Skip to main content
NCBI home page
Fish and Shellfish Immunology Reports logoLink to Fish and Shellfish Immunology Reports
. 2022 Aug 15;3:100064. doi: 10.1016/j.fsirep.2022.100064

The expression profile of a multi-stress inducible transient receptor potential vanilloid 4 (TRPV4) in Pacific oyster Crassostrea gigas

Zhaoyu He a,b,c, Chuanyan Yang a,b,c,⁎, Dongli Jiang a,b,c, Xiangbo Wang a,b,c, Zhen Xing a,b,c, Simiao Yu a,b,c, Qian Yang a,b,c, Lingling Wang a,b,c,⁎⁎
PMCID: PMC9680104  PMID: 36419610

Highlights

  • 1

    CgTRPV4 with typical structural characteristics was indentified from Crassostrea gigas.

  • 2

    CgTRPV4 was located in both endoplasmic reticulum and cytoplasmic membrane of oyster haemocytes.

  • 3

    CgTRPV4 mRNA was ubiquitously expressed with the highest level in gill.

  • 4

    The expression of CgTRPV4 mRNA was significantly up-regulated after high temperature stress at 30°C or V. splendidus stimulation.

Keywords: Crassostrea gigas, Transient receptor potential vanilloid 4, Expression profile, High temperature stress, Vibrio splendidus stimulation

Abstract

Transient receptor potential vanilloid 4 (TRPV4) is one of the major non-selective cation channel proteins, which plays a crucial role in sensing biotic and abiotic stresses, such as pathogen infection, temperature, mechanical pressure and osmotic pressure changes by regulating Ca2+ homeostasis. In the present study, a TRPV4 homologue was identified in Pacific oyster Crassostrea gigas, designated as CgTRPV4. The open reading frame (ORF) of CgTRPV4 was of 2298 bp encoding a putative polypeptide of 765 amino acid residues with three typical ankyrin domains and six conserved transmembrane domains of TRPV4 subfamily proteins, as well as multiple N-glycosylation sites, cAMP- and cGMP-dependent protein kinase phosphorylation sites, protein kinase C phosphorylation sites, casein kinase II phosphorylation sites, and prokaryotic membrane lipoprotein lipid attachment site. The deduced amino acid sequence of CgTRPV4 shared 20.5%-26.2% similarity with TRPV4s from other species. During the early ontogenesis stages of oyster, the mRNA transcripts of CgTRPV4 were detectable in all the stages with the highest expression level in fertilized eggs and the lowest in D-hinged larvae. In adult oyster, the CgTRPV4 mRNA could be detected in all the examined tissues, including gill, hepatopancreas, adductor muscle, labial palp, mantle and haemocyte, with the highest expression level in gill (45.08-fold of that in hepatopancreas, p < 0.05). In immunocytochemical assay, the CgTRPV4 positive signals were distributed in both endoplasmic reticulum and cytoplasmic membrane of oyster haemocytes. The mRNA expression of CgTRPV4 in gill was significantly up-regulated after high temperature stress at 30°C (p < 0.05) and after Vibrio splendidus stimulation (p < 0.05). These results indicated that CgTRPV4 was a classical member of TRPV4 family in oyster, which was induced by either biotic or abiotic stimulations and involved in mediating the stress response of oysters.

1. Introduction

Transient receptor potential (TRP) channel is a class of non-selective cation channel proteins containing six transmembrane domains, and forms ion channels in the form of homologous or heterotetramers to regulate intracellular calcium homeostasis [1]. According to different structural characteristics, TRP superfamily can be divided into seven subfamilies, including TRPC (C stands for canonical or classical), TRPV (V stands for the vanilloid receptor), TRPM (M stands for melastatin), TRPA (A stands for the protein denoted ankyrin-like with transmembrane domains), TRPP (P stands for polycystin), TRPN (N stands for the no mechanoreceptor potential C) and TRPML (ML stands for mucolipin) subfamily [1]. The TRPV subfamily is named for its ability to be activated by chemicals containing vanilloid groups. By far, a total of six subfamily members have been identified (named TRPV1–6), among which TRPV4 is mostly studied.

Studies in model animals including mouse, human, nematode and fruit fly have shown that TRPV4 plays vital roles in sensing biotic stresses (such as pathogenic bacteria) and abiotic stresses (such as temperature, mechanical pressure, chemical pressure, and osmotic pressure) [2]. The classical TRPV4 is consisted of a conserved six transmembrane helical domain at the C-terminal and three to five ankyrin repeats (ANK) domains at the N-terminal [3], in which the latter ANK domain plays an important role in the assembly and transportation of TRPV4 [4], and determines the sensitivity of TRPV4 channel [5,6]. In mammalian, TRPV4 is broadly expressed in various tissues such as heart, arteries, lung, skin, bone, brain, urinary bladder, kidney, intestine, liver and pancreas, as well as in a wide range of cells such as neuron cells, epidermal cells, macrophages, and muscle cells [7], [8], [9], [10], [11], [12]. The TRPV4 in different types of cells may play different functions in a variety of physiological and biochemical processes, such as signal transduction between neuron cells, endoplasmic reticulum (ER) stress, lipid peroxidation, inflammatory response, phagocytosis, and so on [13], [14], [15], [16]. Compared to the vast knowledge on TRPV4 channel regulation, little is known about the induction mechanism of TRPV4 transcription [17].

Compared with the relatively in-depth research in model animals, the research on TRPVs in aquatic animals is very limited, mainly focusing on the identification of fish and shellfish TRPV subfamily members and analysis of their expression levelunder osmotic pressure [[18], [19], [20], [21], [22], [23], [26]], mechanical pressure [19,24], and temperature stress [23,25,26]. At present, TPRV4s have been identified in zebra fish Danio rerio, half-smooth tongue sole Cynoglossus semilaevis, chum salmon Oncorhynchus keta, tilapia Oreochromis mossambicus, sea bass Dicentrarchus labrax, and Pacific oyster Crassostrea gigas [18], [19], [20], [21], [22], [23], [24], [25], [26]. Similar to their homologues in mammals, aquatic TRPV4s all harbor typical six transmembrane domains and three ANK domains [18], [19], [20], [21], [22], [23], [24], [25], [26]. The DrTRPV4 is expressed in various sensory cells of Danio rerio such as retinal cells, ciliated sensory neurons, lateral line cells, and many tissues such as brain, kidney and heart, and its expression is affected by external osmotic pressure, drugs and other factors [19], [20], [21], [22]. The OlTRPV4 can be activated by agonist GSK1016790A, hypotonic solution, and temperature (cold and hot) stimulation [23]. DlTRPV4 and CsTRPV4 is involved in sensing osmotic pressure and mechanical stimulation, respectively [22,24]. The expression level of CgTRPV4.7 mRNA in gill was higher than in other tissues, which can be induced by high temperature stress [25]. Interestingly, OkTRPV4 generates two transcript variants through alternative splicing, TRPV4 x1 and TRPV x2, and their expression levels significantly increased with the increase of salinity and temperature and the decrease of temperature, respectively [26]. However, the functional characters and regulation mechanism of TRPV4s in aquatic animals especially in lower aquatic invertebrates under various stressors are still not clear.

The Pacific oysters C. gigas, a typical representative of intertidal organisms, have to cope with a series of biotic threats such as pathogens, and has been regarded as an attractive experimental model for studying the mechanism of environmental adaptation [27,28]. Timely sensing various stresses and triggering signaling pathways to induce the transcription of a variety of immune effectors may one of the important adaptation mechanisms for oyster C. gigas. Considering the important role of TRPV4s in sensing biotic and abiotic stresses and regulating the calcium homeostasis, a TRPV4 was identified from oyster C. gigas (CgTRPV4) in the present study with the objectives to clarify its structural characteristics and investigate its expression profile under various stresses.

2. Materials and methods

2.1. Oysters and sample collection

All experiments were performed in accordance with the approval and guidelines of the Ethics Review Committee of Dalian Ocean University.

Two-year-old Pacific oysters C. gigas with an average shell length of 12–14 cm were collected from a commercial farm in Dalian, China. They were cultured in aerated seawater at 16°C for seven days and fed with diatom once a day before following experiments. Tissues including gill, muscle, labial palp, hepatopancreas and mantle were collected from six oysters as parallel samples, and haemolymph from these oysters was extracted and centrifuged at 800 × g, 4°C for 10 min to harvest the haemocyte. After addition of 1 mL Trizol reagent (Invitrogen), all the samples were stored at -80°C for further RNA extraction.

2.2. RNA extraction, gene cloning and sequence analysis of CgTRPV4

Total RNA isolation, cDNA synthesis and gene cloning were performed according to the previous reports [29]. The primers of CgTRPV4-F and CgTRPV4-R (Table 1) were designed according to the sequence information of CgTRPV4 (GenBank accession No. XM_034442984.1). The PCR product was gel-purified, cloned into pMD19-T simple vector (Takara), and confirmed by DNA sequencing.

Table. 2.

Sequences used for the CgTRPV4 alignment and phylogenetic analysis.

Protein name Organism Accession number
TRPV4 Homo sapiens XP_011536936.2
TRPV4 Mus musculus XP_011246537.1
TRPV4 Gallus gallus NP_990023.2
TRPV4 Xenopus tropicalis XP_002932129.1
TRPV4 Physeter catodon XP_028336047.1
TRPV4 Danio rerio XP_005165208.1
TRPV4 Larimichthys crocea XP_019130016.1
TRPV4 Oncorhynchus mykiss XP_021476679.1
TRPV4 Salmo salar XP_014016243.1
TRPV4 Monopterus albus XP_020449937.1
TRPV4 Trichinella spiralis KRZ95620.1
TRPV4 Crassostrea gigas XP_034298875.1
Open in a new tab

Table. 1.

Sequences of the primers used in the test.

Primer name Primer Sequence (5′-3′)
Primers for gene CgTRPV4 (Accession number XM_034442984.1)
CgTRPV4-ANK-F ATGGAATCTTATCCATATAACCAA
CgTRPV4-ANK-R ATTTGAAATGCTTCTTTACGAGTA
CgTRPV4-ANK-EX-F CGCCATATGATGGAGTTTTATCAGTATAA
CgTRPV4-ANK-EX-R CCCAAGCTTATTTGAAATGCTTCTGTATGA
CgTRPV4-ANK-RT-F CCATCTCAACCCAAAACCAGG
CgTRPV4-ANK-RT-R GCAGATAATCGGAGTGGTGTC
Primers for gene CgEF-α (Accession number NM_001305313.2)
Cg-EF-α-RT-F AGTCACCAAGGCTGCACAGAAAG
Cg-EF-α-RT-R TCCGACGTATTTCTTTGCGATGT
Open in a new tab

The conserved domains ofCgTRPV4 were predicted using the simple modular architecture research tool (SMART) (http://smart.embl-heidelberg.de/), and the conserved domain database (CDD) (https://www.ncbi.nlm.nih.gov/cdd). The amino acid sequence analyses were carried out using the BLAST algorithm (http://www.ncbi.nlm.nib.gov/BLAST). Multiple sequence alignments were conducted using the Cluster X 1.81 program. The molecular weight and hydrophobicity of CgTRPV4 were predicted using the ProtParam Tool (https://web.expasy.org/protparam/). The secondary structure was predicted using the SOPMA (https://npsa-prabi.ibcp.fr/NPSA/npsa_sopma.html). The N-glycosylation site, cAMP- and cGMP-dependent protein kinase phosphorylation site, Protein kinase C phosphorylation site, Casein kinase II phosphorylation site and Prokaryotic membrane lipoprotein lipid attachment site were predicted using the SoftBerry-Psite (http://linux1.softberry.com/berry.phtml?topic=psite&group=programs&subgroup=proloc). The neighbor-joining (NJ) phylogenetic tree of CgTRPV4 was constructed using MEGA 6.0 software. Bootstrap trials were replicated 1000 times to derive the confidence value for phylogeny analysis [24].

2.3. Detection of CgTPRV4 mRNA transcripts in different developmental stages of oyster larvae using quantitative real-time PCR (qRT-PCR)

All embryos and larvae were sampled from the Yipintang farm in Dalian, Liaoning Province, China in May, 2022 as previously described [30]. Briefly, the embryo or larvae at different stages were identified microscopically and collected as fertilized eggs, 4-cell embryos, 8-cell embryos, morula (6 h post-fertilization, hpf), blastula (11 hpf), gastrula (18 hpf), trochophore (22 hpf), D-hinged larvae (2 day post-fertilization, dpf). For each developmental stage, six aliquot samples were collected, re-suspended in 1 mL Trizol reagent (Invitrogen), and stored in liquid nitrogen immediately. RNA isolation and cDNA synthesis were carried out as described above. The cDNA mix was diluted to1:100 and stored at -80°C for subsequent SYBR Green qRT-PCR.

The mRNA transcripts of CgTPRV4 in different tissues were analyzed by SYBR Green qRT-PCR. All reactions were performed as previously described [31]. The information of the gene specific primers for CgTRPV4 (CgTRPV4-RTFand CgTRPV4-RTR) and CgEF-α (CgEF-α-RTF and CgEF-α-RTR) used in the qRT-PCR was shown in Table 1. The expression of CgTPRV4 was normalized to that of the elongation factor α (CgEF-α) gene (GenBank accession No. NM_001305313.2) for each sample, and the relative expression levels of CgTRPV4 were analyzed using the comparative Ct method (2−△△Ct method) [31,32].

2.4. Detection of CgTPRV4 mRNA transcripts in different tissues of adult oysters using qRT-PCR

The mRNA transcripts of CgTPRV4 in different tissues were analyzed by SYBR Green qRT-PCR. The SYBR Green qRT-PCR was carried out, and the relative expression level of CgTRPV4 was analyzed as previously described [31,32].

2.5. Recombinant expression and polyclonal antibody preparation of CgTPRV4

Recombinant protein of CgTRPV4 fused with GST tag was expressed in Escherichia coli using the pCold™-GST DNA vector (Takara). The cDNA sequence encoding the ANK domains of CgTRPV4 was amplified using gene specific primers rCgTRPV4-ANK-F and rCgTRPV4-ANK-R (Table 1) with restriction enzyme sites Nde I and Hind III. The PCR products were digested, gel-purified, and ligated into the expression vector pCold-GST (Takara). The recombinant plasmids pCold™-GST-CgTRPV4-ANK were extracted and transformed into E. coli Transetta (DE3). The positive transformants were cultured in LB medium and induced using Isopropyl β-D-1-Thiogalactopyranoside (IPTG), and the cell lysates were separated using SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The purification of the recombinant protein of CgTRPV4 (designated rCgTRPV4) and the purity and concentration analysis of rCgTRPV4 were performed as previously described [30].

To prepare polyclonal antibody, the purified rCgTRPV4-ANK was subcutaneously stimulated six-week-old female mice according to the previous description [30]. The anti-rCgTRPV4 serum was stored at -80°C for subsequent experiments.

2.6. Western blot analysis

Proteins were extracted from haemocytes of oysters as previous described [33]. The specificity of polyclonal antibody against endogenous CgTRPV4 in haemocytes was examined using Western blot analysisas previously described [30]. The proteins extracted from haemocytes were separated using 15% SDS-PAGE. The antibodies against rCgTRPV4 (1:1000 dilution) and the HRP-conjugated goat anti-mouse (1:2000 dilution, Sangon Biotech) were used as primary and secondary antibodies, respectively. The western lighting ECL substrate system (Thermo Scientific) was used to detect the immune-blotted protein bands of CgTRPV4. The results were visualized using a chemiluminescent imaging system (Amersham Imager 600).

2.7. Immunofluorescence assay

Immunofluorescence assay was carried out to investigate the subcellular localization of CgTRPV4 in haemocytes as previously described with some modification [34]. The haemocytes were collected from five oysters, re-suspended in L15 cell culture media, deposited on dishes precoated with poly-Lysine (a drop on each) in the wet chamber, and fixed with 4% paraformaldehyde. After blocked with 3% bovine serum albumin (BSA) at room temperature for 30 min, the samples were incubated with anti-rCgTRPV4 (diluted 1:1000 (v/v) in 3% BSA) antibody at 37°C for 1 h. Alexa Fluor 488-conjugated goat anti-mouse IgG (Sangon, diluted 1:1500 in 3% BSA) was used separately to incubate with the samples at 37°C for 1 h. ER-Tracker Red (Beyotime, diluted 1:1500 in 3% BSA) and Dil (Beyotime, diluted 1:1000 in 3% BSA) were used to incubate with the samples to stain ER or the membrane. After incubated with 4, 6-diamidino-2-phenylindole hydrochloride (DAPI, diluted at 1:500 with 3% BSA) for 10 min to stain the nuclei, fluorescent images of the oyster haemocytes were obtained using a Laser Scan Confocal Microscope (ZEISS).

2.8. Analysis of CgTPRV4 mRNA expression under different temperature using qRT-PCR

The different temperature treatment was performed by transferring 60 oysters from aerated seawater at 16°C to aerated seawater at 22°C, 26°C, 30°C and 34°C. Nine oysters were sampled from each group at 12 h post-treatment, and the gill collected from three individuals were pooled together as one sample, and there were three samples for each time point. Nine untreated oysters were used as blank samples. The SYBR Green qRT-PCR was carried out, and the relative expression level of CgTRPV4 was analyzed as previously described [30,31].

2.9. Analysis of CgTPRV4 mRNA expression after Vibrio splendidus stimulation using qRT-PCR

The V. splendidus stimulation experiment was performed as previously described [35]. Briefly, the oysters were sawed a narrowed notch in the oyster shell adjacent to the adductor muscle, and then were acclimated for one week. Seventy oysters were equally separated into two groups. The oysters in two groups received a 100 μL injection of sterile seawater and V. splendidus (1 × 109 CFU mL−1) into the adductor muscle, respectively. Afterwards, nine oysters were sampled from each group at 0, 6 and 12 h post-injection, and the gill collected from three individuals were pooled together as one sample, and there were three samples for each time point. The SYBR Green qRT-PCR was carried out, and the relative expression level of CgTRPV4 was analyzed as previously described [30,31].

2.10. Statistical analysis

All data were analyzed using ANOVA followed by a multiple comparison. The results were given as mean ± SD (N ≥ 4), and statistically significant difference was designated at p < 0.05.

3. Results

3.1. Molecular characteristics and phylogenetic evolution of CgTRPV4

The open reading frame (ORF) of CgTRPV4 was of 2298 bp, encoding a polypeptide of 765 amino acid residues with anisoelectric point (pI) of 8.52 and molecular weight (MW) of 89.3 kDa. There were three typical ANK domains and six transmembrane domains in CgTRPV4 (Fig. 1). Furthermore, there were seven N-glycosylation sites (NTNR138–141, NKSG250–253, NCTR327–330, NETT388–391, NRSV667–670, NDTL710–713, NKSS751–754), two cAMP- and cGMP-dependent protein kinase phosphorylation sites (KRKT724–727, KKSS731–734), ten protein kinase C phosphorylation sites (SLR5–7, TLR35–37, TGK149–151, STK239–241, SAK260–262, TRK329–331, SVR669–671, TDR672–674, TKR723–725, SSK733–735), nine casein kinase II phosphorylation sites (TESE102–105, TEFD297–300, SHTE304–307, SILE318–321, SVFD322–325, TRKE329–332, TTIE374–377, STME688–691, TNPE736–739), and one prokaryotic membrane lipoprotein lipid attachment site (QLPLSAAALAC161–171), identified in CgTRPV4 (Fig. 1).

Fig. 1.

Fig 1

Open in a new tab

Nucleotide, deduced amino acid sequence and protein domain of CgTRPV4. (A) The nucleotide and deduced amino acid sequence of CgTRPV4. The nucleotides and amino acid sequences are numbered along the left margin. The ANK domains and six transmembrane domains are marked with green and blue shadow. The Casein kinase II phosphorylation sites are marked by red letter. The N-glycosylation sites are marked by blue letter. The cAMP- and cGMP-dependent protein kinase phosphorylation sites are marked by green letter. The prokaryotic membrane lipoprotein lipid attachment site is marked by pink letter. (B) The domain structure of CgTRPV4 analyzed by the SMART analysis and the CDD analysis.

Multiple sequence alignment revealed that CgTRPV4 shared low similarity with TRPV4s from other organisms, including Trichinella spiralis (KRZ95620.1, 20.5%), Homo sapiens (XP_011536936.2, 21.3%), Mus musculus (XP_011246537.1, 22.8%), Physeter catodon (XP_028336047.1, 25.4%), Monopterus albus (XP_020449937.1, 25.7%), Larimichthys crocea (XP_019130016.1, 26.0%), Xenopus tropicalis (XP_002932129.1, 26.0%), Danio rerio (XP_005165208.1, 26.1%), Salmo salar (XP_014016243.1, 26.1%), Gallus gallus (NP_990023.2, 26.1%), and Oncorhynchus mykiss (XP_021476679.1, 26.2%). However, the ANK domains (27.1%-31.6%) and transmembrane domains (28.0%-36.8%) of CgTRPV4 shared relatively higher similarity with their homologues from other organisms (Fig. 2).

Fig. 2.

Fig 2

Open in a new tab

Multiple sequence alignment of TRPV4s from invertebrate and vertebrate species. The identical amino acid residues of ANK domains (A) and transmembrane domains (B) of TRPV4s are shaded in black, and similar amino acids are shaded in dark gray. Sequence information of the TRPV4s is listed in Table 2.

The phylogenetic NJ trees were constructed to analyze the phylogenetic evolution of TRPV4s. Though CgTRPV4 shared similar domain composition with other selected TRPV4s from vertebrates (H. sapiens, M. musculus, P. catodon, G. gallus, L. crocea, M. albus, D. rerio, S.salar, O.mykiss and X. tropicalis) and invertebrate (T. spiralis), it showed relatively far evolutionary relationships with them (Fig. 3).

Fig. 3.

Fig 3

Open in a new tab

The Neighbor-joining tree ofCgTRPV4. The CgTRPV4 is marked with a triangle. Sequence information of the twelve TRPV4s is described in Table 2.

3.2. The mRNA expression of CgTRPV4 in different developmental stages

In order to elucidate the possible role of CgTRPV4 in the ontogenesis, its mRNA expression level in different development stages was monitored by qRT-PCR. The mRNA transcript of CgTRPV4 was detected in the development stages from fertilized eggs to D-hinged larvae with the highest expression level in fertilized eggs (Fig. 4). The expression level of CgTRPV4 decreased gradually in the following development stages and reached the lowest in D-hinged larvae (0.01-fold of that in fertilized eggs, p < 0.05) (Fig. 4).

Fig. 4.

Fig 4 The

Open in a new tab

The mRNA expression of CgTRPV4 in different development stages. The relative mRNA expression level of CgTRPV4 among different development stagesis normalized to that of CgEF-α, and the significant difference is indicated by different letters (a, b and c). Each value is shown as mean ± S.D. (N ≥ 4).

3.3. The distribution of CgTRPV4 mRNA in different tissues of adult oyster

The CgTRPV4 transcripts were detected in all the examined tissues, including hepatopancreas, mantle, gill, muscle, labial palp and haemocyte. The highest mRNA expression level of CgTRPV4 was detected in gill, which was 45.08-fold (p < 0.05) of that in the hepatopancreas (Fig. 5). The expression level of CgTRPV4 mRNA in mantle (19.09-fold, p < 0.05) was also significantly higher than that in the hepatopancreas (Fig. 5).

Fig. 5.

Fig 5

Open in a new tab

The distribution of CgTRPV4 mRNA in different tissues. The relative mRNA expression level of CgTRPV4 among different tissues is normalized to that of CgEF-α, and the significant difference is indicated by different letters (a, b and c). Each value is shown as mean ± S.D. (N ≥ 4).

3.4. The subcellular distribution of CgTRPV4 in haemocytes

The cDNA sequence encoding the ANK domains of CgTRPV4 was amplified and ligated into the pCold™-GST DNA vector (Fig. 6A). The recombinant plasmid (pCold-GST-CgTRPV4-ANK) was transformed into E. coli Transetta (DE3). After IPTG induction for 4 h, the whole cell lysate was analyzed by SDS-PAGE, and a distinct band about 55.2 kDa was revealed, which was consistent with the predicted molecular weight of fusion rCgTRPV4 with GST-tag (Fig. 6B, lane2). The rCgTRPV4 was further purified for preparing the polyclonal antibody (Fig. 6B, lane3). The antibody specificity of the anti-rCgTRPV4 was examined using endogenous protein of oyster haemocytes by Western blot analysis. A distinct immune-precipitated band with a molecular weight of approximately 89.30 kDa was revealed with a similar molecular weight predicted by the target sequence (Fig. 6C, lane1).

Fig. 6.

Fig 6 SDS-PAGE

Open in a new tab

SDS-PAGE and western blotting analysis of rCgTRPV4. (A) The domain structure of CgTRPV4 analyzed by the SMART analysis. (B) Lane M, protein molecular standard. Lane 1, negative control for rCgTRPV4 (without induction). Lane 2, induced rCgTRPV4. Lane 3, purified rCgTRPV4. (C) Lane M, protein molecular standard. Lane 1, western blot analysis of the polyclonal antibody against endogenous of CgTRPV4 in gill.

The subcellular distribution of CgTRPV4 in oyster haemocytes was detected using immunofluorescence assay. The morphology of the haemocytes was observed in a bright field, and the nucleus stained by DAPI was shown in blue fluorescence. The positive signals of CgTRPV4 labeled by FITC were indicated in green fluorescence, and both ER and cytoplasmic membrane labeled by ER-Tracker Red and Dil were indicated with red fluorescence. The co-localization of signals for CgTRPV4 (green) and ER (red) was observed (Fig. 7). The co-localization of positive green signals for CgTRPV4 and red signals for cytoplasmic membrane was also observable (Fig. 7), indicating that CgTRPV4 were located in ER and cytoplasmic membrane of oyster haemocytes.

Fig. 7.

Fig 7

Open in a new tab

Subcellular localization of CgTRPV4 in haemocytes of C. gigas. The nuclei of haemocytes stained by DAPI were shown in blue fluorescence. The positive signals of CgTRPV4 labeled by FITC were indicated in green fluorescence. Both ER and cytoplasmic membranes labeled by ER-Tracker Red and Dil were indicated in red fluorescence. Bar = 10 μm.

3.5. Temporal expression of CgTRPV4 mRNA in gill under different temperature

The expression profiles of CgTRPV4 in gill at 12 h after different temperature treatment (22°C, 26°C, 30°C and 34°C) were investigated using qRT-PCR. The mRNA transcripts of CgTRPV4 in gill were significantly up-regulated after high temperature stress at 30°C, which was 1.85-fold of that in the Blank group (p < 0.05). However, there was no significant difference between the blank group and the three experimental groups (22°C, 26°C and 34°C) (Fig. 8).

Fig. 8.

Fig 8

Open in a new tab

The temporal expression of CgTRPV4 mRNA in gill under different temperature. Relative expression levels of CgTRPV4 mRNA in gill were normalized to that of CgEF-α, and the significant difference is indicated by different letters (a and b). Each value is shown as mean ± S.D. (N ≥ 4).

3.6. Temporal expression of CgTRPV4 mRNA in gill after V. splendidus stimulation

The expression profiles of CgTRPV4 ingill after V. splendidus stimulation were investigated using qRT-PCR. Compared to the control group, the mRNA transcripts of CgTRPV4 were significantly up-regulated at 6 h after V. splendidus stimulation (3.07-fold of that in the control group, p < 0.05). There wasno significant difference between the control group and the V. splendidus stimulation group at 0 h and 12 h post-stimulation (Fig. 9).

Fig. 9.

Fig 9

Open in a new tab

The temporal expression of CgTRPV4 mRNA in gill after V. splendidus stimulation. Relative expression levels of CgTRPV4 mRNA in gill were normalized to that of CgEF-α, and the significant difference is indicated by different letters (a, and b). Each value is shown as mean ± S.D. (N ≥ 4).

4. Discussion

TRPV4 usually plays an important role in sensing biological and abiotic stresses, such as pathogen infection, temperature, mechanical and osmotic pressure changes by regulating Ca2+ homeostasis [1,2,17]. In the present study, one TRPV4 was identified from Pacific oyster, which was consisted of three typical ANK domains and six transmembrane domains. The similar domain composition and conserved six transmembrane helical domains identified at the C-terminal of CgTRPV4 and mammalian TRPV4s indicated that they might perform similar functions. Considering the important roles of ANK domain in the assemble and transportation of TRPV4 [3,4] as well as in determining the sensitivity of TRPV4 channel [5,6], the different number of ANK domains in CgTRPV4 and mammalian TRPV4s indicated that there might be some functional differentiation between them. It was reported that N-glycosylation and phosphorylation regulated TRP destination to the specialized structures [36], and the phosphorylation of (cGMP)-dependent kinase protein kinase phosphorylation sites would inactivate TRP [37], while the phosphorylation of Casein kinase II site would modulate the function of TRP [38]. In addition to the typical domains and motifs, there were seven N-glycosylation sites, two cAMP- and cGMP-dependent protein kinase phosphorylation sites, ten protein kinase C phosphorylation sites, nine casein kinase II phosphorylation sites, and one prokaryotic membrane lipoprotein lipid attachment site identified in CgTRPV4, suggesting that the activity of CgTRPV4 is subjected to complex and precise regulation. In the phylogenetic NJ tree, the invertebrate TRPV4s (CgTRPV4 and TsTRPV4) showed relatively far evolutionary relationships with TRPV4s from other vertebrates, and this was consistent with the results of multiple sequence alignment, which revealed that CgTRPV4 shared low similarity with TRPV4s from other organisms (20.5%-26.2%). The structural and evolutionary characteristics collectively suggested that CgTRPV4 was a typical member of the TRPV4 family in invertebrates, which might be involved in regulating Ca2+ homeostasis similar to their homologues in other species, and meanwhile, there might be a certain degree of variation in CgTRPV4.

TRPV4 is broadly expressed in various tissues and a wide range of cells in mammalian, and can be significantly regulated by either biotic or abiotic stimulations followed by the regulation of Ca2+ influx [[7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [18], [19], [20], [21], [22], [23], [24], [25], [26], [39]]. It is indicated that the mRNA expression profile of TRPV4 is associated with their physiological function. In order to further understand the potential function of CgTRPV4, its expression profile in different development stages, different tissues and subcellular component of oyster haemocytes was investigated. The mRNA transcripts of CgTRPV4 could be detected during the tested developmental stages with the highest level in fertilized eggs, and was significantly down-regulated from 4-cell embryos to D-hinged larvae. It was suspected that the higher level of CgTRPV4 transcripts in fertilized eggs might be endowed by parents for the capability of sensing stress. It has been demonstrated that the immune tissues and organs of bivalves usually begin to form in gastrula and mature in D-hinged larvae and veliger larvae [40,41]. The level of CgTRPV4 transcripts decreased along with the developmental stages, which may be explained by the observation that the sensory organs are not fully developed till D-hinged larvae. In the adult oysters, the CgTRPV4 mRNA was constitutively expressed in all the examined tissues, and this wide distribution profile was consistent with that of mammalian TRPV4s [7], [8], [9], [10], [11], [12]. Similar to CgTRPV4.7 with incomplete domain composition [25], the highest mRNA expression level of CgTRPV4 was also observed in gill, which function as the primarily sensitive tissue of molluscs responding to environmental stress [42,43]. These results indicated that TRPV4 might play a key role in resistance to environmental stress in oysters. The co-localization of CgTRPV4 signals with ER and cytoplasmic membrane were observable, indicating that CgTRPV4were located on both ER and cytoplasmic membrane of oyster haemocytes. This result was consistent with the subcellular localization of mouse TRPV4 [44], suggesting that CgTRPV4 might function as a Ca2+ channel in both cytoplasmic membrane and ER membrane of oysters. These results collectively suggested that CgTRPV4 might play a key role in resistance to environmental stress by regulating cytoplasmic Ca2+ homeostasis through channels on plasma membrane and ER membrane.

Accumulating evidences have shown that TRPV4 plays an important role in sensing both biotic and abiotic stresses [2]. In the present study, the expression profiles of CgTRPV4 mRNA under different temperature or after V. splendidus stimulation was investigated to deduce its potential function. The mRNA transcripts of CgTRPV4 in gill were significantly up-regulated after high temperature stress at 30°C, which favored the previous conclusion that TRPV4 is a temperature sensitive channel protein [2]. Similarly, the heat-induced mRNA expression of TRPV4s was also observed in other TRPV4s in aquatic animals, such as OlTRPV4 [23], CgTRPV4.7 [25] and OkTRPV4 [26]. However, there was no significant change after high temperature stress at 34°C, probably due to the different temperature activation threshold of the thermoTRPV channels (TRPV1–4). The previous studies indicated that TRPV1–4 could be activated by temperatures ranging from innocuous warmth (< 37°C) to noxious heat (> 50°C) in heterologous systems [2,23,25,26,45]. It is suspected that four TRPV1s and eight TRPV4s identified in oyster genome may be responsible for sensing different temperature range [25]. In addition, the mRNA transcripts of CgTRPV4 were significantly up-regulated at 6 h after V. splendidus stimulation. It was reported that the mammalian TRPV4 in different types of cells might play different functions in a variety of immune reaction, such as lipid peroxidation, inflammatory response, and phagocytosis [13], [14], [15], [16]. The TRPV4 in airway epithelial cells and macrophages can be activated by LPS stimulation, which triggered downstream protective responses and anti-inflammatory pathways [13,14]. Moreover, TRPV4 could protect lung from injury upon intratracheal Pseudomonas aeruginosa in mice through a novel mechanism of molecular switching of LPS signaling [46], and there was a significant increase in TRPV4 in the hippocampus of a depression mouse model induced by LPS [47]. These results indicated that CgTRPV4 might share a similar role in sensing both biotic and abiotic stresses with their homologues in other species.

In conclusion, CgTRPV4, a typical member of the TRPV4 family, was identified in Pacific oyster. The CgTRPV4 transcripts were constitutively expressed in all the examined tissues with the highest expression level in gill, and CgTRPV4 located in both ER and cytoplasmic membrane of oyster haemocytes. The expression level of CgTRPV4 mRNA in gill was significantly up-regulated after high temperature stress at 30°C or V. splendidus stimulation. All above results indicated that CgTRPV4 shared a similar role in sensing either biotic or abiotic stresses with their homologues in other species.

Declaration of Competing Interest

The authors have declared that no competing interests exist.

Acknowledgments

We are grateful to all the laboratory members for their technical advice and helpful discussions. This research was supported bythe National Key R&D Program (2018YFD0900601), a grant (No. 41961124009) from National Science Foundation of China, Liaoning Climbing Scholar, and the Distinguished Professor of Liaoning (XLYC1902012 to L. W.).

Contributor Information

Chuanyan Yang, Email: yangchuanyan@dlou.edu.cn.

Lingling Wang, Email: linglingwang@dlou.edu.cn.

References

  • 1.Voets T., Talavera K., Owsianik G., et al. Sensing with TRP channels. Nat. Chem. Biol. 2005;1(2):85–92. doi: 10.1038/nchembio0705-85. [DOI] [PubMed] [Google Scholar]
  • 2.Berrout J., Jin M., Mamenko M., et al. Function of transient receptor potential cation channel subfamily V member 4 (TRPV4) as a mechanical transducer in flow-sensitive segments of renal collecting duct system. J. Biol. Chem. 2012;287(12):8782–8791. doi: 10.1074/jbc.M111.308411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Nilius B., Owsianik G., Voets T., et al. Transient receptor potential cation channels in disease. Physiol. Rev. 2007;87(1):165–217. doi: 10.1152/physrev.00021.2006. [DOI] [PubMed] [Google Scholar]
  • 4.Garcia-Elias A., Berna-Erro A., Rubio-Moscardo F., et al. Interaction between the linker, pre-S1, and TRP domains determines folding, assembly, and trafficking of TRPV channels. Structure. 2015;23(8):1404–1413. doi: 10.1016/j.str.2015.05.018. [DOI] [PubMed] [Google Scholar]
  • 5.Phelps C.B., Wang R.R., Choo S.S., et al. Differential regulation of TRPV1, TRPV3, and TRPV4 sensitivity through a conserved binding site on the ankyrin repeat domain. J. Biol. Chem. 2010;285(1):731–740. doi: 10.1074/jbc.M109.052548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Potla R., Hirano-Kobayashi M., Wu H., et al. Molecular mapping of transmembrane mechanotransduction through the β1 integrin–CD98hc–TRPV4 axis. J. Cell Sci. 2020;133(20) doi: 10.1242/jcs.248823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Everaerts W., Nilius B., Owsianik G. The vanilloid transient receptor potential channel TRPV4: from structure to disease. Prog. Biophys. Mol. biol. 2010;103(1):2–17. doi: 10.1016/j.pbiomolbio.2009.10.002. [DOI] [PubMed] [Google Scholar]
  • 8.Rayees S., Joshi J.C., Tauseef M., et al. PAR2-mediated cAMP generation suppresses TRPV4-dependent Ca2+ signaling in alveolar macrophages to resolve TLR4-induced inflammation. Cell Rep. 2019;27(3):793–805. doi: 10.1016/j.celrep.2019.03.053. e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Liu N., Liu J.Y., Wen X.B., et al. TRPV4 contributes to ER stress: relation to apoptosis in the MPP+-induced cell model of Parkinson’s disease. Life Sci. 2020;261 doi: 10.1016/j.lfs.2020.118461. [DOI] [PubMed] [Google Scholar]
  • 10.Nazıroğlu M. A novel antagonist of TRPM2 and TRPV4 channels: carvacrol. Metab. Brain Dis. 2022;37(3):711–728. doi: 10.1007/s11011-021-00887-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bubolz A.H., Mendoza S.A., Zheng X.D., et al. Activation of endothelial TRPV4 channels mediates flow-induced dilation in human coronary arterioles: role of Ca2+ entry and mitochondrial ROS signaling. Am. J. Physiol. Heart Circ. Physiol. 2012;302(3):634–642. doi: 10.1152/ajpheart.00717.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Krüger J., Kunert-Keil C., Bisping F., et al. Transient receptor potential cation channels in normal and dystrophic mdx muscle. Neuromuscul. Disord. 2008;18(6):501–513. doi: 10.1016/j.nmd.2008.04.003. [DOI] [PubMed] [Google Scholar]
  • 13.Alpizar Y.A., Boonen B., Sanchez A., et al. TRPV4 activation triggers protective responses to bacterial lipopolysaccharides in airway epithelial cells. Nat. Commun. 2017;8(1):1–13. doi: 10.1038/s41467-017-01201-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Scheraga R.G., Abraham S., Niese K.A., et al. TRPV4 mechanosensitive ion channel regulates lipopolysaccharide-stimulated macrophage phagocytosis. J. Immunol. 2016;196(1):428–436. doi: 10.4049/jimmunol.1501688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dutta B., Arya R.K., Goswami R., et al. Role of macrophage TRPV4 in inflammation. Lab. Investig. 2020;100(2):178–185. doi: 10.1038/s41374-019-0334-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gao M.R., Han J., Zhu Y.F., et al. Blocking endothelial TRPV4-Nox2 interaction helps reduce ROS production and inflammation, and improves vascular function in obese mice. J. Mol. Cell. Cardiol. 2021;157:66–76. doi: 10.1016/j.yjmcc.2021.04.008. [DOI] [PubMed] [Google Scholar]
  • 17.Nilius B., Flockerzi V. Mammalian transient receptor potential (TRP) cation channels. Berlin, Germany. 2014 [PubMed] [Google Scholar]
  • 18.Seale A.P., Watanabe S., Breves J.P., et al. Differential regulation of TRPV4 mRNA levels by acclimation salinity and extracellular osmolality in euryhaline tilapia. Gen. Comp. Endocrinol. 2012;178(1):123–130. doi: 10.1016/j.ygcen.2012.04.020. [DOI] [PubMed] [Google Scholar]
  • 19.Amato V., Vina E., Calavia M.G., et al. TRPV4 in the sensory organs of adult zebrafish. Microsc. Res. Tech. 2012;75(1):89–96. doi: 10.1002/jemt.21029. [DOI] [PubMed] [Google Scholar]
  • 20.Watanabe S., Seale A.P., Grau E.G., et al. Stretch-activated cation channel TRPV4 mediates hyposmotically induced prolactin release from prolactin cells of mozambique tilapia Oreochromis mossambicus. Am. J. Physiol. Regul. 2012;302(8):1004–1011. doi: 10.1152/ajpregu.00632.2011. Integrative Comparative Physiology. [DOI] [PubMed] [Google Scholar]
  • 21.Mangos S., Liu Y., Drummond I.A. Dynamic expression of the osmosensory channel trpv4 in multiple developing organs in zebrafish. Gene Expr. Patterns. 2007;7(4):480–484. doi: 10.1016/j.modgep.2006.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bossus M., Charmantier G., Lorin-Nebel C. Transient receptor potential vanilloid 4 in the European sea bass Dicentrarchus labrax: a candidate protein for osmosensing. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2011;160(1):43–51. doi: 10.1016/j.cbpa.2011.04.014. [DOI] [PubMed] [Google Scholar]
  • 23.Hori S., Sakamoto N., Saitoh O. Cloning and functional characterization of medaka TRPV4. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022;267 doi: 10.1016/j.cbpa.2022.111182. [DOI] [PubMed] [Google Scholar]
  • 24.Shang X.M., Ma A.J., Wang X.A., et al. Isolation, characterization and expression analysis of TRPV4 in half-smooth tongue sole Cynoglossus semilaevis. J. Oceanol. Limnol. 2020;38(1):294–305. [Google Scholar]
  • 25.Fu H.R., Jiao Z.X., Li Y.J., et al. Transient receptor potential (TRP) channels in the Pacific Oyster (Crassostrea gigas): genome-wide identification and expression profiling after heat stress between C. gigas and C. angulata. Int. J. Mol. Sci. 2021;22(6):3222. doi: 10.3390/ijms22063222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lee H.J., Lee S.Y., Kim Y.K. Molecular characterization of transient receptor potential vanilloid 4 (TRPV4) gene transcript variant mRNA of chum salmon Oncorhynchus keta in response to salinity or temperature changes. Gene. 2021;795 doi: 10.1016/j.gene.2021.145779. [DOI] [PubMed] [Google Scholar]
  • 27.Zhang G.F., Fang X.D., Guo X.M., et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature. 2012;490(7418):49–54. doi: 10.1038/nature11413. [DOI] [PubMed] [Google Scholar]
  • 28.Wang L.L., Song X.R., Song L.S. The oyster immunity. Dev. Comp. Immunol. 2018;80:99–118. doi: 10.1016/j.dci.2017.05.025. [DOI] [PubMed] [Google Scholar]
  • 29.Wang W.L., Zhang T., Wang L.L., et al. A new non-phagocytic TLR6 with broad recognition ligands from Pacific oyster Crassostrea gigas. Dev. Comp. Immunol. 2016;65:182–190. doi: 10.1016/j.dci.2016.07.010. [DOI] [PubMed] [Google Scholar]
  • 30.Jia Z.H., Zhang T., Jiang S., et al. An integrin from oyster Crassostrea gigas mediates the phagocytosis toward Vibrio splendidus through LPS binding activity. Dev. Comp. Immunol. 2015;53(1):253–264. doi: 10.1016/j.dci.2015.07.014. [DOI] [PubMed] [Google Scholar]
  • 31.Wagner E.M. Monitoring gene expression: quantitative real-time rt-PCR. Lipoproteins and Cardiovascular Disease. 2013:19–45. doi: 10.1007/978-1-60327-369-5_2. [DOI] [PubMed] [Google Scholar]
  • 32.Song X.R., Wang X.T., Li L., et al. Identification two novel nacrein-like proteins involved in the shell formation of the Pacific oyster Crassostrea gigas. Mol. Biol. Rep. 2014;41(7):4273–4278. doi: 10.1007/s11033-014-3298-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Song Y., Song X.R., Zhang D., et al. An HECT domain ubiquitin ligase CgWWP1 regulates granulocytes proliferation in oyster Crassostrea gigas. Dev. Comp. Immunol. 2021;123 doi: 10.1016/j.dci.2021.104148. [DOI] [PubMed] [Google Scholar]
  • 34.Yang B., Jia Y.K., Jia Z.H., et al. The cyclin-dependent kinase 2 (CDK2) mediates hematopoiesis through G1-to–S transition in Chinese mitten crab Eriocheir sinensis. Dev. Comp. Immunol. 2018;81:156–166. doi: 10.1016/j.dci.2017.11.022. [DOI] [PubMed] [Google Scholar]
  • 35.Ge W.J., Huang S., Liu S.J., et al. A novel Adiponectin receptor (AdipoR) involved in regulating cytokines production and apoptosis of haemocytes in oyster Crassostrea gigas. Dev. Comp. Immunol. 2020;110 doi: 10.1016/j.dci.2020.103727. [DOI] [PubMed] [Google Scholar]
  • 36.Pertusa M., Madrid R. TRP Channels in Sensory Transduction. Springer; 2015. Modulation of TRP channels by N-glycosylation and phosphorylation; pp. 73–96. [Google Scholar]
  • 37.Yao X. Transient Receptor Potential Channels. 2007. TRPC, cGMP-dependent protein kinases and cytosolic Ca2+ [J] pp. 527–540. [DOI] [PubMed] [Google Scholar]
  • 38.Hu J.H., Bae Y.K., Knobel K.M., et al. Casein kinase II and calcineurin modulate TRPP function and ciliary localization. Mol. Biol. Cell. 2006;17(5):2200–2211. doi: 10.1091/mbc.E05-10-0935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.White T.A., Xue A.L., Chini E.N., et al. Role of transient receptor potential C3 in TNF-α–enhanced calcium influx in human airway myocytes. Am. J. Respir. Cell Mol. Biol. 2006;35(2):243–251. doi: 10.1165/rcmb.2006-0003OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tirapé A., Bacque C., Brizard R., et al. Expression of immune-related genes in the oyster Crassostrea gigas during ontogenesis. Dev. Comp. Immunol. 2007;31(9):859–873. doi: 10.1016/j.dci.2007.01.005. [DOI] [PubMed] [Google Scholar]
  • 41.Haszprunar G., Wanninger A. Molluscs. Curr. Biol. 2012;22(13):510–514. doi: 10.1016/j.cub.2012.05.039. [DOI] [PubMed] [Google Scholar]
  • 42.Jemaà M., Morin N., Cavelier P., et al. Adult somatic progenitor cells and hematopoiesis in oysters. J. Exp. Biol. 2014;217(17):3067–3077. doi: 10.1242/jeb.106575. [DOI] [PubMed] [Google Scholar]
  • 43.Kim B.M., Kim K., Choi I.Y., et al. Transcriptome response of the Pacific oyster, Crassostrea gigas susceptible to thermal stress: a comparison with the response of tolerant oyster. Mol. Cell. Toxicol. 2017;13(1):105–113. [Google Scholar]
  • 44.Li M.Q., Zhang C.S., Zong Y., et al. Transient receptor potential V channels are essential for glucose sensing by aldolase and AMPK. Cell Metab. 2019;30(3):508–524. doi: 10.1016/j.cmet.2019.05.018. e12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Pumroy R.A., Fluck E.C., III, Ahmed T., et al. Structural insights into the gating mechanisms of TRPV channels. Cell Calcium. 2020;87 doi: 10.1016/j.ceca.2020.102168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Scheraga R.G., Abraham S., Grove L.M., et al. TRPV4 protects the lung from bacterial pneumonia via MAPK molecular pathway switching. J. Immunol. 2020;204(5):1310–1321. doi: 10.4049/jimmunol.1901033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Li W., Xu Y., Liu Z.H., et al. TRPV4 inhibitor HC067047 produces antidepressant-like effect in LPS-induced depression mouse model. Neuropharmacology. 2021;201 doi: 10.1016/j.neuropharm.2021.108834. [DOI] [PubMed] [Google Scholar]

Articles from Fish and Shellfish Immunology Reports are provided here courtesy of Elsevier

RESOURCES