Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Nov 23.
Published in final edited form as: Stem Cell Res. 2022 Jul 11;63:102855. doi: 10.1016/j.scr.2022.102855

Generation of human induced pluripotent stem cell lines carrying heterozygous PLN mutation from dilated cardiomyopathy patients

Arianne Caudal a,b, Gema Mondejar-Parreño a,b, Carlos D Vera a,b, Damon R Williams a,b, Sushma P Shenoy a,b, David Liang c, Joseph C Wu a,b,c,*
PMCID: PMC9681708  NIHMSID: NIHMS1827839  PMID: 35853412

Abstract

Familial dilated cardiomyopathy (DCM) is among the most prevalent forms of inherited heart disease. Here, two human-induced pluripotent stem cell (iPSC) lines were generated from peripheral blood mononuclear cells (PBMCs) from DCM patients carrying different mutations in the phospholamban encoding-gene (PLN). Both iPSC lines exhibited normal morphology, karyotype, pluripotency marker expression, and differentiation into the three germ layers. These patient-specific iPSC lines serve as valuable in vitro models for DCM pathology caused by PLN mutations.

Keywords: iPSC, Stem cell, Dilated cardiomyopathy, Phospholamban

1. Resource table

Unique stem cell lines identifier 1. SCVIi049-A
2. SCVIi050-A
Alternative name(s) of stem cell lines 1. SCVIi049-A / SCVI104
2. SCVIi050-A / SCVI2486
Institution Stanford Cardiovascular Institute, Stanford, CA, US
Contact information of distributor Joseph C. Wu, joewu@stanford.edu
Type of cell lines iPSC
Origin Human
Additional origin info required for human ESC or iPSC Age: 44 (SCVIi049-A) and 30 (SCVIi050-A)
Sex: male
Ethnicity if known: Not Hispanic or Latino
Cell Source Fibroblast (SCVIi049-A), PBMC (SCVIi050-A)
Clonality Clonal
Method of reprogramming Nonintegrating Sendai virus expression of human OCT4, SOX2, KLF4, and c-MYC
Genetic Modification Yes
Type of Genetic Modification Spontaneous mutation
Evidence of the reprogramming transgene loss (including genomic copy if applicable) RT-qPCR
Associated disease Dilated cardiomyopathy (DCM)
Gene/locus PLN (6q22.31)
SCVIi049-A: heterozygous PLN (c.25C > T)
SCVIi050-A: heterozygous PLN (c.40_42delAGA)
Date archived/stock date SCVIi049-A: 09/10/2019
SCVIi050-A: 12/03/2021
Cell line repository/bank https://hpscreg.eu/cell-line/SCVIi049-A
https://hpscreg.eu/cell-line/SCVIi050-A
Ethical approval The generation of the lines was approved by the Administrative Panel of Human Subjects Research (IRB) under IRB #29904 “Derivation of Human Induced Pluripotent Stem Cells”

2. Resource utility

Patients carrying pathogenic (c.40_42delAGA) and likely pathogenic (c.25 C>T) mutations in the PLN gene developed dilated cardiomyopathy (DCM). Generation of iPSC lines carrying these mutations provides an unlimited source for differentiation into cardiac cell types (e.g., cardiomyocytes, endothelial cells, fibroblasts), thus providing an excellent tool for in vitro modeling of DCM pathogenesis, testing of candidate therapies, and advancement of personalized medicine (see Table 1).

Table 1.

Characterization and validation.

Classification Test Result Data

Morphology Photography bright field Normal Fig. 1A
Phenotype Qualitative analysis Positive expression of pluripotency markers by immunocytochemistry: NANOG, SOX2, and OCT3/4 Fig. 1B
Genotype Karyotype (G-banding) and resolution Karyostat™ Assay, resolution 1–2 Mb: Normal karyotype 46, XY for both lines. Fig. 1H
Identity Microsatellite PCR (mPCR) or STR analysis Not performed N/A
22 loci tested, 100% identical Submitted in archive with journal
Mutation analysis (IF APPLICABLE) Sequencing SCVIi049-A: heterozygous c.25C > T Fig. 1F
SCVIi050-A: heterozygous c.40_42delAGA
Southern blot OR WGS Not performed Not performed
Microbiology and virology Mycoplasma Mycoplasma testing by luminescence: Negative (p10 and above) Supplemental Fig. 1A
Differentiation potential Embryoid body formation or Teratoma formation or Scorecard or directed differentiation Directed differentiation, positive expression of germ layer markers Fig. 1G
List of recommended germ layer markers Expression of these markers has to be demonstrated at mRNA (RT PCR) or protein (IF) levels, at least 2 markers need to be shown per germ layer Positive expression of germ layer markers: Fig. 1G
Ectoderm: Pax6, Otx2
Mesoderm: Brachyury, Tbx6
Endoderm: Sox17, Foxa2
Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C Not performed Not performed
Genotype additional info (OPTIONAL) Blood group genotyping Not performed Not performed
HLA tissue typing Not performed Not performed

3. Resource details

Dilated cardiomyopathy (DCM), with a prevalence of nearly 1:2,500 people, is the most common cause of heart failure after coronary artery disease and the leading indication for heart transplantation (Maron et al., 2006). Clinical hallmarks of DCM include contractile dysfunction and thinning of the myocardium. Intracellular Ca2+ handling is the central coordinator of cardiac contraction and relaxation. Phospholamban, encoded by the PLN gene, is an abundant, 52 amino acid transmembrane SR phosphoprotein that regulates cardiomyocyte calcium handling as the primary inhibitor of sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) (Schmitt et al., 2003). Several disease variants in the PLN gene have been described in heart failure, but no specific therapies exist beyond standard heart failure treatments or heart transplantation (Eijgenraam et al., 2020). The underlying mechanisms of PLN mutations in DCM remain incompletely understood. Using small animal modeling to study mutation-specific studies is historically a laborious, expensive, time-consuming strategy, taking years before the results of a single treatment may be evaluated (Eijgenraam et al., 2020). The advent of iPSC technology makes in vitro modeling of cardiac diseases possible. Here, cardiovascular cell types derived from patient-specific iPSCs with mutations in PLN present a valuable research opportunity to model DCM disease mechanisms.

We derived two human iPSC lines (SCVIi049-A and SCVIi050-A) from peripheral blood mononuclear cells (PBMCs) and fibroblasts of two patients carrying variants in the PLN gene, including a 44-year-old East Asian male (SCVIi049-A, c.25 C>T encoding p.Arg9Cys, likely pathogenic), and a 30-year-old Caucasian male (SCVIi050-A, c.40_42delAGA encoding p.Arg14del, pathogenic) (Resource Table). Reprogramming of somatic donor cells to iPSCs was conducted using a non-integrating Sendai virus containing the four Yamanaka factors described previously (Liu et al., 2021). Both iPSC lines showed typical morphology (Fig. 1A, Table 1). SCVI049-A and SCVIi050-A demonstrated high expression of pluripotency markers, OCT3/4, NANOG, and SOX2 detected by immunofluorescence (Fig. 1B). The expression of pluripotency markers was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Both SCVIi049-A and SCVIi050-A had comparable SOX2 and NANOG expression levels to the widely used positive control line, SCVI15 (Sun et al., 2012), but expressed much higher than iPSC-derived cardiomyocytes (iPSC-CMs) derived from SCVI15 (Fig. 1C–D). Furthermore, expression of the non-integrating Sendai virus, present at low passage numbers (SCVI15, p4), was absent in SCVIi049-A (p17) and SCVIi050-A (p20) measured by RT-qPCR (Fig. 1E).

Fig. 1.

Fig. 1.

Characterization of patient-derived iPSC lines with c.25C>T and c.40_42delAGA mutations in PLN.

The heterozygous mutations of both iPSC lines were confirmed by Sanger sequencing (Fig. 1F). Short tandem repeat (STR) analysis confirmed that both SCVIi049-A and SCVIi050-A demonstrated overlapping profiles with their respective donor somatic cells (Submitted in archive with journal). Additionally, both iPSC lines could differentiate into all three – ectoderm, mesoderm, and ectoderm – germ layers visualized by immunocytochemistry (Fig. 1G). SCVIi049-A and SCVI050-A had normal karyotype results assessed by the KaryoStat™ assay (Fig. 1H). Both iPSC lines were mycoplasma-negative (Supplemental Fig. 1A).

4. Materials and methods

4.1. Reprogramming

Peripheral blood mononuclear cells (PBMCs) were isolated from patients’ blood by PercollR gradient separation. PBMCs were purified and replated as previously described (Liu et al., 2021). Briefly, PBMCs were cultured in 1 ml of Stem-Pro™-34 medium (100 ng/ml FLT3, 20 ng/ml IL-6, 20 ng/ml EPO, 20 ng/ml IL-3, and 100 ng/ml SCF). PBMCs were resuspended in 300ul of Stem-Pro™-34 medium and transduced with Sendai virus reprogramming cocktail (CytoTune®-iPSC Sendai Reprogramming Kit). After 24 h, cells were replated, and the medium was replaced every two days. On Day 7, 1 ml of supplemented StemMACS™ iPSC-Brew XF medium (Miltenyi Biotec) was added on top of Stem-Pro™-34 medium. On Day 8, the medium was replaced completely with StemMACS™ iPSC-Brew XF medium. Fresh StemMACS™ iPSC-Brew XF medium was replaced on Days 10–15 when colonies appeared.

4.2. Cell culture

Patient-derived iPSCs were cultured in StemMACS iPS-Brew XF medium. Rock inhibitor (10uM, Y27632 Selleck Chemicals) was added up to 24 h after passage. Medium was replaced every two days until confluency. Cells were maintained in a 37 °C incubator with 5% CO2 and 20% O2.

4.3. Karyotyping

Patient-derived iPSCs were analyzed using the KaryoStat™ assay (ThermoFisher Scientific) at p10 (SCVIi049-A) and p8 (SCVIi050-A).

4.4. Trilineage differentiation

STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies #05230) was used to induce differentiation into endoderm and ectoderm. Mesoderm differentiation was induced with RPMI + glucose medium with B27 minus insulin. Differentiation was performed at p10 (SCVIi049-A) and p8 (SCVIi050-A).

4.5. Immunofluorescence staining

At room temperature, cells were fixed in 4% paraformaldehyde, then permeabilized with 50 ug/ml digitonin (Sigma Aldrich #D141) for 10 min each. Cells were incubated with a blocking solution (1% BSA) for 30 min. Cells were incubated with primary antibodies (Table 2) overnight at 4 °C. The following day, cells were washed 3 times. Cells were incubated in secondary antibodies (Table 2) for 30 min at room temperature, then washed 3 times. Nuclei were stained with Molecular Probes NucBlue (ThermoFisher Scientific #R37606) for 10 min at room temperature. Cells were washed 3 times, then imaged using a confocal light microscope. Immunostaining was carried out at p16 (SCVIi049-A) and p19 (SCVIi050-A).

Table 2.

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
Antibody Dilution Company Cat # RRID

Pluripotency Marker Mouse IgG2b kAnti-OCT-3/4 1:100 Santa Cruz Biotechnology Cat# sc-5279 RRID: AB_628051
Pluripotency Marker Rabbit Anti-NANOG 1:100 Protein Tech Cat# 142951-1-AP RRID: AB_1607719
Pluripotency Marker Mouse IgG1 kAnti-SOX2 1:100 RRID: AB_10842165
Santa Cruz Biotechnology Cat# sc-365823
Differentiation Marker (Ectoderm) Goat Anti-OTX2 1:200 R&D Systems Cat#963273 RRID: AB_2157172
Differentiation Marker (Ectoderm) Rabbit Anti-PAX6 1:200 Thermo Fisher Scientific Cat#42-6600 RRID: AB_2533534
Differentiation Marker (Endoderm) Goat Anti-SOX17 1:200 R&D Systems Cat#963121 RRID: AB_355060
Differentiation Marker (Endoderm) Rabbit Anti-FOXA2 1:250 Thermo Fisher Scientific Cat#701693 RRID: AB_2576439
Differentiation Marker (Mesoderm) Goat Anti-Brachyury 1:200 R&D Systems Cat#963427 RRID: AB_2200235
Differentiation Marker (Mesoderm) Rabbit Anti-TBX6 1:200 Thermo Scientific Cat#PA5-35102 RRID: AB2552412
Secondary Antibody Alexa Fluor 488 Goat Anti-Mouse IgG1 1:1000 Thermo Fisher Scientific #A-21121 RRID: AB_2535764
Secondary Antibody Alexa Fluor 647 Goat Anti-Mouse IgG2b 1:250 Thermo Fisher Scientific #A21242 RRID: AB_2535811
Secondary Antibody Alexa Fluor 555 Goat Anti-Rabbit IgG (H+L) 1:500 Thermo Fisher Scientific #A-21428 RRID: AB_141784
Secondary Antibody Alexa Fluor 488 Donkey Anti-Goat IgG (H+L) 1:1000 Thermo Fisher Scientific #A-11055 RRID: AB_2534102
Primers Target Size of band Forward/Reverse primer (5′-3′)

Genotyping SCVIi049-A: c.25 C>T 376 bp F: TTTTACATTCCAGGCTACCTAAAAG
R: TCTACTCAGGAAGTGGTCTGT
Genotyping SCVIi050-A: c.40_42delAGA 376 bp F: TTTTACATTCCAGGCTACCTAAAAG
R: TCTACTCAGGAAGTGGTCTGT
Sendai virus plasmid (RT-qPCR) Sendai virus genome 181 bp Mr042698800_mr
Pluripotency markers (RT-qPCR) SOX2 258 bp Hs04234836_s1
Pluripotency markers (RT-qPCR) NANOG 327 bp Hs02387400_g1
Housekeeping genes (RT-qPCR) GAPDH 471 bp Hs02786624_g1

4.6. RT-qPCR

RNA was extracted using the Direct-zol™ RNA Miniprep Kit (ZYMO Research #3R2061). To generate cDNA, iScript™ cDNA Synthesis Kit (BioRad #1708891) was used as follows: 5 min at 25 °C, 20 min at 46 °C, and 1 min at 95 °C. Expression of SOX2, NANOG, and SEV was amplified using commercial primers (Table 2) and TaqMan™ Gene expression Assay (Applied Biosystems™ #4444556).

4.7. Short tandem repeat analysis

Genomic DNA (gDNA) from fibroblasts (SCVI049-A), PBMCs (SCVIi050-A), and iPSCs were purified using DNeasy Blood & Tissue Kit (Qiagen). STR analysis was performed using CLA Identifier™ Plus and Identifier™ Direct PCR Amplification Kits (Thermo Fisher) by the Stanford PAN Facility.

4.8. Sanger sequencing

PCR primers were designed to flank PLN mutations (Table 2) and used to amplify the genomic region using Q5® Hot Start High-Fidelity DNA Polymerase (New England BioLabs). The PCR reaction was performed as follows: 98 °C for 5 sec, 62 °C for 10 sec, 72 °C for 20 sec for 35 cycles. PCR products were purified using QIAquick Purification Kit (Qiagen) and sent to the Stanford PAN facility.

4.9. Mycoplasma detection

Mycoplasma contamination was evaluated using a MycoAlert Detection Kit (Lonza #LT07–318) at p17 (SCVIi049-A) and p20 (SCVIi050-A).

Supplementary Material

1

Acknowledgements

We thank Chelsea Lee, Celine Lai, McKay MS Mullen, James WS Jahng, Julio Vicente Guevara, and Yan Zhuge for the technical support of this manuscript. This work was supported by the National Institutes of Health (NIH) R01 HL130020, R01 HL163680, P01 HL141084 (to J.C. W), NIH Administrative Diversity Supplement 3R01HL130020-06S1 (to C.D.V), and American Heart Association (AHA) Postdoctoral Fellowship 908936 (to A.C) and AHA Research Supplement to Promote Diversity in Science 872244 (to G.M.P).

Footnotes

Declaration of Competing Interest

The authors declare the following financial interest/personal relationships which may be considered as a potential competing : JCW is a co-founder and board member of Greenstone Biosciences and Khloris Biosciences. The other authors declare no conflicts of interest.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2022.102855.

References

  1. Eijgenraam TR, Boukens BJ, Boogerd CJ, Schouten EM, van de Kolk CWA, Stege NM, te Rijdt WP, Hoorntje ET, van der Zwaag PA, van Rooij E, van Tintelen JP, van den Berg MP, van der Meer P, van der Velden J, Silljé HHW, de Boer RA, 2020. The phospholamban p.(Arg14del) pathogenic variant leads to cardiomyopathy with heart failure and is unresponsive to standard heart failure therapy. Scientific Rep. 10, 9819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Liu L, Shenoy SP, Jahng JWS, Liu Y, Knowles JW, Zhuge Y, Wu JC, 2021. Generation of two heterozygous MYBPC3 mutation-carrying human iPSC lines, SCVIi001-A and SCVIi002-A, for modeling hypertrophic cardiomyopathy. Stem Cell Res. 53, 102279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Maron BJ, Towbin JA, Thiene G, Antzelevitch C, Corrado D, Arnett D, Moss AJ, Seidman CE, Young JB, 2006. Contemporary definitions and classification of the cardiomyopathies. Circulation 113, 1807–1816. [DOI] [PubMed] [Google Scholar]
  4. Schmitt JP, Kamisago M, Asahi M, Li GH, Ahmad F, Mende U, Kranias EG, MacLennan DH, Seidman JG, Seidman CE, 2003. Dilated cardiomyopathy and heart failure caused by a mutation in phospholamban. Science 299, 1410–1413. [DOI] [PubMed] [Google Scholar]
  5. Sun N, Yazawa M, Liu J, Han L, Sanchez-Freire V, Abilez OJ, Navarrete EG, Hu S, Wang L, Lee A, Pavlovic A, Lin S, Chen R, Hajjar RJ, Snyder MP, Dolmetsch RE, Butte MJ, Ashley EA, Longaker MT, Robbins RC, Wu JC, 2012. Patient-specific induced pluripotent stem cells as a model for familial dilated cardiomyopathy. Sci. Transl. Med. 4, 130ra147–130ra147. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES