Abstract
Riverine metabarcoding data were obtained from the Takamigawa River, a tributary of the Kinokawa River, in Nara Prefecture (Central Honshu, Japan). We extracted DNA from bulk community samples of aquatic organisms, most of which could not be morphologically identified at species level due to their small body size (0.12 - 2 mm length). A partial coding region of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1) was amplified using PCR, and the amplicon was subjected to high-throughput parallel sequencing (Illumina MiSeq). The 313 bp paired-end sequence reads were classified into operational taxonomic units (OTUs), their species boundaries were delineated using the Generalised Mixed Yule Coalescent (GMYC) method, and taxonomic names of the GMYC species were assigned using basic local alignment search tool (BLAST) against International DNA Databases (INSD: GenBank, ENA, and DDBJ).
Keywords: Benthic fauna, Cytochrome c oxidase subunit 1 gene (cox1), Metabarcoding, Riverine metagenome, Species identification
Specifications Table
| Subject: | Biodiversity |
| Specific subject area: | DNA taxonomy and species identification of stream insects |
| Type of data: | Figure, Table, and amplicon sequence data |
| Data acquisition: | Illumina MiSeq platform, MrBayes 3.2.7a, SPLITS package in R |
| Data format: | Raw sequence reads Analysed metabarcoding data |
| Description of data collection: | DNA extraction of three bulk community samples of aquatic organisms, amplicon sequencing of cox1, quality-filtering of sequence reads, operational taxonomic units (OTUs) clustering of sequence reads using ad hoc R script, building a phylogenetic tree of OTUs using Markov chain Monte Carlo (MCMC) by MrBayes 3.2.7a with the GTR+I+G molecular clock model, estimation of taxonomic boundaries among OTUs based on GMYC approach using SPLITS package in R, and BLAST search against INSD. |
| Data source location: | Bulk community samples of aquatic organisms collected from Takamigawa River, Nara Prefecture, Central Honshu, Japan. Sampling site: Aridoshi (ARD), 34°23′23″N 135°59′17″E Sampling site: Shisetsu at Kozugawa (SST), 34°23′53″N 135°59′34″E |
| Data accessibility: | With the article: Phylogenetic tree, taxonomy, abundance of the OTUs. In a public repository: DNA Databank of Japan (DDBJ) and Mendeley Data. The sequencing data are available in DDBJ under the SRA ID: DRA012522; BioProject No. PRJDB11912; BioSample: SAMD00388525, SAMD00388526, SAMD00388527, SAMD00388528, SAMD00388529, SAMD00388530, SAMD00388531, SAMD00388532; Run: DRR311861, DRR311862, DRR311863, DRR311864, DRR311865, DRR311866, DRR311867, DRR311868. OTU sequences in FASTA format and an R script for clustering OTUs are deposited in Mendeley Data with DOI:10.17632/pfhf4kt37s.1 |
Value of the Data
-
•
The metabarcoding result enables us to evaluate the efficacy of DNA-based biodiversity assessment in comparison with conventional morphology-based species identification data collected from the same localities.
-
•
The new OTU clustering algorism that compare the read abundances between neighbouring OTUs is available as an R script, which could be used widely to process amplicon sequence data.
-
•
The results are beneficial for researchers working on both DNA metabarcoding and conventional morphology-based faunal surveys.
-
•
The data will serve as a reference barcode sequence data of benthic fauna in mountain streams in the Central Honshu, Japan.
1. Data Description
Raw sequence reads of partial coding regions of cox1 in riverine metagenomes are deposited in DNA Data Bank of Japan (DDBJ). DDBJ accession numbers DRR311861 and DRR311862 were obtained from the run environment (slow riffle) of Aridoshi (ARD), DRR311863-DRR311865 from the rapid environment of Shisetsu (SST), and DDR311866-DRR311868 from the run environment of Shisetsu (SST). There were 472,697 reads in total of DRR311861- DRR311868, and they were classified into 888 OTUs.
Phylogenetic tree of the 888 OTUs was reconstructed by MrBayes 3.2.7a based on the GTR+I+G molecular clock model, and the species boundaries were delineated using the Generalised Mixed Yule Coalescent (GMYC) method (Fig. 1). A total of 369 GMYC species were presumed from 888 OTUs.
Fig. 1.
Species clusters estimated by GMYC. Each vertical bar indicates a cluster of OTUs or singleton assigned to single GMYC species. OTUs are numbered arbitrarily, and the numbers in parentheses after OTU names indicate the number of reads of OTUs. Numbers with dotted lines refer to GYMC IDs. Owing to the size of the phylogenetic tree, Fig. 1 is divided into 1a and 1b, both of which are linked at the node indicated by the closed circle (●).
Representative sequences of the GMYC species (the most abundant OTUs in the species clusters; marked with GMYC IDs in Fig. 1) were queried on INSD, and the sequence data showing the highest similarity were retrieved (Table 1). According to the critical similarity scores for species identification [1], OTUs showing similarity scores (percent identity) greater than 95% are considered to be properly deduced. In the present results, 137 out of 369 GMYC species were assigned to INSD with >95% similarity. The DNA barcode references of the remaining unassigned GMYC species may not have been registered in INSD yet. These unassigned GMYC species can be extrapolated to coarser level taxonomic names (i.e., genus, family, or order) according to the critical similarity scores proposed by Inai et al. [1].
Table 1.
List of INSD data showing highest similarity with representative OTUs assigned as species by GMYC.
| GMYC ID | (Number of identical sites/ query size) | Similarity scores (% identity) | INSD accession number Organism name/ Family/ Order | Remark on taxon |
|---|---|---|---|---|
| 10 | (313/313) | 100.0 | MK774296 Paracinygmula zhiltzovae / Heptageniidae / Ephemeroptera | |
| 11 | (313/313) | 100.0 | KP970686 Epeorus aesculus / Heptageniidae / Ephemeroptera | |
| 12 | (313/313) | 100.0 | MK774388 Epeorus curvatulus / Heptageniidae / Ephemeroptera | |
| 15 | (313/313) | 100.0 | JQ655115 Epeorus latifolium / Heptageniidae / Ephemeroptera | |
| 17 | (313/313) | 100.0 | MK774354 Epeorus latifolium / Heptageniidae / Ephemeroptera | |
| 18 | (313/313) | 100.0 | LC513137 Afronurus yoshidae / Heptageniidae / Ephemeroptera | Ecdyonurus yoshidae Takahashi, 1924 |
| 20 | (313/313) | 100.0 | LC106815 Isonychia japonica / Isonychiidae / Ephemeroptera | |
| 22 | (313/313) | 100.0 | GU354162 Cinygmula sp. MK-2010 / Heptageniidae / Ephemeroptera | |
| 25 | (313/313) | 100.0 | MK774360 Drunella trispina / Ephemerellidae / Ephemeroptera | |
| 27 | (313/313) | 100.0 | MK774334 Drunella ishiyamana / Ephemerellidae / Ephemeroptera | |
| 34 | (313/313) | 100.0 | LC489696 Dipteromimus tipuliformis / Dipteromimidae / Ephemeroptera | |
| 38 | (313/313) | 100.0 | GU354161 Paraleptophlebia chocolata / Leptophlebiidae / Ephemeroptera | |
| 39 | (313/313) | 100.0 | MN961294 Ephemera strigata / Ephemeridae / Ephemeroptera | |
| 41 | (313/313) | 100.0 | KP970715 Ephemerellidae sp. OPU_BS_E2014-4 / Ephemerellidae / Ephemeroptera | |
| 66 | (313/313) | 100.0 | MN344567 Kamimuria tibialis / Perlidae / Plecoptera | |
| 70 | (313/313) | 100.0 | MN961334 Neoperla sp. OPU BS 2019-094-DB-PL / Perlidae / Plecoptera | |
| 74 | (313/313) | 100.0 | MK774376 Paragnetina sp. OPU_BS_2017-320-YS-PL / Perlidae / Plecoptera | |
| 76 | (313/313) | 100.0 | AB770094 Togoperla limbata / Perlidae / Plecoptera | |
| 77 | (313/313) | 100.0 | MK774375 Paragnetina sp. OPU_BS_2017-319-YS-PL / Perlidae / Plecoptera | |
| 81 | (313/313) | 100.0 | MK492252 Perlomyia isobeae / Leuctridae / Plecoptera | |
| 91 | (313/313) | 100.0 | LC462303 Corynoneura celtica / Chironomidae / Diptera | |
| 96 | (313/313) | 100.0 | LC462341 Cricotopus metatibialis / Chironomidae / Diptera | |
| 97 | (313/313) | 100.0 | LC462339 Cricotopus metatibialis / Chironomidae / Diptera | |
| 119 | (313/313) | 100.0 | AB838600 Cricotopus bimaculatus / Chironomidae / Diptera | |
| 126 | (313/313) | 100.0 | LC462328 Synorthocladius tamaparvulus / Chironomidae / Diptera | |
| 137 | (313/313) | 100.0 | LC329260 Rheopelopia joganflava / Chironomidae / Diptera | |
| 161 | (313/313) | 100.0 | LC329063 Cladotanytarsus vanderwulpi / Chironomidae / Diptera | |
| 171 | (313/313) | 100.0 | LC342229 Tanytarsus tamaundecimus / Chironomidae / Diptera | |
| 177 | (313/313) | 100.0 | LC329303 Tanytarsus arduennensis / Chironomidae / Diptera | |
| 183 | (313/313) | 100.0 | LC462285 Microtendipes famiefeus / Chironomidae / Diptera | |
| 185 | (313/313) | 100.0 | LC329175 Polypedilum asakawaense / Chironomidae / Diptera | |
| 199 | (313/313) | 100.0 | JQ655116 Baetis sp. OPU_BS_B2011-494 / Baetidae / Ephemeroptera | |
| 212 | (313/313) | 100.0 | KP970716 Baetidae sp. OPU_BS_B2014-5 / Baetidae / Ephemeroptera | |
| 213 | (313/313) | 100.0 | KF563015 Baetiella japonica / Baetidae / Ephemeroptera | |
| 215 | (313/313) | 100.0 | MH260764 Stenopsyche sauteri / Stenopsychidae / Trichoptera | |
| 216 | (313/313) | 100.0 | KX291699 Stenopsyche marmorata / Stenopsychidae / Trichoptera | |
| 225 | (313/313) | 100.0 | JX448423 Parascythopus exsulans / Curculionidae / Coleoptera | Parascythopus intrusus (Kôno, 1948) |
| 230 | (313/313) | 100.0 | KX106254 Rhyacophila kawamurae / Rhyacophilidae / Trichoptera | |
| 231 | (313/313) | 100.0 | MK774340 Rhyacophila kisoensis / Rhyacophilidae / Trichoptera | |
| 237 | (313/313) | 100.0 | KX104086 Goera japonica / Goeridae / Trichoptera | |
| 238 | (313/313) | 100.0 | KX104891 Goera squamifera / Goeridae / Trichoptera # | species not recorded from Japan |
| 240 | (313/313) | 100.0 | HQ967404 Trichoptera sp. BOLD:AAN9649 / / Trichoptera | |
| 246 | (313/313) | 100.0 | LT903836 Nais communis / Naididae / Haplotaxida | Oligochaeta |
| 255 | (313/313) | 100.0 | KY284174 Eiseniella tetraedra / Lumbricidae / Crassiclitellata | Oligochaeta |
| 295 | (313/313) | 100.0 | MH260783 Cheumatopsyche infascia / Hydropsychidae / Trichoptera | |
| 296 | (313/313) | 100.0 | MH260789 Cheumatopsyche galloisi / Hydropsychidae / Trichoptera | |
| 297 | (313/313) | 100.0 | KX104427 Ceratopsyche orientalis / Hydropsychidae / Trichoptera | Hydropsyche orientalis Martynov, 1934 |
| 298 | (313/313) | 100.0 | MK774339 Ceratopsyche setensis / Hydropsychidae / Trichoptera | Hydropsyche setensis Iwata, 1927 |
| 302 | (312/312) | 100.0 | HQ967450 Trichoptera sp. BOLD:AAN9228 / / Trichoptera | |
| 305 | (313/313) | 100.0 | AP010696 Homo sapiens / Hominidae / Primates | human (contaminant?) |
| 306 | (295/295) | 100.0 | AB988797 Rhinogobius flumineus / Gobiidae / Gobiiformes | fish (lizard goby) |
| 307 | (301/301) | 100.0 | AB708313 Lestes temporalis / Lestidae / Odonata | |
| 308 | (301/301) | 100.0 | AB708713 Onychogomphus viridicostus / Gomphidae / Odonata | |
| 322 | (313/313) | 100.0 | GU722900 Hydra vulgaris / Hydridae / Anthoathecata | |
| 337 | (313/313) | 100.0 | MF000493 Craspedacusta sowerbii / Olindiidae / Limnomedusae | peach blossom jellyfish |
| 351 | (313/313) | 100.0 | JN574872 Calonectria colhounii / Nectriaceae / Hypocreales | fungus |
| 354 | (313/313) | 100.0 | MT010913 Fusarium globosum / Nectriaceae / Hypocreales | fungus |
| 3 | (312/313) | 99.7 | MK774315 Rhithrogena japonica / Heptageniidae / Ephemeroptera | |
| 56 | (312/313) | 99.7 | MK774371 Oyamia sp. OPU_BS_2017-315-YS-PL / Perlidae / Plecoptera | |
| 79 | (312/313) | 99.7 | MK132349 Amphinemura megaloba / Nemouridae / Plecoptera | |
| 98 | (312/313) | 99.7 | LC050960 Cricotopus metatibialis / Chironomidae / Diptera | |
| 135 | (312/313) | 99.7 | LC329252 Rheopelopia joganflava / Chironomidae / Diptera | |
| 136 | (312/313) | 99.7 | LC329258 Rheopelopia joganflava / Chironomidae / Diptera | |
| 166 | (312/313) | 99.7 | EF585416 Stempellinella coronata / Chironomidae / Diptera | |
| 182 | (312/313) | 99.7 | LC329124 Microtendipes britteni / Chironomidae / Diptera | |
| 188 | (312/313) | 99.7 | LC329243 Polypedilum unifascium / Chironomidae / Diptera | |
| 223 | (312/313) | 99.7 | LT991411 Ochthebius japonicus / Hydraenidae / Coleoptera | |
| 235 | (312/313) | 99.7 | MN961310 Glossosoma ussuricum / Glossosomatidae / Trichoptera | |
| 336 | (312/313) | 99.7 | MF177101 Craspedacusta sowerbii / Olindiidae / Limnomedusae | peach blossom jellyfish |
| 1 | (311/313) | 99.4 | MK774405 Rhithrogena japonica / Heptageniidae / Ephemeroptera | |
| 8 | (311/313) | 99.4 | MK774358 Rhithrogena tetrapunctigera / Heptageniidae / Ephemeroptera | |
| 9 | (311/313) | 99.4 | MN961320 Heptageniidae sp. OPU BS 2019-040-DB-EP / Heptageniidae / Ephemeroptera | |
| 26 | (311/313) | 99.4 | MK774398 Drunella kohnoi / Ephemerellidae / Ephemeroptera | |
| 107 | (311/313) | 99.4 | LC329151 Orthocladius kanii / Chironomidae / Diptera | |
| 127 | (311/313) | 99.4 | LC329155 Parakiefferiella tamatriangulata / Chironomidae / Diptera | |
| 129 | (311/313) | 99.4 | LC329157 Parametriocnemus stylatus / Chironomidae / Diptera | |
| 179 | (311/313) | 99.4 | LC329188 Polypedilum hiroshimaense / Chironomidae / Diptera | |
| 194 | (311/313) | 99.4 | MN961306 Apsilochorema sutshanum / Hydrobiosidae / Trichoptera | |
| 196 | (311/313) | 99.4 | MK144522 Nymphomyia alba / Nymphomyiidae / Diptera | |
| 197 | (311/313) | 99.4 | KP970694 Baetis sp. MK-2015d / Baetidae / Ephemeroptera | |
| 234 | (311/313) | 99.4 | MN961311 Glossosoma altaicum / Glossosomatidae / Trichoptera | |
| 301 | (311/313) | 99.4 | HQ967424 Trichoptera sp. BOLD:AAN3967 / / Trichoptera | |
| 21 | (310/313) | 99.0 | MK774393 Epeorus ikanonis / Heptageniidae / Ephemeroptera | |
| 55 | (310/313) | 99.0 | MK774343 Baetidae sp. OPU_BS_2017-141-MA-EP / Baetidae / Ephemeroptera | |
| 123 | (310/313) | 99.0 | LC462337 Orthocladius tamarutilus / Chironomidae / Diptera | |
| 164 | (310/313) | 99.0 | LC329266 Rheotanytarsus tamasecundus / Chironomidae / Diptera | |
| 168 | (310/313) | 99.0 | LC329147 Neozavrelia tamanona / Chironomidae / Diptera | |
| 187 | (310/313) | 99.0 | LC329176 Polypedilum asoprimum / Chironomidae / Diptera | |
| 294 | (310/313) | 99.0 | KX103761 Psychomyia nipponica / Psychomyiidae / Trichoptera | |
| 86 | (309/313) | 98.7 | LC462305 Corynoneura kibunelata / Chironomidae / Diptera | |
| 95 | (309/313) | 98.7 | LC462311 Thienemanniella majuscula / Chironomidae / Diptera | |
| 159 | (309/313) | 98.7 | LC329058 Cladotanytarsus vanderwulpi / Chironomidae / Diptera | |
| 210 | (309/313) | 98.7 | KP970709 Acentrella gnom / Baetidae / Ephemeroptera | |
| 242 | (309/313) | 98.7 | GQ355370 Nais variabilis / Naididae / Haplotaxida | Oligochaeta |
| 250 | (309/313) | 98.7 | GQ355366 Chaetogaster diaphanus / Naididae / Haplotaxida | Oligochaeta |
| 45 | (308/313) | 98.4 | JQ655113 Serratella setigera / Ephemerellidae / Ephemeroptera | |
| 46 | (308/313) | 98.4 | JQ655113 Serratella setigera / Ephemerellidae / Ephemeroptera | |
| 85 | (308/313) | 98.4 | LC462302 Corynoneura tenuistyla / Chironomidae / Diptera | |
| 90 | (308/313) | 98.4 | LC462308 Corynoneura lobata / Chironomidae / Diptera | |
| 113 | (308/313) | 98.4 | LC329246 C / Chironomidae / Diptera | |
| 236 | (308/313) | 98.4 | KX106735 Rhyacophila angulata / Rhyacophilidae / Trichoptera # | species not recorded from Japan |
| 16 | (307/313) | 98.1 | JQ655115 Epeorus latifolium / Heptageniidae / Ephemeroptera | |
| 31 | (307/313) | 98.1 | LC481971 Cincticostella elongatula / Ephemerellidae / Ephemeroptera | |
| 92 | (307/313) | 98.1 | LC329294 Thienemanniella flaviscutella / Chironomidae / Diptera | |
| 103 | (307/313) | 98.1 | LC329301 Tvetenia tamaflava / Chironomidae / Diptera | |
| 133 | (307/313) | 98.1 | KY497570 Simulium quinquestriatum / Simuliidae / Diptera | |
| 53 | (306/313) | 97.8 | LC462319 Nilotanypus dubius / Chironomidae / Diptera | |
| 209 | (306/313) | 97.8 | KF563060 Nigrobaetis chocoratus / Baetidae / Ephemeroptera | |
| 224 | (306/313) | 97.8 | KM376576 Hydrocyphon satoi / Scirtidae / Coleoptera | |
| 29 | (305/312) | 97.8 | LC461422 Drunella ishiyamana / Ephemerellidae / Ephemeroptera | |
| 19 | (305/313) | 97.4 | MK774389 Ecdyonurus sp. OPU_BS_2018-038-IN-EP / Heptageniidae / Ephemeroptera | |
| 180 | (305/313) | 97.4 | AB731460 Polypedilum takaoense / Chironomidae / Diptera | |
| 244 | (305/313) | 97.4 | LN810267 Nais bretscheri / Naididae / Haplotaxida | Oligochaeta |
| 299 | (305/313) | 97.4 | KX291233 Oecetis raghava / Leptoceridae / Trichoptera # | species not recorded from Japan |
| 362 | (304/312) | 97.4 | MK468491 Ascochyta pisi / Didymellaceae / Pleosporales | fungus |
| 30 | (304/313) | 97.1 | LC481981 Cincticostella orientalis / Ephemerellidae / Ephemeroptera | |
| 118 | (304/313) | 97.1 | KX037940 Tiphobiosis hinewai / Hydrobiosidae / Trichoptera # | species not recorded from Japan |
| 131 | (304/313) | 97.1 | MG551479 Simulium bidentatum / Simuliidae / Diptera | |
| 160 | (304/313) | 97.1 | LC329058 Cladotanytarsus vanderwulpi / Chironomidae / Diptera | |
| 181 | (304/313) | 97.1 | LC329088 Demicryptochironomus vulneratus / Chironomidae / Diptera | |
| 353 | (304/313) | 97.1 | MT123351 Calonectria ilicicola / Nectriaceae / Hypocreales | fungus |
| 28 | (303/313) | 96.8 | MK774334 Drunella ishiyamana / Ephemerellidae / Ephemeroptera | |
| 200 | (303/313) | 96.8 | JQ655116 Baetis sp. OPU_BS_B2011-494 / Baetidae / Ephemeroptera | |
| 117 | (302/313) | 96.5 | LC329102 Eukiefferiella chuzeoctava / Chironomidae / Diptera | |
| 186 | (302/313) | 96.5 | LC329204 Polypedilum parviacumen / Chironomidae / Diptera | |
| 54 | (302/314) | 96.2 | LC462319 Nilotanypus dubius / Chironomidae / Diptera | |
| 33 | (301/313) | 96.2 | MH260779 Drunella sp. OPU_BS_D2016-90 / Ephemerellidae / Ephemeroptera | |
| 47 | (301/313) | 96.2 | MK774379 Serratella setigera / Ephemerellidae / Ephemeroptera | |
| 104 | (301/313) | 96.2 | LC329301 Tvetenia tamaflava / Chironomidae / Diptera | |
| 167 | (301/313) | 96.2 | AM398700 Micropsectra kurobemaculata / Chironomidae / Diptera | |
| 248 | (301/313) | 96.2 | KY633405 Slavina appendiculata / Naididae / Haplotaxida | Oligochaeta |
| 128 | (300/312) | 96.2 | LC329156 Parametriocnemus stylatus / Chironomidae / Diptera | |
| 252 | (299/313) | 95.5 | AF534855 Pristina osborni / Naididae / Haplotaxida | Oligochaeta |
| 71 | (298/313) | 95.2 | MN961334 Neoperla sp. OPU BS 2019-094-DB-PL / Perlidae / Plecoptera | |
| 87 | (298/313) | 95.2 | LC462305 Corynoneura kibunelata / Chironomidae / Diptera | |
| 214 | (298/313) | 95.2 | KF563015 Baetiella japonica / Baetidae / Ephemeroptera | |
| 233 | (296/311) | 95.2 | KX107043 Rhyacophila brevicephala / Rhyacophilidae / Trichoptera | similarity score >95% |
| 57 | (297/313) | 94.9 | MK774371 Oyamia sp. OPU_BS_2017-315-YS-PL / Perlidae / Plecoptera | similarity score <95% |
| 184 | (297/313) | 94.9 | LC329139 Microtendipes tamaogouti / Chironomidae / Diptera | |
| 48 | (296/313) | 94.6 | MK774379 Serratella setigera / Ephemerellidae / Ephemeroptera | |
| 211 | (296/313) | 94.6 | KP970709 Acentrella gnom / Baetidae / Ephemeroptera | |
| 122 | (294/311) | 94.5 | LC462337 Orthocladius tamarutilus / Chironomidae / Diptera | |
| 142 | (294/312) | 94.2 | KX946556 Tabanus thoracinus / Tabanidae / Diptera | |
| 58 | (294/313) | 93.9 | MK774371 Oyamia sp. OPU_BS_2017-315-YS-PL / Perlidae / Plecoptera | |
| 205 | (277/295) | 93.9 | MH823348 Acentrella sibirica / Baetidae / Ephemeroptera | |
| 339 | (293/313) | 93.6 | KR055655 Pseudogymnoascus pannorum / Pseudeurotiaceae / | fungus |
| 361 | (293/313) | 93.6 | MK468491 Ascochyta pisi / Didymellaceae / Pleosporales | fungus |
| 245 | (290/310) | 93.5 | LN810254 Piguetiella blanci / Naididae / Haplotaxida | Oligochaeta |
| 341 | (293/314) | 93.3 | KR055655 Pseudogymnoascus pannorum / Pseudeurotiaceae / | fungus |
| 61 | (292/313) | 93.3 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 72 | (292/313) | 93.3 | MN961334 Neoperla sp. OPU BS 2019-094-DB-PL / Perlidae / Plecoptera | |
| 146 | (292/313) | 93.3 | MG089252 Hexatoma sp. I13-26-02 / Limoniidae / Diptera | |
| 218 | (291/312) | 93.3 | HQ938480 Zaitzevia sp. BOLD:AAN5764 / Elmidae / Coleoptera | |
| 88 | (288/309) | 93.2 | KM928316 Chironomidae sp. BOLD:AAN5033 / Chironomidae / Diptera | |
| 344 | (267/287) | 93.0 | KX450332 Glarea lozoyensis / Helotiaceae / Helotiales | fungus |
| 143 | (291/313) | 93.0 | MK396368 Tabanus thoracinus / Tabanidae / Diptera | |
| 145 | (290/312) | 92.9 | MG089252 Hexatoma sp. I13-26-02 / Limoniidae / Diptera | |
| 132 | (289/311) | 92.9 | AY251508 Simulium grossifilum / Simuliidae / Diptera | |
| 106 | (288/310) | 92.9 | MF458772 Orthocladiinae sp. BAP34 / Chironomidae / Diptera | |
| 59 | (290/313) | 92.7 | MK774371 Oyamia sp. OPU_BS_2017-315-YS-PL / Perlidae / Plecoptera | |
| 141 | (290/313) | 92.7 | DQ983533 Tabanus aegrotus / Tabanidae / Diptera | |
| 124 | (286/309) | 92.6 | MN680434 Pseudokiefferiella sp. BOLD:AAL9436 / Chironomidae / Diptera | |
| 40 | (289/313) | 92.3 | LC461324 Teloganopsis punctisetae / Ephemerellidae / Ephemeroptera | |
| 114 | (289/313) | 92.3 | JF287767 Potthastia gaedii / Chironomidae / Diptera | |
| 116 | (289/313) | 92.3 | HQ941600 Orthocladius rivulorum / Chironomidae / Diptera | |
| 144 | (288/313) | 92.0 | KC592633 Scioniini gen. NZ sp. lerda / Tabanidae / Diptera | |
| 102 | (287/312) | 92.0 | MT047747 Diamesa hyperborea / Chironomidae / Diptera | |
| 360 | (287/312) | 92.0 | KM382246 Shiraia bambusicola / Shiraiaceae / Pleosporales | fungus |
| 227 | (285/310) | 91.9 | MT230864 Parachauliodes continentalis / Corydalidae / Megaloptera | |
| 134 | (283/308) | 91.9 | KP252587 Simulium gonzalezi / Simuliidae / Diptera | |
| 7 | (287/313) | 91.7 | MK774358 Rhithrogena tetrapunctigera / Heptageniidae / Ephemeroptera | |
| 60 | (287/313) | 91.7 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 100 | (287/313) | 91.7 | KJ082995 Apsiphortica lini / Drosophilidae / Diptera | |
| 125 | (286/312) | 91.7 | MG301788 Orthocladiinae sp. BIOUG23941-E02 / Chironomidae / Diptera | |
| 109 | (284/310) | 91.6 | KX779818 Culex gnomatos / Culicidae / Diptera | |
| 170 | (286/313) | 91.4 | KT613675 Tanytarsus sp. 7XL / Chironomidae / Diptera | |
| 99 | (283/310) | 91.3 | LC329164C / Chironomidae / Diptera | |
| 355 | (271/297) | 91.2 | MK674497 Podosphaera xanthii / Erysiphaceae / Erysiphales | fungus |
| 271 | (279/306) | 91.2 | MN673973 Sperchon glandulosus / Sperchontidae / Trombidiformes | Acariformes |
| 2 | (285/313) | 91.1 | MK774405 Rhithrogena japonica / Heptageniidae / Ephemeroptera | |
| 64 | (285/313) | 91.1 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 65 | (285/313) | 91.1 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 340 | (284/312) | 91.0 | EU883400 Tetracladium apiense / / Helotiales | fungus |
| 115 | (281/309) | 90.9 | KC750387 Cricotopus sp. 1 MEC-2013 / Chironomidae / Diptera | |
| 342 | (279/307) | 90.9 | KY318514 Pseudogymnoascus destructans / Pseudeurotiaceae / | fungus |
| 93 | (286/315) | 90.8 | KR659696 Corynoneura sp. BOLD-2016 / Chironomidae / Diptera | |
| 121 | (285/314) | 90.8 | JX887678 Leucophenga saigusai / Drosophilidae / Diptera | |
| 334 | (284/313) | 90.7 | GU070900 invertebrate environmental sample / / | unspecified |
| 173 | (283/312) | 90.7 | LC329269 Stempellinella tamaseptima / Chironomidae / Diptera | |
| 228 | (283/312) | 90.7 | KX294695 Rhyacophila lata / Rhyacophilidae / Trichoptera | |
| 148 | (282/311) | 90.7 | KX771129 Drosophila nikananu / Drosophilidae / Diptera | |
| 243 | (282/311) | 90.7 | GQ355369 Nais elinguis / Naididae / Haplotaxida | Oligochaeta |
| 154 | (272/300) | 90.7 | KT116489 Gymnometriocnemus brumalis / Chironomidae / Diptera | |
| 110 | (281/310) | 90.6 | KF839967 Simulium callidum / Simuliidae / Diptera | |
| 130 | (280/309) | 90.6 | KP697234 Leucophenga sp. 7 HWC-2015 / Drosophilidae / Diptera | |
| 139 | (267/295) | 90.5 | JF871911 Docosia sp. BOLD:AAP4732 / Mycetophilidae / Diptera | |
| 120 | (283/313) | 90.4 | LC582930 Chironominae sp. 11 NK-2020 / Chironomidae / Diptera | |
| 352 | (283/313) | 90.4 | JN574872 Calonectria colhounii / Nectriaceae / Hypocreales | fungus |
| 101 | (282/312) | 90.4 | MG308407 Gymnometriocnemus sp. BIOUG01460-H10 / Chironomidae / Diptera | |
| 105 | (282/312) | 90.4 | KY841662 Chironomidae sp. BIOUG02204-H08 / Chironomidae / Diptera | |
| 94 | (281/311) | 90.4 | MF825573 Chironomidae sp. BIOUG20749-B02 / Chironomidae / Diptera | |
| 111 | (281/311) | 90.4 | MG144554 Chironomidae sp. BIOUG27558-D07 / Chironomidae / Diptera | |
| 140 | (280/310) | 90.3 | JN887059 Cricotopus bimaculatus / Chironomidae / Diptera | |
| 149 | (273/303) | 90.1 | KY833856 Megaselia sp. BIOUG02394-D11 / Phoridae / Diptera | |
| 67 | (282/313) | 90.1 | MN344567 Kamimuria tibialis / Perlidae / Plecoptera | |
| 147 | (281/312) | 90.1 | MW301815 Pilaria sp. ZS10 / Limoniidae / Diptera | |
| 155 | (275/306) | 89.9 | LC057190 Drosophila trilutea / Drosophilidae / Diptera | |
| 343 | (281/313) | 89.8 | EU678468 Leohumicola sp. DAOM 239516 / / | fungus |
| 162 | (280/312) | 89.7 | LC329265 Rheotanytarsus tamaquintus / Chironomidae / Diptera | |
| 269 | (280/312) | 89.7 | MN362995 Lebertia sp. BIOUG15123-B05 / Lebertiidae / Trombidiformes | Acariformes |
| 273 | (280/312) | 89.7 | MF744731 Hydryphantes sp. BIOUG18156-B10 / Hydryphantidae / Trombidiformes | Acariformes |
| 138 | (279/311) | 89.7 | MG301788 Orthocladiinae sp. BIOUG23941-E02 / Chironomidae / Diptera | |
| 165 | (279/311) | 89.7 | MF835529 Tachinidae sp. BIOUG21146-F12 / Tachinidae / Diptera | |
| 350 | (279/311) | 89.7 | MN593345 Arthrocladium fulminans / Trichomeriaceae / Chaetothyriales | fungus |
| 158 | (278/310) | 89.7 | KC263146 Antocha sp. SS-2012 / Limoniidae / Diptera | |
| 220 | (269/300) | 89.7 | MF881631 Drosophilinae sp. BIOUG24085-F09 / Drosophilidae / Diptera | |
| 239 | (277/309) | 89.6 | JQ907722 Goeracea genota / Goeridae / Trichoptera | |
| 151 | (274/306) | 89.5 | JN285990 Zavrelimyia sp. 1ES / Chironomidae / Diptera | |
| 89 | (280/313) | 89.5 | LC462308 Corynoneura lobata / Chironomidae / Diptera | |
| 112 | (280/313) | 89.5 | MG300230 Tanypodinae sp. BIOUG21865-B09 / Chironomidae / Diptera | |
| 150 | (280/313) | 89.5 | MF476250 Simulium atratum / Simuliidae / Diptera | |
| 262 | (278/311) | 89.4 | MG895845 Sperchon glandulosus / Sperchontidae / Trombidiformes | Acariformes |
| 51 | (261/292) | 89.4 | MG516460 Chromarcys magnifica / Oligoneuriidae / Ephemeroptera | |
| 318 | (269/301) | 89.4 | JN418688 Pinnularia sp. 9 CS-2011 / Pinnulariaceae / Naviculales | alga |
| 108 | (280/314) | 89.2 | KR457791 Orthocladius sp. BOLD-2016 / Chironomidae / Diptera | |
| 153 | (277/311) | 89.1 | KR438630 Nanocladius dichromus / Chironomidae / Diptera | |
| 175 | (267/300) | 89.0 | HM385606 Tanytarsus sp. TTDFW1048-09 / Chironomidae / Diptera | |
| 300 | (273/307) | 88.9 | FN601011 Ptochoecetis africana / Leptoceridae / Trichoptera | |
| 172 | (278/313) | 88.8 | LC495094 Benthalia sp. HM-2012 / Chironomidae / Diptera | |
| 78 | (277/312) | 88.8 | MK774407 Paragnetina sp. OPU_BS_2018-050-TM-PL / Perlidae / Plecoptera | |
| 156 | (277/312) | 88.8 | FM998448 Cheumatopsyche persica / Hydropsychidae / Trichoptera | |
| 274 | (277/312) | 88.8 | MW369218 Sperchonopsis aff. verrucosa VZ19076 / Sperchontidae / Trombidiformes | Acariformes |
| 226 | (276/311) | 88.7 | JX448423 Parascythopus exsulans / Curculionidae / Coleoptera | Parascythopus intrusus (Kôno, 1948) |
| 247 | (273/308) | 88.6 | JQ519820 Chaetogaster diastrophus / Naididae / Haplotaxida | Oligochaeta |
| 270 | (271/306) | 88.6 | MF458740 Lebertia porosa / Lebertiidae / Trombidiformes | Acariformes |
| 249 | (270/305) | 88.5 | GQ355367 Chaetogaster diastrophus / Naididae / Haplotaxida | Oligochaeta |
| 83 | (277/313) | 88.5 | LC462302 Corynoneura tenuistyla / Chironomidae / Diptera | |
| 163 | (277/313) | 88.5 | KT613493 Tanytarsus tamaduodecimus / Chironomidae / Diptera | |
| 178 | (277/313) | 88.5 | KC750520 Riethia stictoptera / Chironomidae / Diptera | |
| 268 | (276/312) | 88.5 | MW369264 Torrenticola aff. amplexa VZ19145 / Torrenticolidae / Trombidiformes | Acariformes |
| 84 | (268/303) | 88.4 | KF489833 Corynoneura mediaspicula / Chironomidae / Diptera | |
| 193 | (260/294) | 88.4 | MT262583 Simulium sp. BPD1 / Simuliidae / Diptera | |
| 330 | (274/310) | 88.4 | KC791166 Neoporphyra haitanensis / Bangiaceae / Bangiales | red alga |
| 169 | (278/315) | 88.3 | JF287884 Rheotanytarsus sp. BOLD:AAH3855 / Chironomidae / Diptera | |
| 346 | (270/306) | 88.2 | KY318514 Pseudogymnoascus destructans / Pseudeurotiaceae / | fungus |
| 24 | (262/297) | 88.2 | MH823334 Proepeorus nipponicus / Heptageniidae / Ephemeroptera | Epeorus nipponicus (Ueno,1931) |
| 176 | (276/313) | 88.2 | MN150323 Chironomidae sp. CH08 Zhangqiao Village 3 / Chironomidae / Diptera | |
| 267 | (276/313) | 88.2 | KJ709343 Arrenurus sp. BOLD:ACH9257 / Arrenuridae / Trombidiformes | Acariformes |
| 348 | (275/312) | 88.1 | KR704425 Verticillium nonalfalfae / Plectosphaerellaceae / Glomerellales | fungus |
| 229 | (267/303) | 88.1 | GU711742 Himalopsyche sp. XZ CN1 / Rhyacophilidae / Trichoptera | |
| 49 | (270/307) | 87.9 | MK403745 Ablabesmyia monilis / Chironomidae / Diptera | |
| 63 | (276/314) | 87.9 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 152 | (268/305) | 87.9 | KY861853 Dictenidia leigongshanensis / Tipulidae / Diptera | |
| 80 | (275/313) | 87.9 | MH840672 Sweltsa borealis / Chloroperlidae / Plecoptera | |
| 174 | (266/303) | 87.8 | KP462171 Chironomidae sp. WHW-2015 / Chironomidae / Diptera | |
| 349 | (263/300) | 87.7 | MN593345 Arthrocladium fulminans / Trichomeriaceae / Chaetothyriales | fungus |
| 282 | (270/308) | 87.7 | HM377216 Hydryphantes sp. KOWMC070-09 / Hydryphantidae / Trombidiformes | Acariformes |
| 52 | (268/306) | 87.6 | LC329151 Orthocladius kanii / Chironomidae / Diptera | |
| 272 | (275/314) | 87.6 | MW369201 Protzia caucasica / Hydryphantidae / Trombidiformes | Acariformes |
| 356 | (274/313) | 87.5 | KU168424 Cairneyella variabilis / Helotiaceae / Helotiales | fungus |
| 192 | (273/312) | 87.5 | KU373672 Ceratopogon sp. BOLD:ACI9186 / Ceratopogonidae / Diptera | |
| 221 | (272/311) | 87.5 | HQ938470 Ordobrevia nubifera / Elmidae / Coleoptera | |
| 265 | (265/303) | 87.5 | KU243801 Testudacarus harrisi / Torrenticolidae / Trombidiformes | Acariformes |
| 219 | (270/309) | 87.4 | KT818884 Hydora sp. EJD-2015 / Elmidae / Coleoptera | |
| 195 | (256/293) | 87.4 | KP252653 Simulium travisi / Simuliidae / Diptera | |
| 345 | (268/307) | 87.3 | KX257489 Cladophialophora bantiana / Herpotrichiellaceae / Chaetothyriales | fungus |
| 62 | (274/314) | 87.3 | AB770139 Oyamia lugubris / Perlidae / Plecoptera | |
| 191 | (273/313) | 87.2 | JF872386 Ceratopogonidae sp. BOLD:AAG6465 / Ceratopogonidae / Diptera | |
| 359 | (266/305) | 87.2 | MK637641 Sydowia polyspora / Dothioraceae / Dothideales | fungus |
| 157 | (273/314) | 86.9 | EU493666 Drosophila nigella / Drosophilidae / Diptera | |
| 263 | (272/313) | 86.9 | HQ938536 Sperchon sp. BOLD:AAN9213 / Sperchontidae / Trombidiformes | Acariformes |
| 333 | (269/310) | 86.8 | GU070901 invertebrate environmental sample / / | unspecified |
| 232 | (268/309) | 86.7 | MG511784 Rhyacophilidae sp. 10BBEPT-0215 / Rhyacophilidae / Trichoptera | |
| 13 | (273/315) | 86.7 | MH844244 Anopheles braziliensis / Culicidae / Diptera | |
| 303 | (265/306) | 86.6 | JN304924 Chrysauginae sp. BOLD:AAM6842 / Pyralidae / Lepidoptera | moth |
| 50 | (258/298) | 86.6 | MF668536 Siphlaenigma janae / Siphlaenigmatidae / Ephemeroptera | |
| 14 | (270/312) | 86.5 | KP970706 Rhithrogena tetrapunctigera / Heptageniidae / Ephemeroptera | |
| 293 | (249/288) | 86.5 | MN674851 Hydryphantidae sp. BOLD:ADS0542 / Hydryphantidae / Trombidiformes | Acariformes |
| 190 | (270/313) | 86.3 | MF105765 Culicoides longipennis / Ceratopogonidae / Diptera | |
| 68 | (263/306) | 85.9 | KR665902 Drosophila paramelanica / Drosophilidae / Diptera | |
| 285 | (269/313) | 85.9 | MW369236 Parathyas dirempta / Hydryphantidae / Trombidiformes | Acariformes |
| 347 | (268/312) | 85.9 | MN657181 Cladosporium sphaerospermum / Cladosporiaceae / Cladosporiales | fungus |
| 278 | (263/307) | 85.7 | MG319031 Sperchontidae sp. BIOUG22338-D12 / Sperchontidae / Trombidiformes | Acariformes |
| 332 | (268/313) | 85.6 | MT228925 Vexillifera sp. AKu-2020a / Vexilliferidae / Dactylopodida | Amoebozoa |
| 284 | (265/310) | 85.5 | MN364233 Parathyas sp. BOLD:AAM7957 / Hydryphantidae / Trombidiformes | Acariformes |
| 358 | (265/310) | 85.5 | KX011536 Zasmidium cellare / Mycosphaerellaceae / Mycosphaerellales | fungus |
| 5 | (264/309) | 85.4 | KJ675257 Cinygmula sp. JMW3 / Heptageniidae / Ephemeroptera | |
| 82 | (266/312) | 85.3 | KX576477 Taenionema atlanticum / Taeniopterygidae / Plecoptera | |
| 251 | (258/303) | 85.1 | GQ355374 Pristina aequiseta / Naididae / Haplotaxida | Oligochaeta |
| 283 | (263/309) | 85.1 | KC263080 Sperchon sp. SS-2012 / Sperchontidae / Trombidiformes | Acariformes |
| 4 | (267/314) | 85.0 | MN961316 Heptageniidae sp. OPU BS 2019-017-DB-EP / Heptageniidae / Ephemeroptera | |
| 208 | (260/306) | 85.0 | KR489256 Melanophthalma helvola / Latridiidae / Coleoptera | |
| 280 | (262/309) | 84.8 | MG835761 Axonopsis sp. 1BHL041917av / Aturidae / Trombidiformes | Acariformes |
| 254 | (261/308) | 84.7 | LN999074 Enchytraeidae sp. 1 RV-2016 / Enchytraeidae / Enchytraeida | Oligochaeta |
| 207 | (266/314) | 84.7 | MN640425 Cloeon perkinsi / Baetidae / Ephemeroptera | |
| 206 | (265/313) | 84.7 | JQ662499 Baetodes sp. JMW1 / Baetidae / Ephemeroptera | |
| 259 | (265/313) | 84.7 | KP845499 Harpacticoida sp. BOLD:ACM2620 / / Harpacticoida | copepod |
| 222 | (257/304) | 84.5 | FJ819961 Anacaena sp. 5 MTM-2009 / Hydrophilidae / Coleoptera | |
| 264 | (267/316) | 84.5 | MF746983 Sperchontidae sp. BIOUG18716-A05 / Sperchontidae / Trombidiformes | Acariformes |
| 201 | (264/313) | 84.3 | MT830952 Labiobaetis sabordoi / Baetidae / Ephemeroptera | |
| 253 | (260/309) | 84.1 | GU014012 Megascolecidae sp. DPEW46886 / Megascolecidae / Crassiclitellata | Opisthopora |
| 363 | (233/277) | 84.1 | HQ923626 Phrixocomes sp. ANIC7 / Geometridae / Lepidoptera | moth |
| 189 | (254/302) | 84.1 | KX453756 Liponeura cordata / Blephariceridae / Diptera | |
| 311 | (259/308) | 84.1 | MN356524 Oribatella sp. BOLD:AAL8123 / Oribatellidae / Sarcoptiformes | Acariformes |
| 6 | (253/301) | 84.1 | HQ261141 Paraleptophlebia sp. AMI 1 / Leptophlebiidae / Ephemeroptera | |
| 321 | (252/300) | 84.0 | MT222521 Globisporangium spinosum / Pythiaceae / Pythiales | fungus |
| 204 | (262/312) | 84.0 | KF563030 Baetis thermicus / Baetidae / Ephemeroptera | |
| 367 | (262/312) | 84.0 | MW369294 Atractides tener / Hygrobatidae / Trombidiformes | Acariformes |
| 73 | (261/311) | 83.9 | MK132423 Nemoura sp. 3 MG-2018 / Nemouridae / Plecoptera | |
| 203 | (261/311) | 83.9 | MH841573 Baetis bicaudatus / Baetidae / Ephemeroptera | |
| 317 | (239/285) | 83.9 | EF164936 Sellaphora pupula / Sellaphoraceae / Naviculales | alga |
| 319 | (258/308) | 83.8 | MF997422 Nitzschia alba / Bacillariaceae / Bacillariales | alga |
| 290 | (262/313) | 83.7 | LR827697 Agraylea multipunctata / Hydroptilidae / Trichoptera | |
| 289 | (241/288) | 83.7 | MW369278 Lebertia porosa / Lebertiidae / Trombidiformes | Acariformes |
| 69 | (256/306) | 83.7 | KR665902 Drosophila paramelanica / Drosophilidae / Diptera | |
| 304 | (261/312) | 83.7 | KX296397 Hydroptilidae sp. TVTRI0057 / Hydroptilidae / Trichoptera | |
| 275 | (255/305) | 83.6 | MN359216 Mideopsis sp. BOLD:AAL8123 / Mideopsidae / Trombidiformes | Acariformes |
| 357 | (260/311) | 83.6 | EU678467 Myxotrichum deflexum / Myxotrichaceae / | fungus |
| 324 | (137/164) | 83.5 | KR879316 Pholetesor sp. BOLD-2016 / Braconidae / Hymenoptera | wasp |
| 331 | (246/295) | 83.4 | KR665197 Mycetophilidae sp. BOLD-2016 / Mycetophilidae / Diptera | |
| 32 | (256/307) | 83.4 | JQ661610 Ephemerella dorothea / Ephemerellidae / Ephemeroptera | |
| 256 | (264/317) | 83.3 | KY633394 Branchiodrilus hortensis / Naididae / Haplotaxida | Oligochaeta |
| 217 | (259/311) | 83.3 | KR561360 Saldidae sp. BOLD-2016 / Saldidae / Hemiptera | shore bug |
| 281 | (259/311) | 83.3 | JX838402 Hydryphantes sp. BOLD:AAF4149 / Hydryphantidae / Trombidiformes | Acariformes |
| 320 | (251/302) | 83.1 | KF768027 Dimeregramma acutum / Plagiogrammaceae / Triceratiales | alga |
| 327 | (187/225) | 83.1 | MT925539 Protancylus adhaerens / Protancylidae / Hygrophila | Gastrapoda |
| 23 | (260/313) | 83.1 | KM570892 Dolichopodidae sp. BOLD:AAG9626 / Dolichopodidae / Diptera | |
| 198 | (259/312) | 83.0 | HG935109 Cloeon cf. smaeleni GL30 / Baetidae / Ephemeroptera | |
| 276 | (259/312) | 83.0 | MG316728 Mideopsis sp. BIOUG23251-F06 / Mideopsidae / Trombidiformes | Acariformes |
| 286 | (259/312) | 83.0 | MG449836 Pionidae sp. BIOUG30216_F02 / Pionidae / Trombidiformes | Acariformes |
| 279 | (261/315) | 82.9 | MW369209 Lebertia aff. inaequalis VZ19067 / Lebertiidae / Trombidiformes | Acariformes |
| 335 | (251/303) | 82.8 | MH124198 Acanthamoeba sp. / Acanthamoebidae / Longamoebia | Amoebozoa |
| 291 | (260/314) | 82.8 | HQ563462 Micropterix schaefferi / Micropterigidae / Lepidoptera | moth |
| 36 | (259/313) | 82.7 | KM954873 Dolichopodidae sp. BOLD:ACB1149 / Dolichopodidae / Diptera | |
| 202 | (258/312) | 82.7 | KR134645 Baetodes sp. gmycM20 / Baetidae / Ephemeroptera | |
| 292 | (258/312) | 82.7 | MG311338 Lebertia sp. BIOUG25361-C07 / Lebertiidae / Trombidiformes | Acariformes |
| 316 | (243/294) | 82.7 | MH681084 Pinnularia macilenta / Pinnulariaceae / Naviculales | alga |
| 277 | (238/288) | 82.6 | MG315676 Hydrodroma sp. BIOUG23251-F10 / Hydrodromidae / Trombidiformes | Acariformes |
| 266 | (257/311) | 82.6 | JN018109 Torrenticola amplexa / Torrenticolidae / Trombidiformes | Acariformes |
| 241 | (244/296) | 82.4 | KX842664 Platysticta serendibica / Platystictidae / Odonata | |
| 312 | (244/296) | 82.4 | MN674518 Oppiidae sp. BOLD:AAL7979 / Oppiidae / Sarcoptiformes | Acariformes |
| 288 | (229/278) | 82.4 | KF966651 Penthaleidae sp. Q080 / Penthaleidae / Trombidiformes | Acariformes |
| 44 | (252/306) | 82.4 | HE651331 Compsoneuria sp. 6 LV-2012 / Heptageniidae / Ephemeroptera | |
| 43 | (261/317) | 82.3 | KY262520 Serratella ignita / Ephemerellidae / Ephemeroptera | |
| 42 | (247/300) | 82.3 | KJ964059 Melanophila acuminata / Buprestidae / Coleoptera | |
| 37 | (255/311) | 82.0 | KX038172 Zephlebia pirongia / Leptophlebiidae / Ephemeroptera | |
| 366 | (112/137) | 81.8 | KY698160 Cladius grandis / Tenthredinidae / Hymenoptera | wasp |
| 260 | (250/307) | 81.4 | MH976580 Eoschizopera sp. n. aff. syltensis SR-2019 / Miraciidae / Harpacticoida | copepod |
| 338 | (245/301) | 81.4 | EU681393 Bachelotia antillarum / / | alga |
| 75 | (244/300) | 81.3 | KY428239 Hexachaeta eximia / Tephritidae / Diptera | |
| 328 | (230/283) | 81.3 | MT380098 Megastigmus sp. 8 NHL-2020 / Megastigmidae / Hymenoptera | wasp |
| 35 | (245/302) | 81.1 | MN961290 Ephemera strigata / Ephemeridae / Ephemeroptera | |
| 313 | (247/306) | 80.7 | MN348626 Mucronothus sp. BOLD:AAL6084 / Trhypochthoniidae / Sarcoptiformes | Acariformes |
| 258 | (244/303) | 80.5 | MN745842 Ctenocalanus citer / Calanidae / Calanoida | copepod |
| 325 | (225/281) | 80.1 | KY492523 Stelligera rigida / Hemiasterellidae / Tethyida | sponge |
| 314 | (224/280) | 80.0 | HQ948517 Elachista discina / Elachistidae / Lepidoptera | moth |
| 326 | (238/299) | 79.6 | KR245768 Phronia sp. BOLD:ACL1048 / Mycetophilidae / Diptera | |
| 257 | (241/303) | 79.5 | MG936104 Harpacticoida sp. 11AlgonqNJ0018 / / Harpacticoida | copepod |
| 261 | (241/304) | 79.3 | KM611754 Cyclopoida sp. BOLD:AAG9785 / / Cyclopoida | copepod |
| 287 | (241/304) | 79.3 | MG320138 Tiphys sp. 09PROBE-02368 / Pionidae / Trombidiformes | Acariformes |
| 309 | (241/307) | 78.5 | MF917435 Suctobelbidae sp. BIOUG20423-H02 / Suctobelbidae / Sarcoptiformes | Acariformes |
| 329 | (243/310) | 78.4 | MK833920 Demospongiae sp. DGM-2019 / / | sponge |
| 310 | (246/314) | 78.3 | MN356725 Ceratoppia sp. BOLD:ADH9191 / Ceratoppiidae / Sarcoptiformes | Acariformes |
| 315 | (242/309) | 78.3 | KX651129 Dendrobaena octaedra / Lumbricidae / Crassiclitellata | Oligochaeta |
| 368 | (217/279) | 77.8 | KX281460 Stigmella sp. FicusauriculataVietnam / Nepticulidae / Lepidoptera | moth |
| 364 | (232/299) | 77.6 | HQ708994 Pythium vanterpoolii / Pythiaceae / Pythiales | fungus |
| 323 | (224/293) | 76.5 | HM033152 Rhodymenia stenoglossa / Rhodymeniaceae / Rhodymeniales | red alga |
| 365 | (221/295) | 74.9 | MN116495 Beybienkonus acuticercus / Corydiidae / Blattodea | cockroach |
| 369 | (217/302) | 71.9 | KY264161 Thaumamermis zealandica / Mermithidae / Mermithida | nematoda |
Species showing high similarity scores (>95%) but not recorded from Japan.
2. Experimental Design, Materials and Methods
2.1. Collection of specimens
Benthic organisms were collected using a hand net (mesh size: 200 per inch) in a perturbed riverbed by kicking at two sampling stations: ARD (on 17 March 2017) and SST (on 29 June 2017). Sampling was performed in the run environment (slow riffle) of both stations ARD and SST, and in rapid environment of SST (three community samples in total). The specimens were immersed in 70% ethanol until DNA was isolated. DNA of the three bulk community samples (one from ARD and two from SST) were separately extracted using conventional proteinase K treatment/phenol extraction/ethanol precipitation, as previously described [3].
2.2. DNA sequencing
The DNA libraries for sequencing were constructed by 2-step tailed PCR. The first PCR amplifications of the target gene (partial coding region of cox1) were performed using PrimeSTAR® HS DNA Polymerase (Takara Bio Co. Ltd., Kusatsu, Japan) for 35 cycles of 98°C-10 s / 40°C-5 s / 72°C-60 s with an initial incubation at 95°C for 1 min and a final elongation at 72°C for 7 min, using a set of primers IntF and HCOm [2]. The nucleotide sequences of the primers (containing the linker for the second PCR) were as follows:
IntF, ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGWACWGGWTGAACWGTWTAYCCYCC;
HCOm, GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAHACTTCNGGGTGKCCRAARAATCA.
The amplified fragments were purified by AMPure XP (Beckman Coulter, Brea, CA, USA). The second PCR was performed using ExTaq® DNA Polymerase (Takara Bio Co. Ltd.) for 12 cycles of 94°C-30 s / 60°C-30 s / 72°C-30 s with an initial incubation at 94°C for 2 min and a final elongation at 72°C for 5 min, with a set of DNA primers containing octanucleotide tag for indexing. The nucleotide sequences of primers were as follows:
2nd-F, AATGATACGGCGACCACCGAGATCTACAC-[octanucleotide tag]-ACACTCTTTCCCTACACGACGC;
2nd-R, CAAGCAGAAGACGGCATACGAGATTAGCTGCAGTGACTGGAGTTCAGACGTGTG.
Two technical replicates for ARD and three technical replicates for each of two SST samples were prepared with different tags. The tag sequences for DRR311861, DRR311862, DRR311863, DRR311864, DRR311865, DRR311866, DRR311867, and DRR311868 were TCGACTAG, TTCTAGCT, CCTAGAGT, GCGTAAGA, CTATTAAG, AAGGCTAT, GAGCCTTA, and TTATGCGA, respectively. Quality of the DNA libraries was assessed by Fragment Analyzer with dsDNA 915 Reagent Kit (Agilent Technologies, Santa Clara, CA, USA). High-throughput parallel sequencing was performed by Miseq (Illumina, San Diego, CA, USA) capable of generating 2 × 300 base paired-end reads. The library construction (after the first PCR) and sequencing were outsourced to Seibutsu Giken Co. Ltd. (Sagamihara, Japan) (https://gikenbio.com/).
2.3. Operational Taxonomic Units
Among the raw sequence reads (472,697 reads in total of DRR311861-DRR311868), reads with quality scores less than 20 were discarded, and those of the 313 bp net length of paired sequences were sorted out. Valid sequences (227,467 reads) were collapsed into 41,010 groups with 100% identity, and the groups consisting of less than three reads were discarded. Neighbouring groups with a single nucleotide difference were combined each other to form an OTU, and a sequence with the largest number of reads within the OTU was defined as the OTU representative sequence. A total of 888 OTUs were obtained and subjected to GMYC analysis. The R script used to produce OTUs and OTU representatives in FASTA format are deposited in Mendeley Data (DOI:10.17632/pfhf4kt37s.1).
Fig. 1.
Continued
2.4. Estimation of GMYC species
A phylogenetic tree of 888 OTUs was reconstructed using Markov chain Monte Carlo (MCMC) methods by MrBayes 3.2.7a with the GTR+I+G molecular clock model. GMYC species boundaries were estimated using SPLITS package in R.
CRediT authorship contribution statement
Kei Wakimura: Investigation, Writing – original draft. Koji Inai: Software, Investigation. Kazumi Tanida: Resources, Writing – review & editing. Kozo Watanabe: Conceptualization, Writing – review & editing, Funding acquisition. Mikio Kato: Project administration, Conceptualization, Resources, Writing – review & editing, Funding acquisition.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
This work was supported in part by the Japan Society for the Promotion of Science (JSPS) KAKENHI (Grant Numbers 17K07541 to M.K. and 19H02276 to K.W.).
Data Availability
Operational taxonomic units of cox1 amplified from bulk community DNA samples in Takamigawa River, Nara, Japan (Original data) (Mendeley Data).
cox1 amplicon sequences of riverine metagenomes (Original data) (DDBJ (DNA Data Bank of Japan)).
References
- 1.Inai K., Wakimura K., Kato M. Pairwise sequence comparison data of the DNA barcodes of aquatic insects. Data Brief. 2020;32 doi: 10.1016/j.dib.2020.106284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Leray M., Yang J.Y., Meyer C.P., Mills S.C., Agudelo N., Ranwez V., Boehm J.T., Machida R.J. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents. Front. Zool. 2013;10:34. doi: 10.1186/1742-9994-10-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wakimura K., Takemon Y., Ishiwata S.-I., Tanida K., Abbas E.M., Inai K., Taira A., Tanaka A., Kato M. A reference collection of Japanese aquatic macroinvertebrates. Ecol. Genet. Genom. 2020;17 doi: 10.1016/j.egg.2020.100065. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Operational taxonomic units of cox1 amplified from bulk community DNA samples in Takamigawa River, Nara, Japan (Original data) (Mendeley Data).
cox1 amplicon sequences of riverine metagenomes (Original data) (DDBJ (DNA Data Bank of Japan)).