney homogenate with a ratio of 1:1:1 (v/v). The mixture was then heated in boiling water for 15 minutes and was brought to room temperature for centrifugation at 5000 x g for 5 minutes. The absorbance was taken at 553 nm along with blank and the percent inhibition was calculated [44].
Determination of renal superoxide dismutase (SOD) activity
The enzymatic activity of the superoxide dismutase (SOD) was determined by Misra and Fridovich, 1972 [45]. The prepared homogenate was mixed with 0.3 mM of freshly prepared epinephrine and 0.05 M carbonate buffer (pH 10.2). The absorbance was calculated at 480 nm every 30s for 150 s. The 50% inhibition of the rate of autoxidation of epinephrine measured as a change in absorbance /min was employed in calculating one unit of enzyme activity.
Determination of renal catalase (CAT) activity
The catalase activity in the supernatant of kidney homogenate was assayed spectrophotometrically at 620 nm as described by Sinha [46]. The reaction mixture (1.5 mL) consisted of 0.1 mL of supernatant of kidney tissue homogenate, 0.4 mL of 2 M H2O2, and 1.0 mL of 0.01 M pH 7.0 phosphate buffer. The 2 mL of dichromate-acetic acid reagent (5% potassium dichromate and glacial acetic acid were mixed in a 1:3 ratio) was added to the solution to stop the reaction and the absorbance was measured.
Determination of renal HMG-CoA reductase activity
The activity of HMG-CoA reductase was determined in terms of the HMG-CoA/mevalonate ratio in kidney homogenate. The kidney homogenate was prepared in sodium arsenate solution. The homogenate was taken with an equal volume of dilute perchloric acid (PCA) mixed and incubated for 5 minutes at room temperature followed by a centrifuge at 3000 rpm for 10 minutes. 1.0 mL of kidney supernatant was collected in each of the two test tubes and allowed to react with 1.5 mL of ferric chloride and 0.5 mL of 2 M hydroxylamine reagent (alkaline pH = 5.5 in case of HMG-CoA and acidic pH = 2.1 in case of mevalonate) and incubated for 10 min. Absorbance was determined at 540 nm followed by a calculation of the HMG-CoA/mevalonate ratio [47].
Determination of renal reduced glutathione (GSH) level and glutathione peroxidase (GPx) activity
The GSH levels in the kidney homogenate was determined by using the procedure of Ellman (1959). Kidney homogenate (1.0 mL) was mixed with 0.1 mL of 25% TCA and the precipitate was removed by centrifuge at 5000 x g for 10 min. 0.1 mL of supernatant was removed and added to 2 mL of 0.6 mM DTNB (5,5′-dithiobis nitrobenzoic acid) prepared in 0.2 M sodium phosphate buffer (pH 8.0). The absorbance was read at 412 nm [48].
GPx activity was measured by the method described by Rotruck et al, 1973. The reaction mixture contained 0.2 mL of 0.4 M Tris-HCl buffer pH 7.0, 0.1 mL of 10 mM sodium azide, 0.2 mL of tissue homogenate (homogenized in 0.4 M, Tris-HCl buffer, pH 7.0), 0.2 mL glutathione, and 0.1 mL of 0.2 mM hydrogen peroxide. The contents of the mixture were incubated at 37 °C for 10 min. The reaction was arrested by 0.4 mL of 10% TCA and centrifuged. The supernatant was assayed for glutathione content by using Ellman’s reagent (19.8 mg of 5,5′-dithiobis nitrobenzoic acid (DTNB) in 100 mL of 0.1% sodium nitrate) [49].
Determination of levels of NF-κB p65 DNA binding activity
The ELISA of transcription factor NF-κB was carried out on the renal tissues homogenates as per manufacturer instruction (USCN Catalog no. SEB824Ra). The optical density of protein-bound NF-κB was measured at 450 nm.
Reverse transcription quantitative real-time PCR (RT-qPCR) analysis
The kidneys of dissected animals were stored in PBS solution at − 80°C to preserve the RNA integrity. Total RNA was extracted using the TRIzol® Reagent. The integrity of the RNA was checked on 1% agarose gel electrophoresis. The quantitation of RNA was done with a nanodrop. Afterward, the complementary DNA (cDNA) was synthesized using a Thermo Scientific RevertAid First Strand cDNA Synthesis Kit (Catalog no. K1691 Thermofisher Scientific, USA). The PCR cDNA with eight different sets of primers was carried out using SYBR™ Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and was performed in StepOnePlus Real-time PCR system. Table 2 contains the primer sets used in RT-qPCR. The gene HPRT-1 was used as a reference gene to measure the relative expression of the mRNA in a sample. The amplification PCR program included 1 cycle of 94 °C for 10 min, followed by 35 cycles of 94 °C for 1 min, 60 °C for 40 sec, and 72 °C for 30 sec, and a final elongation cycle at 72 °C for 5 min using an Applied Biosystems, Foster City, CA, USA. Each sample was run in duplicates in order to ensure the reproducibility of the reaction [32].
Table 2.
Forward and reverse primers (5′ → 3′) for reverse transcriptase-real time PCR (RT-qPCR)
Sr.no | Gene name | Forward primer | Reverse primer |
---|---|---|---|
1 | IL-1β | CAGCTTTCGACAGTGAGGAGA | GTCGAGATGCTGCTGTGAGA |
2 | Nrf-2 | GCAAGAGACTTCCAGCCAGT | TGCCATTGCACAACTCTTTTC |
3 | TNF-α | TTCTCATTCCTGCTCGTGGC | CTCCGCTTGGTGGTTTGCTAC |
4 | HO-1 | CAGAACCCAGTCTATGCCCC | TGTGTGGCTGGTGTTAAGGG |
5 | Keap1 | CTGTGACACTTCTCCTGGGG | GAGAAGCAGGAACCAGGCAT |
6 | HPRT1 | AGTCCCAGCGTCGTGATTAGT | CCAGCAGGTCAGCAAAGAAC |
7 | Bax | CACGTCTGCGGGGAGTCA | CTCGATCCTGGATGAAACCCT |
8 | Bcl2 | CTTTGAGTTCGGTGGGGTCA | AGTTCCACAAAGGCATCCCAG |
9 | COX-1 | AACCGTGTGTGTGACTTGCT | TTGCGATACTGGAACTGGGC |
Statistical analysis
The results are expressed as the mean ± standard error mean (S.E.M). Statistical analysis was carried out using the One-way ANOVA followed by least significant difference (LSD) multiple comparisons post-hoc test. A value of p < 0.05 was considered statistically significant. IBM SPSS v. 26 software (Chicago, IL, USA) was used for statistical analysis.
Results
Acute toxicity of C. anthelminticum fixed oil and its fractions
No toxicity and mortality due to C. anthelminticum fixed oil and its hexane, chloroform, and ethanol fractions were observed within 24-48 hours and for 15 days thereafter. All the administered doses were found to be safe up to 2000 mg/kg (Supplementary File 1).
Effect on Oral glucose tolerance test
In OGTT, 200 mg/kg of C. anthelminticum fixed oil and its fractions produced hypoglycemic state in rats challenged with a glucose load of 2 g/kg. The maximum reduction in blood glucose was observed between 30 to 60 minutes whereas between 60 to 120 minutes glucose levels were maintained within euglycemic levels as compared to the standard anti-diabetic drug (Gliclazide). A reduction in the concentration of blood glucose was found in all doses of C. anthelminticum fixed oil and its fractions from 50 to 600 mg/kg (p < 0.05) after 120 min (Supplementary File 2). Based on the present acute toxicity study (Fig. 2A), OGTT and previous studies of C.anthelminticum seed extract in rabbits, rats, and humans, 200 mg/kg was selected as a final dose of intervention [39, 50–53].
Fig. 2.
A Oral glucose tolerance test of C. anthelminticum seed FO and its fractions was carried out at doses of 50, 100, 200, 400 and 600 mg/kg followed by glucose load 2 g/kg and was compared with control (glucose 2 g/kg), Glic positive control (gliclazide 200 mg/kg + glucose 2 g/kg) and DMSO negative control (0.05% DMSO 1 mL/kg + glucose 2 g/kg). B The effects of C. anthelminticum FO and its fractions on HbA1c, kidney weight, serum urea, and creatinine in HF-HFr-STZ induced diabetic rats. The data are expressed as the mean ± S.E.M. Statistical analysis was carried out using the One-way ANOVA followed by LSD multiple comparisons post-hoc test. *p < 0.05 versus Normal; #p < 0.05 versus DM Control
Effect on fasting blood glucose, serum insulin, HOMA-IR, HOMA-β, and insulin sensitivity (IS)
Table 3 shows the level of FBG and serum insulin in rats from normal, diabetic, and treatment groups. Both insulin resistance and elevated blood glucose level are the initial indicators of HF-HFr diet-induced T2DM followed by administration of a single dose of STZ (60 mg/kg). The level of blood glucose significantly increased in the diabetic control group compared to the normal control (p < 0.05); whereas the serum insulin in diabetic rats as compared to control rats decreased (p < 0.05). Significant improvement in insulin levels and reduction in blood glucose was recorded in all the four diabetic treatment groups (FO, HF, CF, and EF) when compared to the diabetic control groups. Furthermore, the results shown in Table 3 signify that the HOMA-IR index was significantly (p < 0.05) higher in the DM-C group when compared to the normal, treatment control and C. anthelminticum treated groups. Similarly, significant (p < 0.05) differences were observed between diabetic control and the C. anthelminticum seed fixed oil group. In the diabetic control group, the β cell functioning index and insulin sensitivity (IS) were significantly compromised when compared to the normal group and the treated groups.
Table 3.
Quantification of FBG, serum insulin, insulin sensitivity, resistance, and beta-cell function in T2DM rats treated with FO and its HF, CF, and EF (200 mg/kg) for 28 days
Groups | FBS (mg/dL) | Serum Insulin (mIU/L) | HOMA-IR | HOMA-B | Insulin sensitivity |
---|---|---|---|---|---|
Control | 83.1 ± 13* | 9.24 ± 0.17* | 1.59 ± 0.12 | 44.1 ± 3.45 | 1.76 ± 1.0 |
DM Control | 270.6 ± 33 | 7.46 ± 0.06 | 4.8 ± 0.20 | 6.82 ± 0.42 | 0.98 ± 0.02 |
DM Glic | 146.7 ± 98* | 11.6 ± 0.48 | 2.43 ± 0.78* | 48.5 ± 18.35* | 1.44 ± 0.28* |
HF | 97.25 ± 29* | 11.85 ± 1.61 | 3.8 ± 2.77 | 40.2 ± 25.31* | 1.27 ± 0.39 |
EF | 105.2 ± 37* | 11.12 ± 0.96 | 5.36 ± 2.09 | 19.7 ± 11.5 | 0.96 ± 0.15 |
CF | 182.8 ± 62* | 11.15 ± 1.62 | 3.03 ± 1.06 | 37.1 ± 17.8* | 1.27 ± 0.23 |
FO | 82.3 ± 17* | 10.8 ± 0.37* | 1.82 ± 0.07* | 53.4 ± 1.22* | 1.67 ± 0.05* |
* shows the significant difference of p-value < 0.05 as compared to DM control
Effect on hemoglobin A1c level
The level of HbA1c level had increased in STZ-induced diabetic control rats whereas C. anthelminticum seed FO, CF, and HF treated groups (200 mg/kg b.w) exhibited a significant (p < 0.05) decline in glycated hemoglobin as compared to EF group in which there is no significant decrease found (Fig. 2B).
Effect on biochemical parameters and kidney weight
In this study, the renal function parameters including serum creatinine and urea were measured using commercial assay kits. Data shows higher levels of urea in diabetic control rats and rats treated with chloroform fraction of seed oil than those in normal and other treatment groups (i.e. FO, HF, and EF) whereas; no significant change was observed in creatinine levels in either diabetic or treatment groups. However, the diabetic control group exhibited a decrease in kidney weight as compared to the normal. On the other hand treatment with C. anthelminticum FO and its fraction reinstated the kidney mass to near normal (Fig. 2B).
Effect of C. anthelminticum fixed oil and its fraction on renal histology
Morphological changes in renal tissue of normal control rats determined using H&E staining revealed normal renal cortex and parenchyma with normal glomeruli and renal tubules (Fig. 3). The photomicrographs of kidneys from the HF-HFr-STZ-induced diabetic rats demonstrated interstitial hemorrhage, degenerative changes, and focal inflammatory cell infiltration, whereas 4 weeks of treatment with C. anthelminticum FO and its fractions at a dose of 200 mg/kg improved the architecture of renal tissue.
Fig. 3.
Histopathological changes in HF-HFr-STZ induced diabetic rat kidneys treated with C. anthelminticum fixed oil and its fractions. The figure shows a photomicrograph of (A) Normal control (NC) kidney showing normal architecture, (B) Diabetic control (DM-C) showing congestion of blood with signs of inflammation, and (C) Treatment control (DM Glic) reveals attenuation in inflammation as compared to DM-C; and (D, E, F, and G) are the photomicrograph of C. anthelminticum fixed oil and HF, CF, and EF-treated kidney, respectively. Degeneration and inflammation observed in DM-C have subsided upon treatment with C. anthelminticum seed oil and its fractions. Renal cell architecture is near normal
C. anthelminticum fixed oil and its fractions mitigate diabetes-induced renal oxidative stress
The biological activities of SOD, CAT, GPx, and GSH levels in the kidney of HF-HFr-STZ diabetic rats decreased significantly (p < 0.05) by showing increased percent inhibition of.
these enzymes when compared to control rats (Fig. 4). Oral administration of 200 mg/kg of C. anthelminticum fixed oil and its fractions (i.e. HF, CF, and EF) raised the activities of these enzymes (SOD, CAT, GPx) and GSH significantly (p < 0.05) in their respective groups by displaying their less percent inhibition when compared with the diabetic control group (Fig. 4).
Fig. 4.
Administration of C. anthelminticum FO and its fractions alleviate oxidative stress in DN. The percent inhibition of SOD, reduced GSH, GPx, CAT, and HMG-COA: Melvonate ratio except LPO in kidney tissue extracts of different groups. The results are expressed as the mean ± S.E.M. Statistical analysis was carried out using the One-way ANOVA followed by LSD multiple comparisons post-hoc test. Abbreviations: DM-C: DM + 1 mL/kg distilled water, DM-Glic: DM + 200 mg/kg Glicalized, FO: DM + 200 mg/kg C. anthelminticum fixed oil, HF: DM + 200 mg/kg hexane fraction, CF: DM-control + 200 mg/kg chloroform fraction and EF: DM + 200 mg/kg ethanol fraction. *p < 0.05 versus Normal; #p < 0.05 versus DM Control
Effect of C. anthelminticum fixed oil and its fractions on LPO and HMG-CoA reductase/mevalonate ratio
The level of malondialdehyde (MDA) which is the end product of LPO was significantly decreased in kidney tissue homogenate of the diabetic control group as compared to the normal control (Fig. 4). After 4 weeks of C. anthelminticum fixed oil and its fractions treatment; the MDA level in the treatment groups increased, and a significant difference was observed between the DM control group vs. treatment groups (p < 0.05). The HMG-CoA/Mevalonate ratio improved in FO, EF, and CF groups as compared to DM-control (p < 0.05) (Fig. 4).
C. anthelminticum fixed oil and its fractions ameliorate diabetes-induced renal inflammation
In order to analyze the anti-inflammatory potential of C. anthelminticum fixed oil and its fractions, a pro-inflammatory NF-κB mediated pathway was explored. The relative mRNA expression of inflammatory markers IL-1β, TNF-α, and COX-1 were assessed by reverse transcriptase real-time PCR whereas; NF-κB p65 protein was measured using ELISA. The expression and protein levels of pro-inflammatory markers: IL-1β, TNF-α COX-1, and NF-κB p65, respectively were significantly increased in diabetic rats. Diabetic rats treated with Gliclazide, C. anthelminticum seed FO, and its fractions (i.e. HF, CF, and EF) showed significant reduction (p < 0.05) in the expression of IL-1β whereas; the levels of TNF-α decreased but not significantly. Similarly, COX-1 showed a reduction (p < 0.05) compared to diabetic control. The level of pro-inflammatory transcription factor NF-κB p65 improved with treatment (p < 0.05) as shown in Fig. 5.
Fig. 5.
RT-qPCR showing cytosolic expression of (A) Nrf-2/Keap1/HO-1-mediated antioxidant pathway, (B) inflammatory (IL-β and TNF-α) and NF-κB (ELISA) pathway, and (C) apoptotic (Bcl-2 and Bax) pathway in the kidney homogenate from diabetic kidney treated with C. anthelminticum fixed oil and its fractions. The values are expressed as the mean ± S.E.M. Statistical analysis was carried out using the One-way ANOVA followed by LSD multiple comparisons post hoc test, *p < 0.05 versus Normal Control (NC); #p < 0.05 versus DM Control. Abbreviations: DM-C: DM + 1 mL/kg distilled water, DM-Glic: DM + 200 mg/kg Glicalized, FO: DM + 200 mg/kg C. anthelminticum fixed oil, HF: DM + 200 mg/kg hexane fraction, CF: DM + 200 mg/kg chloroform fraction and EF: DM + 200 mg/kg ethanol fraction
C. anthelminticum fixed oil and its fractions prevent renal apoptosis
The mRNA expression level of pro-apoptotic Bax and anti-apoptotic Bcl-2 markers are illustrated in Fig. 5. The expression levels of Bax were elevated, whereas; Bcl-2 mRNA levels were found to be reduced in diabetic control rats when compared to normal rats. Following treatment, the levels of Bax were significantly down-regulated in treatment control (Gliclazide) as compared to all the treatment groups (p < 0.05). Compared to diabetic control, Bcl-2 expression levels were up-regulated in treatment groups (Fig. 5C).
Antioxidant role of C. anthelminticum fixed oil and its fractions in protecting renal tissue through Nrf-2/Keap1/HO-1 pathway
Oxidative stress along with inflammation lies at the crux of DN pathogenesis. Nrf-2/keap1/HO-1 being a major defense mechanism against oxidative insult was evaluated to understand its role in the progression and development of DN. Expression levels of Nrf-2, keap1, and HO-1 were measured in all the study groups. The levels of all the three antioxidant markers were significantly elevated (p < 0.05) in the diabetic control group in comparison to the normal control (Fig. 5). C. anthelminticum FO and its fraction (i.e HF, CF, and EF) administered to treatment groups showed a decrease in the expression of Nrf2, Keap1, and HO-1 as compared to the diabetic group (p < 0.05). The most significant decrease was observed in EF and CF (p < 0.05). The expression level of antioxidant markers in the treatment groups were near to normal as observed in the normal control group (Fig. 5A).
Discussion
Prolonged redox imbalances manifesting both as chronic oxidative and inflammatory stress in DM delineate the role of the same in the pathophysiology and progression of its most debilitating complication; diabetic nephropathy [54, 55]. Most cited literature highlights its pathophysiology in the context of chronicity but how the kidney tries to compensate in the early stage and what the consequences of early intervention with strategies other than the existing conventional one are inadequate. C. anthelminticum seed’s known antihyperglycemic, anti-inflammatory, and antioxidant activities are likely to have the potential to help in the prevention and progression of T2DM [56, 57].
Innately at cellular and molecular levels, antioxidant/anti-stress systems exist to try to mitigate the oxidative and inflammatory responses. The key player of this system is nuclear factor erythroid 2-related factor 2 (Nrf-2); a transcription factor that forms a complex with its substrate adaptor Kelch-like ECH-associated protein 1 (Keap1) with Cullin (Cul3)-containing E3 ubiquitin ligase and is found in the cytoplasm [58–60]. Under basal conditions, Nrf-2 is sequestered by Keap1 and degraded by E3 ubiquitin ligase [61]. In the face of xenobiotic, oxidative, electrophile, and metabolic stress Nrf-2 escapes from the Keap/Cul3-Rbx1 ubiquitination in a dose-dependent manner and the free (or newly) synthesized Nrf-2 translocates into the nucleus [61, 62]. Inside the nucleus, Nrf-2 heterodimerizes with one of the small Maf (musculoaponeurotic fibrosarcoma oncogene homolog) protein to recognize the enhancer sequence called antioxidant response element (ARE) present in its regulatory region [63]. It has been cited in the literature that Nrf-2 is involved in the expression of nearly 500 genes involved in redox homeostasis, detoxification, anti-stress/anti-oxidation, and indirectly/directly anti-inflammation activities [64, 65].
In the context of scientific evidence and findings from the experimental animal models of DN, it is observed that Nrf-2 adapts to changing oxidative and inflammatory stress by trying to not only remain functional rather, also increase its expression levels. This adaptation is to overcome the glucolipotoxicity insult faced in the initial stages [66]. Jiang et al. has cited the similar findings [58]; they have also proposed that up-regulation and activation of Nrf-2 during the early stages of kidney insult is an attempt of innately existing antioxidant/anti-stress mechanisms to prevent the progression of DN. However, in the face of persistent glycemic, oxidative, and inflammatory insults, the protective mechanisms become saturated with excessive ROS, and the kidney insult progresses to advanced stages of ESRD [58]. It means the high and low expression levels of Nrf-2 parallel the early and advanced stages of DN. Furthermore, a redox-regulated transcription factor NF-κB, after its translocation inside the nucleus increases the expression of pro-inflammatory cytokines: TNF-α, IL-6, IL-1β, COX-1, and COX-2. Rather, in the light of the emerging evidences it has been shown to facilitate Nrf-2 activity with the help of a small Ras-related C3 botulinum toxin substrate 1 (Rac1) protein with GTPase activity [67]. Rac1 not only mediates activation and nuclear translocation of Nrf-2 in keap1 independent manner rather, also up-regulates HO-1 expression (regulated by Nrf-2) and suppresses activation of the NF-κB pathway. Up-regulation of HO-1 mediated by Nrf-2 and indirectly by Rac1, in turn, suppresses inflammatory activity mediated via NF-κB [68]. These cited findings suggest that Nrf-2 is a putative antioxidant target that could either prevent or slow the progression of DN. Therefore, a number of novel therapeutic molecules are undergoing clinical trials. Recently, bardoxolone methyl showed promising Nrf-2 stimulating activity however, the trial could not continue due to adverse cardiovascular events [69].
C. anthelminticum seeds fixed oil antioxidant activity in the context of Nrf-2 has not been explored. We, therefore, proposed to evaluate the anti-inflammatory, antihyperglycemic, anti-apoptotic, and antioxidant role of seed’s fixed oil and its fractions in the diabetic kidneys via modulation of Nrf-2. HF-HFr-STZ-induced hyperglycemia leads to the suppression of antioxidant activities of SOD, CAT, GPx, and GSH by showing high percent inhibition of these enzymes. The HMG-CoA:Mevalonate ratio was also found decreased in the same group (DM-C) as HF-HFr-STZ-induced hyperglycemia accelerates cholesterol biosynthesis as compared to other treated groups (EF, CF & FO). However, interestingly high percent inhibition of LPO was found in the DM-C group. In our study LPO for some reason did not occur which would normally be accepted to occur in diabetes-induced oxidative stress. The exhaustive activity of antioxidant enzymes (proteins) in tissue reflects the oxidative toll taken by the tissue which in turn is reflected upon the mRNA levels of transcriptional factor Nrf-2 and its downstream master regulator of antioxidant mechanisms: HO-1(Fig. 5A). Therefore, it can be speculated that if the expression levels of SOD and GPx are measured they might also be increased as they are controlled by Nrf2 and are involved in ROS catabolism [70, 71]. Similarly, the increasing level of NF-κB reflects inflammatory stress which is seen as increased levels of IL-1β, TNF-α, and COX-1 whereas; decreasing Bcl-2 and increasing Bax show apoptotic activity (Fig. 5B and C, p < 0.05). C. anthelminticum fixed oil reversed these deleterious effects and improved blood glucose which could be attributed to improved beta-cell function and insulin sensitivity without a decrease in serum insulin levels [39, 51, 52, 57, 72] (Table 3). The C. anthelminticum fixed oil and its fractions treatment also dampen the inflammatory damage and preserve the kidney structural damage observed at the tissue level (Figs. 5B and 3). These improvements could also be attributed due to its antioxidant potential. However, hyperglycemia, oxidative and inflammatory stress in our model increased the mRNA levels of Nrf-2, Keap1, and HO-1 (Fig. 5A); the increased Nrf-2 might be due to increased de novo synthesis (Fig. 6).
Fig. 6.
The schematic diagram is summarizing the actions of the intervention of C. anthelminticum seed oil on Nrf-2/HO-1 and NF-ĸB pathways. Upon exposure to oxidative, inflammatory, and glycemic stress expression levels of Nrf-2 increase and it translocates into the nucleus where it binds ARE to activate the expression of the HO-1 (antioxidant) gene (red arrow). Similarly, NF-ĸB is also translocated from the cytosol to the nucleus, where it activates the transcription of genes that include TNF-α, and IL-1β (red arrow). Following treatment with C. anthelminticum seed oil and its fractions, NF-ĸB activation is downregulated and it is reflected in the decrease in expression levels of Nrf-2/HO-1 to near normal (green arrow). Nrf-2-driven transcription of HO-1 is normalized which attempts to mitigate oxidative stress (green arrow). The perturbations of both NF-ĸB and Nrf-2/HO-1 signaling points to putative cross-talk occurring between the two. However, the mechanism of this process in kidney disease remains unknown
Dissecting the complex transcriptional activation and cellular expression of the Nrf-2 gene has delineated that its promoter region, NFE2L2 in mice also contains the ARE sequence to which Nrf-2 may bind thus providing a positive feedback loop to not only amplify its effects rather its expression as well [73, 74]. Nrf-2 also regulates the transcription and expression of heme-oxygenase 1 (HO-1) therefore, is regarded as the master regulator of the oxidative stress response [75]. Furthermore, it has been cited by Rushworth, S. A et.al; that increasing levels of NF-κB, c-Jun, and c-Fos in response to inflammation activates the transcription of the NFE2L2 gene, mediating the increase in Nrf-2 expression [68]. Thus highlighting the putative cross-talk occurring between Nrf-2 and NF-κB signaling pathways in order to maintain not only cellular redox homeostasis but also regulate cells’ response to inflammatory insult and stress [76]. However, this functional cross-talk between the said signaling pathways appears to be tissue and cell-type-specific, and much needs to be explained and explored about their cellular and molecular interaction [77]. Very interestingly, the administration of C. anthelminticum seed oil and its fraction dampens the inflammation by decreasing the NF-κB which is also reflected in the expression of IL-1β, TNF-α, and COX-1 [67] (Fig. 5B). A decrease in inflammation simultaneously brought the expression profiles of Nrf-2, keap1, and HO-1 to near-normal constitutive levels as observed in the normal control model (Fig. 5A). This finding supports the notion of the molecular and cellular communication occurring between the Nrf-2- NF-κB pathways; both are either working for or against each other to restore the redox balance [68, 78, 79]. The model lasted for approximately 9 weeks; therefore, the findings of the study are representing more or less acute changes both biochemically and at the tissue level.
The study findings have highlighted the response of antioxidant pathways in the context of acute insults much in the same way when the body’s immune system reacts to acute infectious insults; the innate and reflexive defense mechanisms all go in a forward drive to correct the insult. This means an earlier intervention can be helpful to slow and even reverse the progression of DN. The observed increase in the expression levels of Nrf-2 in the diabetic model and near normalcy of Nrf-2, Keap1, and HO-1 by C. anthelminticum seed oil calls for exploring its nuclear translocation and nuclear to cytoplasmic ratio. Furthermore, its biphasic levels with upregulation in early phases and down-regulation when DN progresses to ESRD needs to be explored. Similarly, the parallel behavior of Nrf-2 and Keap1 in diabetic and treated rats needs to be delineated for a better understanding of the mechanisms.
For further understanding of how the Nrf-2 mRNA expression profile changes acutely with changes in glucose concentration in time; cells can be treated with increasing doses of glucose at different time intervals and this could be validated using experimental in-vivo models and measuring protein expression as well. Furthermore, for exploring mechanisms of C. anthelminticum seed oil both in the early and later stages of DN, transfection studies using validated Nrf-2 specific siRNA can be used for ex-vivo models along with in vivo models. This will help to understand whether C. anthelminticum oil is: (i) Nrf-2 nuclear translocation activator; (ii) inducing the de novo synthesis of Nrf-2; or (iii) it is disrupting the Nrf-2-Keap1 complex alone without the induction of Nrf-2 synthesis. Nrf-2-NF-κB communication needs to be dissected as well to further understand the mechanism of C. anthelminticum oil; as this could be the possibility that rather than activating Nrf-2 directly, it is targeting NF-κB signaling, which is conversely activating the Nrf-2 pathway in an acute state.
Conclusion
This study explored the potential antioxidant, anti-inflammatory, and antihyperglycemic effects of the C. anthelminticum seeds fixed oil and its fractions. Despite the short intervention period of 4 weeks, the effects were promising and it can be said that seed oil has the potential to dampen inflammatory and oxidative stress in early DN. The fixed oil and its hexane fraction were found effective and had the satisfactory ability to reverse diabetic perturbations to near normal. The evidence cited in the literature and the results from this study give credibility to the valuable ethno-therapeutic properties of C. anthelminticum. The study also speculates the antinephropathic effect at an early stage can be attributed to its ability to down-regulate NF-κB which reflects by bringing the Nrf2 expression levels to near normal. Moreover, it can also have the potential of having significant long-term or chronic effects as well, which needs to be explored further. Our laboratory is presently working on the isolation and identification of the bioactive components from C. anthelminticum seed oil and its fractions for further evaluation.
Supplementary Information
Acknowledgments
The authors acknowledge the support and collaboration of scientists and technologists at the Department of Animal Sciences & Advance Research Laboratory, and Research Institute of Bio-Technology and Bio-Sciences (DRIBBS), Dow University of Health Sciences, Pakistan. We also acknowledge the Department of Biochemistry, Karachi University for providing facilitation for the provision of seeds and Industrial Analytical Center (IAC) for extraction and fractionation of the fixed oil.
Abbreviations
- DM
Diabetes mellitus
- IDF
International Diabetes Federation
- T2DM
Type 2 Diabetes Mellitus
- GFR
Glomerular filtration rate
- PF
Polyherbal formulations
- OECD
Organization of Economic Co-Operation and Development
- DUHS
Dow University of Health Sciences
- FBG
Fasting blood glucose
- HOMA-IR
Homeostatic Model Assessment of Insulin Resistance
- HOMA β
Pancreatic β-cell function
- LPO
Lipid peroxidation
- HF-HFr-STZ
High fat-high fructose-streptozotocin
- TBA
Thiobarbituric acid
- TCA
Trichloroacetic acid
- HCL
Hydrochloric acid
- HF
Hexane Fraction
- EF
Ethanol Fraction
- CF
Chloroform Fraction
- FO
Fixed Oil
- DPPH
1,1-Diphenyl-2-Picrylhydrazyl
- FRAP
Ferric reducing antioxidant power assay
Authors’ contributions
NB designed, and conceptualized the study, analyzed the data, drafted the report, and prepared the final manuscript. RS carried out laboratory work for this study and performed the statistical analysis, made all figures, and reviewed and edited the final manuscript. SAQ provided resources for the study, reviewed the draft report, and supervised the work. All authors have read and approved the manuscript.
Funding
Not applicable.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
This study was approved by the Ethical Review Board for Animal Research and Ethics, Dow University of Health Sciences, Pakistan Approval number: AR.IRB-21/DUHS/Approval/2021/037. All the methods used in this study are in compliance with ARRIVE guidelines and Organization of Economic Co-Operation and Development (OECD) guideline 420 for testing of chemicals.
Consent for publication
Not applicable.
Competing interests
None
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Saeedi P, Salpea P, Karuranga S, Petersohn I, Malanda B, Gregg EW, et al. Mortality attributable to diabetes in 20-79 years old adults, 2019 estimates: results from the international diabetes federation diabetes atlas, 9th edition. Diabetes Res Clin Pract. 2020;162:108086. doi: 10.1016/j.diabres.2020.108086. [DOI] [PubMed] [Google Scholar]
- 2.Lin Y-C, Chang Y-H, Yang S-Y, Wu K-D, Chu T-S. Update of pathophysiology and management of diabetic kidney disease. J Formos Med Assoc. 2018;117:662–675. doi: 10.1016/j.jfma.2018.02.007. [DOI] [PubMed] [Google Scholar]
- 3.Tonneijck L, Muskiet MH, Smits MM, Van Bommel EJ, Heerspink HJ, Van Raalte DH, Joles JA. Glomerular hyperfiltration in diabetes: mechanisms, clinical significance, and treatment. J Am Soc Nephrol. 2017;28(4):1023–1039. doi: 10.1681/ASN.2016060666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Majid M, Masood A, Kadla SA, Hameed I, Ganai BA. Association of Pro12Ala polymorphism of peroxisome proliferator-activated receptor gamma 2 (PPARγ2) gene with type 2 diabetes mellitus in ethnic Kashmiri population. Biochem Genet. 2017;55:10–21. doi: 10.1007/s10528-016-9765-6. [DOI] [PubMed] [Google Scholar]
- 5.Bhattacharyya C, Majumder PP, Pandit B. CXCL10 is overexpressed in active tuberculosis patients compared to M. tuberculosis-exposed household contacts. Tuberculosis. 2018;109:8–16. doi: 10.1016/j.tube.2018.01.005. [DOI] [PubMed] [Google Scholar]
- 6.MacIsaac RJ, Jerums G, Ekinci EI. Effects of glycaemic management on diabetic kidney disease. World J Diabetes 2017. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/pmc5437616/ [DOI] [PMC free article] [PubMed]
- 7.Tavafi M. Diabetic nephropathy and antioxidants. J Nephropathol. 2013;2:20–27. doi: 10.5812/nephropathol.9093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kandhare AD, Mukherjee A, Bodhankar SL. Antioxidant for treatment of diabetic nephropathy: a systematic review and meta-analysis. Chem Biol Interact. 2017;278:212–221. doi: 10.1016/j.cbi.2017.10.031. [DOI] [PubMed] [Google Scholar]
- 9.Heerspink HJL, De Zeeuw D. Novel anti-inflammatory drugs for the treatment of diabetic kidney disease. Diabetologia. 2016;59:1621–1623. doi: 10.1007/s00125-016-4030-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Xue R, Gui D, Zheng L, Zhai R, Wang F, Wang N. Mechanistic insight and Management of Diabetic Nephropathy: recent Progress and future perspective. J Diabetes Res. 2017;2017:1839809. doi: 10.1155/2017/1839809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Thomas MC, Brownlee M, Susztak K, Sharma K, Jandeleit-Dahm KAM, Zoungas S, et al. Diabetic kidney disease. Nat. Rev. Dis. Primers. 2015;1:1–20. doi: 10.1038/nrdp.2015.18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jiang G, Luk AOY, Tam CHT, Xie F, Carstensen B, Lau ESH, et al. Progression of diabetic kidney disease and trajectory of kidney function decline in Chinese patients with type 2 diabetes. Kidney Int. 2019;95:178–187. doi: 10.1016/j.kint.2018.08.026. [DOI] [PubMed] [Google Scholar]
- 13.Anders H-J, Huber TB, Isermann B, Schiffer M. CKD in diabetes: diabetic kidney disease versus nondiabetic kidney disease. Nat Rev Nephrol. 2018;14:361–377. doi: 10.1038/s41581-018-0001-y. [DOI] [PubMed] [Google Scholar]
- 14.Xu L, Li Y, Dai Y, Peng J. Natural products for the treatment of type 2 diabetes mellitus: pharmacology and mechanisms. Pharmacol Res. 2018;130:451–465. doi: 10.1016/j.phrs.2018.01.015. [DOI] [PubMed] [Google Scholar]
- 15.Unuofin JO, Lebelo SL. Antioxidant effects and mechanisms of medicinal plants and their bioactive compounds for the prevention and treatment of type 2 diabetes: an updated review. Oxidative Med Cell Longev. 2020;2020:1356893. doi: 10.1155/2020/1356893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nagaraju N, Rao KN. Folk - medicine for diabetes from rayalaseema of Andhra Pradesh. Anc Sci Life. 1989;9:31–35. [PMC free article] [PubMed] [Google Scholar]
- 17.Dogra NK, Kumar S, Kumar D. Vernonia anthelmintica (L.) Willd: an ethnomedicinal, phytochemical, pharmacological and toxicological review. J Ethnopharmacol. 2020;256:112777. doi: 10.1016/j.jep.2020.112777. [DOI] [PubMed] [Google Scholar]
- 18.Basha E, O’Neill H, Vierling E. Small heat shock proteins and α-crystallins: dynamic proteins with flexible functions. Trends Biochem Sci. 2012;37:106–117. doi: 10.1016/j.tibs.2011.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Patnaik S, Bhatnagar S. Evaluation of Cytotoxic and Antioxidant properties and Phytochemical analysis of Vernonia anthelmentica. Int J Biosci Psychiatr Technol. 2015;8(1):1. [Google Scholar]
- 20.Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, Merlini G, Mateos M-V, et al. International myeloma working group updated criteria for the diagnosis of multiple myeloma. Lancet Oncol. 2014;15:e538–e548. doi: 10.1016/S1470-2045(14)70442-5. [DOI] [PubMed] [Google Scholar]
- 21.Dailiah Roopha P, Padmalatha C. Effect of herbal preparation on heavy metal (cadmium) induced antioxidant system in female Wistar rats. J Med Toxicol. 2012;8:101–107. doi: 10.1007/s13181-011-0194-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Bedi O, Bijjem KRV, Kumar P, Gauttam V. Herbal induced Hepatoprotection and hepatotoxicity: a critical review. Indian J Physiol Pharmacol. 2016;60:6–21. [PubMed] [Google Scholar]
- 23.Fernando CD, Karunaratne DT, Gunasinghe SD, Cooray MCD, Kanchana P, Udawatte C, et al. Inhibitory action on the production of advanced glycation end products (AGEs) and suppression of free radicals in vitro by a Sri Lankan polyherbal formulation Nawarathne Kalka. BMC Complement Altern Med. 2016;16:197. doi: 10.1186/s12906-016-1178-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Huang X, Ishikawa M, Mansur A, Emet A, Nasir E, Semet R, et al. The effects of Bairesi complex prescription (a Uyghur medicine prescription) and its five crude herbal extracts on Melanogenesis in G-361 cells. Evid Based Complement Alternat Med. 2016;2016:8415359. doi: 10.1155/2016/8415359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ma ZQ, Hu H, He TT, Guo H, Zhang MY, Chen MW, et al. An assessment of traditional Uighur medicine in current Xinjiang region (China) Afr J Tradit Complement Altern Med. 2014;11:301–314. doi: 10.4314/ajtcam.v11i2.13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pavani M, Rao MS, Nath MM, Rao CA. Ethnobotanical explorations on anti-diabetic plants used by tribal inhabitants of Seshachalam forest of Andhra Pradesh, India. Indian J Fund Appl Life Sci. 2012;2:100–105. [Google Scholar]
- 27.Sabu MC. Antioxidant activity of Indian herbal drugs in rats with Aloxan-induced diabetes. Pharm Biol. 2003;41:500–505. [Google Scholar]
- 28.Bhatia D, Gupta MK, Bharadwaj A, Pathak M, Kathiwas G, Singh M. Anti-diabetic activity of Centratherum anthelminticum kuntze on alloxan induced diabetic rats. Pharmacologyonline. 2008;3:1–5. [Google Scholar]
- 29.Ani V, Naidu KA. Antihyperglycemic activity of polyphenolic components of black/bitter cumin Centratherum anthelminticum (L.) Kuntze seeds. Eur Food Res Technol. 2008;226:897–903. [Google Scholar]
- 30.Fatima SS, Rajasekhar MD, Kumar KV, Kumar MTS, Babu KR, Rao CA. Antidiabetic and antihyperlipidemic activity of ethyl acetate:isopropanol (1:1) fraction of Vernonia anthelmintica seeds in streptozotocin induced diabetic rats. Food Chem Toxicol. 2010;48:495–501. doi: 10.1016/j.fct.2009.10.048. [DOI] [PubMed] [Google Scholar]
- 31.Lateef T, Qureshi SA. Centratherum anthelminticum ameliorates antiatherogenic index in hyperlipidemic rabbits. Int J Pharm. 2013;3:698–704. [Google Scholar]
- 32.Otari KV, Shete RV, Upasani CD, Adak VS, Bagade MY, Harpalani AN. Evaluation of anti-inflammatory and anti-ArthriticActivities of Ethanolic extract of Vernonia Anthelmintica seeds. Cell Tissue Res. 2010;10.
- 33.Santosh CH, Attitalla IH, Mohan MM. Phytochemical analysis, antimicrobial and antioxidant activity of ethanolic extract of Vernonia anthelmintica. Int J Pharma Bio Sci. 2013;1:960–966. [Google Scholar]
- 34.Ediriweera E, Ratnasooriya WD, Others. A review on herbs used in treatment of diabetes mellitus by Sri Lankan ayurvedic and traditional physicians. Ayu. 2009;30:373–391. [Google Scholar]
- 35.Singh J, Bargale PC. Development of a small capacity double stage compression screw press for oil expression. J Food Eng. 2000;43:75–82. [Google Scholar]
- 36.Acute Oral Toxicity (OECD Test Guideline 425) (AOT), 2001. Statistical Programme (AOT425StatPgm), Version 1.0. http://www.oecd.org/oecd/pages/home/displaygeneral/0,3380,EN-document-524-nodirectorate-no-24-6775-8,FF.html.
- 37.Anesthesia (Guideline). [cited 23 Nov 2021]. Available: https://animal.research.uiowa.edu/iacuc-guidelines-anesthesia
- 38.Islam MA, Akhtar MA, Khan MR-I, Hossain MS, Alam AHMK, Ibne-Wahed MI, et al. Oral glucose tolerance test (OGTT) in normal control and glucose induced hyperglycemic rats with Coccinia cordifolia l. and Catharanthus roseus L. Pak J Pharm Sci. 2009;22:402–404. [PubMed] [Google Scholar]
- 39.Mudassir HA, Qureshi SA. Centratherum anthelminticum minimizes the risk of insulin resistance in fructose-induced type 2 diabetes. J Basic Appl Pharm Sci. 2015;5:074–078. [Google Scholar]
- 40.Yoo S, Ahn H, Park YK. High dietary fructose intake on cardiovascular disease related parameters in growing rats. Nutrients. 2016:9. 10.3390/nu9010011. [DOI] [PMC free article] [PubMed]
- 41.Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and β-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412–419. doi: 10.1007/BF00280883. [DOI] [PubMed] [Google Scholar]
- 42.Okoduwa SIR, Umar IA, James DB, Inuwa HM. Anti-diabetic potential of Ocimum gratissimum leaf fractions in fortified diet-fed Streptozotocin treated rat model of Type-2 diabetes. Medicines (Basel). 2017:4. [DOI] [PMC free article] [PubMed]
- 43.Krause WJ. The art of examining and interpreting histologic preparations: a student handbook: CRC Press: Universal Publisher; 2001.
- 44.Alam MB, et al. Thank you, a good research antioxidant, antimicrobial and toxicity studies of the different fractions of fruits of Terminalia belerica Roxb. Glob J Pharmacol. 2011;5:7–17. [Google Scholar]
- 45.Misra HP, Fridovich I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J Biol Chem. 1972;247:3170–3175. [PubMed] [Google Scholar]
- 46.Sinha AK. Colorimetric assay of catalase. Anal Biochem. 1972;47:389–394. doi: 10.1016/0003-2697(72)90132-7. [DOI] [PubMed] [Google Scholar]
- 47.Rao AV, Ramakrishnan S. Indirect assessment of hydroxymethylglutaryl-CoA reductase (NADPH) activity in liver tissue. Clin Chem. 1975;21:1523–1525. [PubMed] [Google Scholar]
- 48.Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys. 1959;82:70–77. doi: 10.1016/0003-9861(59)90090-6. [DOI] [PubMed] [Google Scholar]
- 49.Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hafeman DG, Hoekstra WG. Selenium: biochemical role as a component of glutathione peroxidase. Sci. 1973;179:588–590. doi: 10.1126/science.179.4073.588. [DOI] [PubMed] [Google Scholar]
- 50.Qureshi SA, Nawaz A, Udani SK, Azmi B. Hypoglycaemic and hypolipidemic activities of Rauwolfia serpentina in alloxan-induced diabetic rats. Int J Pharmacol. 2009;5:323–326. [Google Scholar]
- 51.Mudassir HA, Qureshi SA, Azmi MB, Ahsan M. Ethanolic seeds extract of Centratherum anthelminticum reduces oxidative stress in type 2 diabetes. Pak J Pharm Sci. 2018;31:991–995. [PubMed] [Google Scholar]
- 52.Lateef T, Qureshi SA. Ameliorative Effect of Withania coagulans on Experimentally-Induced Hyperlipidemia in Rabbits. J. Nat. Remedies http://paperpile.com/b/dGlO2o/2PPJl 2013;14: 83–88.
- 53.Qureshi SA, Rais S, Usmani R. Centratherum anthelminticum seeds reverse the carbon tetrachloride-induced hepatotoxicity in rats. Afr J Pharm Pharmacol. 2016;10(26):533–539. [Google Scholar]
- 54.Fowler MJ. Microvascular and macrovascular complications of diabetes. Clin Diabetes. 2008;26:77–82. [Google Scholar]
- 55.Kashihara N, Haruna Y, Kondeti VK, Kanwar YS. Oxidative stress in diabetic nephropathy. Curr Med Chem. 2010;17:4256–4269. doi: 10.2174/092986710793348581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Arya A, Cheah SC, Looi CY, Taha H, Mustafa MR, Mohd MA. The methanolic fraction of Centratherum anthelminticum seed downregulates pro-inflammatory cytokines, oxidative stress, and hyperglycemia in STZ-nicotinamide-induced type 2 diabetic rats. Food Chem Toxicol. 2012;50:4209–4220. doi: 10.1016/j.fct.2012.08.012. [DOI] [PubMed] [Google Scholar]
- 57.Arya A, Looi CY, Cheah SC, Mustafa MR, Mohd MA. Anti-diabetic effects of Centratherum anthelminticum seeds methanolic fraction on pancreatic cells, β-TC6 and its alleviating role in type 2 diabetic rats. J Ethnopharmacol. 2012;144:22–32. doi: 10.1016/j.jep.2012.08.014. [DOI] [PubMed] [Google Scholar]
- 58.Jiang T, Huang Z, Lin Y, Zhang Z, Fang D, Zhang DD. The protective role of Nrf2 in streptozotocin-induced diabetic nephropathy. Diabetes. 2010;59:850–860. doi: 10.2337/db09-1342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Kansanen E, Kivelä AM, Levonen AL. Regulation of Nrf2-dependent gene expression by 15-deoxy-Δ12,14-prostaglandin J2. Free Radic Biol Med. 2009;47:1310–1317. doi: 10.1016/j.freeradbiomed.2009.06.030. [DOI] [PubMed] [Google Scholar]
- 60.Kaspar JW, Niture SK, Jaiswal AK. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic Biol Med. 2009;47:1304–1309. doi: 10.1016/j.freeradbiomed.2009.07.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Itoh K, Ishii T, Wakabayashi N, Yamamoto M. Regulatory mechanisms of cellular response to oxidative stress. Free Radic Res. 1999;31:319–324. doi: 10.1080/10715769900300881. [DOI] [PubMed] [Google Scholar]
- 62.Wakabayashi N, Itoh K, Wakabayashi J, Motohashi H, Noda S, Takahashi S, et al. Keap1-null mutation leads to postnatal lethality due to constitutive Nrf2 activation. Nat Genet. 2003;35:238–245. doi: 10.1038/ng1248. [DOI] [PubMed] [Google Scholar]
- 63.Suzuki T, Yamamoto M. Molecular basis of the Keap1–Nrf2 system. Free Radic. Biol. Med. 2015;88:93–100. doi: 10.1016/j.freeradbiomed.2015.06.006. [DOI] [PubMed] [Google Scholar]
- 64.Yang L, Palliyaguru DL, Kensler TW. Frugal chemoprevention: targeting Nrf2 with foods rich in sulforaphane. Semin Oncol. 2016;43:146–153. doi: 10.1053/j.seminoncol.2015.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Hahn ME, Timme-Laragy AR, Karchner SI, Stegeman JJ. Nrf2 and Nrf2-related proteins in development and developmental toxicity: insights from studies in zebrafish (Danio rerio) Free Radic Biol Med. 2015;88:275–289. doi: 10.1016/j.freeradbiomed.2015.06.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Mohan T, Narasimhan KKS, Ravi DB, Velusamy P, Chandrasekar N, Chakrapani LN, et al. Role of Nrf2 dysfunction in the pathogenesis of diabetic nephropathy: therapeutic prospect of epigallocatechin-3-gallate. Free Radic. Biol. Med. 2020;160:227–238. doi: 10.1016/j.freeradbiomed.2020.07.037. [DOI] [PubMed] [Google Scholar]
- 67.Karin M, Yamamoto Y, Wang QM. The IKK NF-kappa B system: a treasure trove for drug development. Nat Rev Drug Discov. 2004;3:17–26. doi: 10.1038/nrd1279. [DOI] [PubMed] [Google Scholar]
- 68.Rushworth SA, Zaitseva L, Murray MY, Shah NM, Bowles KM, MacEwan DJ. The high Nrf2 expression in human acute myeloid leukemia is driven by NF-κB and underlies its chemo-resistance. Blood. 2012;120:5188–5198. doi: 10.1182/blood-2012-04-422121. [DOI] [PubMed] [Google Scholar]
- 69.Huang Z, Mou Y, Xu X, Zhao D, Lai Y, Xu Y, et al. Novel derivative of Bardoxolone methyl improves safety for the treatment of diabetic nephropathy. J Med Chem. 2017;60:8847–8857. doi: 10.1021/acs.jmedchem.7b00971. [DOI] [PubMed] [Google Scholar]
- 70.Rangasamy T, Cho CY, Thimmulappa RK, Zhen L, Srisuma SS, Kensler TW, et al. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J Clin Invest. 2004;114:1248–1259. doi: 10.1172/JCI21146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.He X, Ma Q. Redox regulation by nuclear factor erythroid 2-related factor 2: gatekeeping for the basal and diabetes-induced expression of thioredoxin-interacting protein. Mol Pharmacol. 2012;82:887–897. doi: 10.1124/mol.112.081133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Lateef T, Sa Q. Centratherum anthelminticum and Withania coagulans improves lipid profile and oxidative stress in triton X-100 induced hyperlipidemic rabbits. Int. J. Pharmacogn. Phytochem. Res. 2016;8(6):933–940. [Google Scholar]
- 73.Miao W, et al. Transcriptional regulation of NF-E2 p45-related factor (NRF2) expression by the aryl hydrocarbon receptor-xenobiotic response element signaling pathway: direct cross-talk between phase I and II drug-metabolizing enzymes. J Biol Chem. 2005;280(21):20340–20348. doi: 10.1074/jbc.M412081200. [DOI] [PubMed] [Google Scholar]
- 74.Kwak M-K, Itoh K, Yamamoto M, Kensler TW. Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2 promoter. Mol Cell Biol. 2002;22:2883–2892. doi: 10.1128/MCB.22.9.2883-2892.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Nguyen T, Nioi P, Pickett CB. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J Biol Chem. 2009;284:13291–13295. doi: 10.1074/jbc.R900010200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Ahmed SMU, Luo L, Namani A, Wang XJ, Tang X. Nrf2 signaling pathway: pivotal roles in inflammation. Biochim Biophys Acta Mol basis Dis. 2017;1863:585–597. doi: 10.1016/j.bbadis.2016.11.005. [DOI] [PubMed] [Google Scholar]
- 77.Wardyn JD, Ponsford AH, Sanderson CM. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem Soc Trans. 2015;43:621–626. doi: 10.1042/BST20150014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Cuadrado A, Martín-Moldes Z, Ye J, Lastres-Becker I. Transcription factors NRF2 and NF-κB are coordinated effectors of the rho family, GTP-binding protein RAC1 during inflammation. J Biol Chem. 2014;289:15244–15258. doi: 10.1074/jbc.M113.540633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Bao L, Li J, Zha D, Zhang L, Gao P, Yao T, et al. Chlorogenic acid prevents diabetic nephropathy by inhibiting oxidative stress and inflammation through modulation of the Nrf2/HO-1 and NF-ĸB pathways. Int Immunopharmacol. 2018;54:245–253. doi: 10.1016/j.intimp.2017.11.021. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.