Skip to main content
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2022;23(3):280–284. doi: 10.22099/IJVR.2022.40469.5870

Klebsiella pneumoniae infection in canaries (Serinus canaria Domestica): a case report

P Nakhaee 1, H Zarif Moghadam 2, S Shokrpoor 3, J Razmyar 4,*
PMCID: PMC9681979  PMID: 36425610

Abstract

Background:

Klebsiella pneumoniae can cause high mortality in birds. In recent years, small farming of canaries has been developed in Iran and infectious diseases are the main obstacle in the progress of these occupations which increases the importance of identification of pathogenic bacterial agents.

Case description:

A flock with 250 one-year-old canaries presented a history of anorexia, lethargy, mild diarrhea, and approximately 30% mortality. Physical examination revealed that the birds were severely debilitated, cachectic, dehydrated with ruffled feathers, and wet discolored stool around the cloaca. Necropsy findings revealed enlarged liver with multiple pale white, irregular foci on the surface of parenchyma, serosal petechial hemorrhages, and enlargement of lungs, liver, and kidneys. The entire intestine was intensely reddened with fibrinonecrotic exudate content. Histopathological findings of the liver elicited multifocal hepatocellular necrosis, hemorrhage, and also basophilic bacterial colonies. The results of biochemical and molecular tests confirmed K. pneumonia as the causative agent.

Findings/treatment and outcome:

Based on antimicrobial susceptibility test, K. pneumonia isolates were susceptible to gentamycin and ciprofloxacin which were administrated for the considered treatment protocol.

Conclusion:

K. pneumoniae is one of the most important causes of mortality in canaries with multiple antibiotic resistance, therefore assessments of health conditions can supply suitable information to help decision-making about the sanitary processes, control, prevention, and treatment.

Key Words: Canary, Diarrhea, Histopathology, Klebsiella pneumoniae, Necropsy

Introduction

Klebsiella pneumoniae is a Gram-negative, non-motile, bacilliform, late lactose fermenting bacterium. It is an encapsulated opportunistic pathogen which is a member of the Enterobacteriacea family. Members of the genus Klebsiella are opportunistic pathogens that are mostly identified in various infections of animals and humans. This bacterium is a common saprophyte in the environment and one of the respiratory disease agents in humans and chickens (Podschun and Ullmann, 1998 ▶). Klebsiella infections can cause sepsis, meningitis, diarrhea, nosocomial pneumonia, arthritis, and urinary tract infections in hospitalized humans. In animals, Klebsiella infections are frequently associated with respiratory and urinary tract infections, sepsis, and mastitis (Brisse and Van Duijkeren, 2005 ▶). Meanwhile, Klebsiella can acquire resistance to multiple antibiotics and is an important cause of nosocomial wound and urinary tract infections in hospitalized humans and animals (Vuotto et al., 2014 ▶).

In recent years, non-industrial farming of canaries has been developed in Iran and infectious diseases, including bacterial infections, are the main obstacle in the progress of these occupations which this subject increases the importance of identification of pathogenic bacterial agents. This report details the identification procedure of K. pneumonia in a canary with respiratory symptoms.

Case description

A total of 250 one-year-old (both sexes) domestic canaries (Serinus canaria domestica) with an average weight of 33 ± 0.6 g were presented by an indoor aviculturist to the private veterinary clinic in Northeast Iran due to anorexia, lethargy, diarrhea, and also approximately 30% mortalities during two days. On physical examination, the birds were severely debilitated, cachectic, dehydrated with ruffled feathers and wet discolored stool around the cloaca. According to the history and clinical signs, our differential diagnosis included coccidiosis, secondary necrotizing enteritis, avian poxvirus infection, and other potential bacterial causes.

Based on owner information, an indoor breeding facility was considered, and the birds were kept in pairs in breeding cages (50 × 40 × 40 cm) with artificial lighting. The diet was mostly traditional seed mixture (millets and linseed), soft food (fruits and vegetables), cuttlefish bone, and grit. To have an accurate diagnosis, the fresh canary carcasses were referred to the Avian Diseases Division, Faculty of Veterinary Medicine, the University of Tehran for further examinations. All procedures used in the study are following institutional ethical guidelines which are based on the Directive 2010/63/EU on the protection of animals used for scientific purposes.

Microbiology and antimicrobial susceptibility testing

To check out necrotizing enteritis, a sample of 50 g liver sample was added into 450 ml of distilled water and mixed in a vortex mixer (TARSON) for 15 min. A 50-ml aliquot from the mixture was transferred to a beaker and placed in the water bath at 80°C for 10 min. After cooling the mixture, 1 ml of it was inoculated on blood agar containing 7% defibrinated sheep blood and incubated anaerobically at 37°C for 48 h. Suspected colonies were sub-cultured on selective culture media of C. perfringens including tryptose sulfite cycloserine agar (TSC).

For detection of Salmonella spp., three debilitated canaries were humanly killed by CO2 asphyxiation. One gram of cecal contents was aseptically removed and placed into sterile tubes containing 9 ml of peptone water buffer and incubated overnight at 37°C. To be enriched in a selective media 0.1 ml of each tube was transferred to 10 ml of rappaport vassiliadis (RV) broth (Merck, Germany) and incubated overnight at 37°C. Following enrichment, each sample of cecal contents was streaked for isolation on xylose lysine deoxycholate (XLD) agar plates (Merck, Germany). The plates were incubated at 37°C for 24 h and then observed for either the presence or absence of characteristic Salmonella colonies.

The presence of the coccidian organism (Isospora) was evaluated by wet smears of intestinal and fecal samples taken from live and dead canaries. In terms of determining the distribution of other potential bacterial agents especially Enterobacteriacea, Klebsiella, Pseudomonas, Enterobacter, Proteus, and some Gram-positive bacteria such as Staphylococcus spp., Streptococcus spp., and Enterococcus spp. were assessed by Gram staining of fecal specimens and mucosal intestinal scraping, agar culture, colonial and microscopical morphology, hemolytic pattern and biochemical experiments as described formerly (Chanos and Mygind, 2016 ▶).

In the next step, biochemical tests and bacterial culture were performed using sterilized swabs from seven liver samples of birds. The specimens were enriched using a nutrient broth for 24-48 h at 37°C anaerobically/aerobically, then cultured on Blood agar aerobically at 37°C for 24-48 h which represented mucoid non-hemolytic colonies. To have definite colonies of bacteria, suspected colonies were re-cultured on Mac Conkey’s agar for 24 h.

To treat the canaries, the antimicrobial susceptibility of K. pneumoniae was tested by Kirby-Bauer disk diffusion method on Mueller-Hinton agar based on the recommendations provided by the National Committee for Clinical Laboratory Standards Guidelines (CLSI, 2019). K. pneumoniae isolate was tested against the following 13 antimicrobial agents (μg/disk): ciprofloxacin (5 μg), enrofloxacin (5 μg), chloramphenicol (30 μg), cefazolin (30 μg), cefixime (5 μg), ampicillin (10 μg), erythromycin (15 μg), kanamycin (30 μg), streptomycin (30 μg), amikacin (30 μg), gentamicin (10 μg), florfenicol (30 μg), and oxytetracycline (30 μg). All anti-bacterial disks were purchased from Padtan Teb Co. (Tehran, Iran).

Histopathology

Samples of livers were collected in 10% neutral buffered formalin for histopathological assessment. Tissue samples were routinely processed, dehydrated, and embedded in paraffin wax, sectioned at 5 μm thickness (Rotary Microtome RM2 145, Leica), and stained with hematoxylin and eosin (H&E). Sections were examined using a light microscope (Nikon, Eclipse E600), and representative images were taken.

Polymerase chain reaction (PCR)

Tissue samples of pulmonary lesions were kept at 20°C until use. The specimens were minced and ground with sterile quartz sand by a mortar and pestle, suspended in a balanced salt solution containing 50 IU/ml penicillin and 50 mg/ml streptomycin. After centrifugation at 100 g for 10 min with low-speed, 0.1 ml of the supernatant of the 15 suspensions was inoculated on the CAMs of 11-day-old chicken embryos from commercial and specific-pathogen-free (SPF) as well. The inoculated eggs were incubated at 37.5°C for 7 days and then evaluated for pocks on the CAM. No more passages were performed. Extraction of DNA was performed by 25 mg of the pulmonary lesions of seven clinical cases and 25 mg of the two lyophilized vaccines by QIAamp DNA Mini Kit (Qiagen, Italy, Milan) according to the manufacturer’s instructions. Proteinase K was used for tissue digestion at 56°C for 24 h. Obtained DNA specimens were kept at 80°C up to analysis. PCR reactions for APV-specific PCR and fpv140 were performed in a volume of 25 ml PCR buffer containing 1.5 mM of MgCl2, 6 pmol of each primer, 200 mM of each dNTP, and 1.25 U Taq polymerase (Invitrogen, Milan, Italy). The APV specific PCR was carried out using a primer pair explained in a study (Lee and Lee, 1997 ▶) according to the sequence of P4b gene of Fowlpox virus strain HP444. After the initial denaturation, the amplification was performed for 2 min at 94°C for 35 cycles including 1 min denaturation at 94°C, 1 min annealing at 60°C, and 1 min extension at 72°C. The final extension step was performed for 2 min at 72°C. Afterwards, five microliters of the PCR products were detached by 2% (for P4b) and 1.2% (for fpv140) agarose gel electrophoresis and subsequently stained with ethidium bromide. PCR products obtained from amplifying P4b gene with the characteristic size were purified by QIAquick PCR purification kit (Qiagen, Milan, Italy). One commercially available vaccine strain against the fowlpox virus (Razi Institute, Iran) was also included.

To detect K. pneumonia, the isolate was subjected to multiplex PCR to confirm results obtained from biochemical tests by using the method adopted from a study with some modification (Chander et al., 2011 ▶). The DNA extraction from the individual colonies was performed by an extraction kit (Bioneer, South Korea) in accordance with the manufacturer’s guidelines. In brief, 200 μL of the specimen suspension was incubated with 200 μL of lysis buffer and 10 μL proteinase K at 65°C for 30 min. Following incubation, 250 μL of binding buffer and 250 μL of ethanol 80% were combined with the lysate. After that, washing the sample was performed according to the producer’s guidelines. Elution of nucleic acid was carried out with 100 μL of elution buffer. The PCR reaction mixture composed of 5 μL template DNA, 12.5 μL Taq DNA Polymerase Master Mix RED kit (Ampliqon, Denmark) which contained Tris-HCl 150 mM pH = 8.5, (NH4)2SO4 40 mM, MgCl2 1.5 mM, 0.2% Tween 20, dNTPs 0.4 mM, Ampliqon Taq DNA Polymerase (0.05 Unit/ul), 1 μL (10 pmol/μL) of each forward and reverse of primers and distilled water to the final volume of 25 μL. The list of primers used in this study is presented in Table 1. Thermal cycling (Techne TC, 3000, England) was carried out at 95°C for 3 min followed by 35 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min which terminated the PCR reaction. The PCR products (5 μL) were visualized on 1% agarose gel in Tris-acetate-EDTA buffer by electrophoresis.

Table 1.

List of primers used in multiplex PCR assay for confirmation of K. pneumonia

Primer name Sequence (5´-3´) Target gene Product size (bp)
Klebsiella spp. F: CGCGTACTATACGCCATGAACGTA gyrA 441
R: ACCGTTGATCACTTCGGTCAGG
K. pneumoniae F: CAACGGTGTGGTTACTGACG rpoB 108
R: ΤCΤΑCGΑΑGΤGGCCGΤΤΤΤC

Results

Necropsy, microbiological, and histopathological findings

Postmortem examination revealed enlarged liver with multiple pale white, irregular, and variably sized foci on the surface, and the parenchyma and many foci were confluent (Fig. 1A). There were petechial hemorrhages on the serosal surface of visceral organs, enlargement of subcutaneous blood vessels, and congestion and enlargement of the lungs, liver, and kidneys. In addition, the entire intestine was intensely reddened, and the mucosal surfaces were covered by fibrinonecrotic exudate. Meanwhile, airsacculitis especially cranial and caudal thoracic air sacs were involved but pneumonia/bronchopneumonia was not observed.

Fig. 1.

Fig. 1

(A) An enlarged liver with multiple pale white and irregular foci on the surface, (B) Hepatocellular necrosis (arrowheads) (H&E staining, ×20, scale bar: 50 μm), (C) Hemorrhage (arrowheads) (H&E staining, ×20, scale bar: 50 μm), and (D) Basophilic bacterial colonies in the liver (arrowheads) (H&E staining, ×60, scale bar: 20 μm)

After the procedure of culture on blood agar and Mac Conkey’s agar and obtaining non-hemolytic and lactose-fermenting colonies, the bacterial isolates were identified as K. pneumoniae by non-automated biochemical tests (Table 2). Histopathological findings revealed multifocal hepatocellular necrosis, hemorrhage, and inflammatory cells infiltration (Figs. 1B and C). In addition, basophilic bacterial colonies were also seen in the liver (Fig. 1D). All samples selected and sub-cultured on selective culture media of C. perfringens were negative for C. perfringens. In addition, black colonies characterizing Salmonella spp. were not observed on XLD agar.

Table 2.

Biochemical properties of K. pneumoniae strains isolates in the present study

Test name Results
Indole production test Negative
Methyl-red test Negative
Voges-proskauer test Positive
Citrate utilization test Positive
Hydrogen sulfide production Negative
Urea hydrolysis test Positive
Ornithine decarboxylase Negative
Motility at 36°C Non-motile
D-glucose (acid/gas) Positive/Positive
D-mannitol fermentation Positive
Sucrose fermentation Positive
Lactose fermentation Positive
D-sorbitol fermentation Positive
Cellobiose Positive
Esculin hydrolysis Positive
Acetate utilization test Positive

Antimicrobial susceptibility findings

The results of the antibiotic susceptibility tests were interpreted according to the guidelines provided by CLSI (2019) ▶. The isolates were assigned into resistant, intermediate, and susceptible groups. Klebsiella pneumonia isolates were susceptible to ciprofloxacin and gentamycin. Ciprofloxacin was then administrated for the treatment of the flock. Gentamicin was not prescribed because it is not absorbed orally and must be given parentally, which would be a challenge in a flock of 250 small, fragile birds. Intermediate susceptibility was observed to streptomycin, kanamycin, amikacin, enrofloxacin, and oxytetracycline. Antibiotic resistance was shown for cefazolin, cefixime, ampicillin, erythromycin, chloramphenicol, and florfenicol.

PCR analysis

The results for detection of canarypox virus in PCR technique were negative in all isolates (data are not shown). In all reactions, positive controls were K. pneumoniae and Klebsiella oxytoca, and the negative control was distilled water. Every seven samples in the current study were positive for Klebsiella species and K. pneumonia. In gel electrophoresis, both products of 441 bp and 108 bp were observed (data are not shown).

Discussion

Klebsiella pneumoniae in the Enterobacteriacea family is a common saprophyte in the environment and one of the respiratory disease agents in humans and chickens. Enterobacteria do not belong to the intestinal flora of granivorous pet birds which are able to spread in the environment and become ubiquitous under suitable situations (Gerlach, 1994 ▶; Glünder, 2002 ▶). K. pneumoniae can be detected in fecal samples and oropharynx of many species of healthy psittacines and passerines (Gibbs et al., 2007 ▶), however, these enterobacteria mostly act as respiratory pathogens, especially among immunosuppressed and stressed birds (El Fertas-Aissani et al., 2013 ▶). It seems that keeping captive birds can impact on normal flora of the intestinal and respiratory tract and subsequent colonization by Gram-negative bacteria. In this case report, it seems that lack of hygiene and biosecurity, introducing new canaries to the flock without quarantine and health status monitoring, induced stress and immunosuppression especially during mating and feeding the chicks, or presence of concurrent diseases may play important roles in the occurrence of K. pneumonia infection. In addition, arbitrary usage of different antibiotics by aviculturists without consultant of vets and antimicrobial susceptibility testing could modify the intestinal and respiratory tract microbial flora, favoring colonization by Gram-negative bacteria. Based on the history and owner descriptions, the disease started suddenly and the rate of mortality was relatively severe during utilization of antibiotics arbitrarily by the aviculturist which shows the multiple antibiotic resistance against K. pneumoniae as an aggregating factor in the infectious process of disease.

An outbreak of K. pneumonia infection had been reported in many animals (Fecteau et al., 1997 ▶; Davies et al., 2016 ▶; Yang et al., 2019 ▶; Roberts et al., 2000 ▶). Similar recent reports about the isolation of this microorganism from canaries suffered from cutaneous xanthogranuloma and yolk sac infection (Razmyar and Zamani, 2016 ▶; Shokrpoor et al., 2019 ▶). Consistent with the current study, the clinical signs and necropsy findings were similar in dogs with K. pneumonia infection in which diarrhea, dehydration, and enlarged liver with multiple focal necrosis were the dominant reported symptoms (Roberts et al., 2000 ▶). This bacterium had been recognized as a causative factor of genital system infection of the mare, bovine mastitis, critically sick neonatal calves, severe enteritis, and diarrhea in dogs (Braman et al., 1973 ▶; Atherton, 1975 ▶; Fecteau et al., 1997 ▶; Saidenberg et al., 2012 ▶; Roberts et al., 2000 ▶). In addition to bacterial infection caused by Klebsiella spp. in animals with different clinical manifestations, there are other concerns about the probability of transmission of this microorganism to animals and humans (Saidenberg et al., 2012 ▶).

K. pneumoniae is known to be an opportunistic causative agent of nosocomial infections in humans with various presentations of disease and the emergence of multidrug-resistant of this bacterium has made it difficult to control, worldwide (Ripabelli et al., 2018 ▶). In a similar study, the researchers reported the prevalence of Gram-negative bacteria between breeder canaries with clinical disease and the antimicrobial susceptibility patterns of the isolates in which 6 of 88 isolates classified in Klebsiella spp and most susceptibility was observed to norfloxacin, oxytetracycline, and ciprofloxacin. The most resistance was found for amoxicillin, cefadroxil, erythromycin, and penicillin G (Giacopello et al., 2015 ▶); while in our study, the isolates were susceptible to gentamycin and ciprofloxacin and resistant to cefazolin, cefixime, ampicillin, erythromycin, chloramphenicol, and florfenicol. As well, we discovered a relatively large similarity between the antimicrobial susceptibility of the K. pneumonia isolate of the current study and the recent case report (Razmyar and Zamani, 2016 ▶). In another study, gentamicin efficacy against K. pneumonia isolated from Passeriformes and Psittaciformes was demonstrated. In the current study, ciprofloxacin showed proper efficiency for treatment protocol, but in another study, K. pneumonia strains isolated from chickens were resistant to this antimicrobial agent, therefore, these similar and contradictory findings of antimicrobial susceptibility of K. pneumonia would be due to different species, age, route of infection, environmental condition, and bacterial resistant profiles.

Based on the results of this study, K. pneumoniae is one of the most important causes of mortality in canaries with multiple antibiotic resistance, and its control, prevention, and treatment are of great importance. Isolation of this bacterium had been reported in extra-enteric disease in canaries and this study demonstrated pathogenic K. pneumoniae with gastrointestinal origin and systemic lesions which should be considered as a differential diagnosis for high mortalities in canaries. In addition, the precision mechanism of horizontal transmission of K. pneumonia has not been identified to date. It appears that the bacterium has entered the host via the gastrointestinal tract and vertical transmission has not been definitively confirmed yet and needs further investigations. Also, due to the wide range of this bacterium hosts, wild and domesticated birds and mammals may be raised as the reservoir of infection. According to the results, K. pneumoniae is one of the most important causes of mortality in canaries with multiple antibiotic resistance, therefore assessments of health conditions can supply suitable information to help decision-making about the sanitary processes, control, prevention, and treatment.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgment

We would like to thank Ms. A. Yazdani for his kind laboratory assistance.

References

  1. Atherton JG. The identification of equine genital strains of Klebsiella and Enterobacter species. Equine Vet. J. 1975;7:207–209. [Google Scholar]
  2. Braman SK, Eberhart RJ, Asbury MA, Hermann GJ. Capsular types of Klebsiella pneumoniae associated with bovine mastitis. J. Am. Vet. Med. Assoc. 1973;162:109–111. [PubMed] [Google Scholar]
  3. Brisse S, Van Duijkeren E. Identification and antimicrobial susceptibility of 100 Klebsiella animal clinical isolates. Vet. Microbiol. 2005;105:307–312. doi: 10.1016/j.vetmic.2004.11.010. [DOI] [PubMed] [Google Scholar]
  4. Chander Y, Ramakrishnan MA, Jindal N, Hanson K, Goyal SM. Differentiation of Klebsiella pneumoniae and Klebsiella oxytoca by multiplex polymerase chain reaction. Int. J. Appl. Res. Vet. Med. 2011;9:138–142. [Google Scholar]
  5. Chanos P, Mygind T. Co-culture-inducible bacteriocin production in lactic acid bacteria. Appl. Microbiol. Biotechnol. 2016;100:4297–4308. doi: 10.1007/s00253-016-7486-8. [DOI] [PubMed] [Google Scholar]
  6. CLSI. 29th Edn., CLSI Supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2019. Performance standards for antimicrobial susceptibility testing. [Google Scholar]
  7. Davies YM, Cunha MPV, Oliveira MGX, Oliveira MCV, Philadelpho N, Romero DC, Milanelo L, Guimarães MB, Ferreira AJP, Moreno AM, Sá LRM, Knöbl T. Virulence and antimicrobial resistance of Klebsiella pneumoniae isolated from passerine and psittacine birds. Avian Pathol. 2016;45:194–201. doi: 10.1080/03079457.2016.1142066. [DOI] [PubMed] [Google Scholar]
  8. El Fertas-Aissani R, Messai Y, Alouache S, Bakour R. Virulence profiles and antibiotic susceptibility patterns of Klebsiella pneumoniae strains isolated from different clinical specimens. Pathologie Biologie. 2013;61:209–216. doi: 10.1016/j.patbio.2012.10.004. [DOI] [PubMed] [Google Scholar]
  9. Fecteau G, Van Metre DC, Pare J, Smith BP, Higgins R, Holmberg CA, Jang S, Guterbock W. Bacteriological culture of blood from critically ill neonatal calves. Can. Vet. J. 1997;38:95–100. [PMC free article] [PubMed] [Google Scholar]
  10. Gerlach H. Bacteria. In: Ritchie BW, editor. Avian medicine: principles and application. 1st Edn. Florida: Wingers Publishing; 1994. pp. 949–983. [Google Scholar]
  11. Giacopello C, Foti M, Fisichella V, Piccolo FL. Antibiotic-resistance patterns of Gram-negative bacterial isolates from breeder canaries (Serinus canaria domestica) with clinical disease. J. Exot. Pet. Med. 2015;24:84–91. [Google Scholar]
  12. Gibbs PS, Kasa R, Newbrey JL, Petermann SR, Wooley RE, Vinson HM, Reed W. Identification, antimicrobial resistance profiles, and virulence of members from the family Enterobacteriaceae from the feces of yellow-headed blackbirds (Xanthocephalus xanthoce-phalus) in North Dakota. Avian Dis. 2007;51:649–655. doi: 10.1637/0005-2086(2007)51[649:IARPAV]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  13. Glünder G. Influence of diet on the occurrence of some bacteria in the intestinal flora of wild and pet birds. Dtsch. Tierarztl. Wochenschr. 2002;109:266–270. [PubMed] [Google Scholar]
  14. Lee LH, Lee KH. Application of the polymerase chain reaction for the diagnosis of fowl poxvirus infection. J. Virol. Methods. 1997;63:113–119. doi: 10.1016/s0166-0934(96)02119-2. [DOI] [PubMed] [Google Scholar]
  15. Podschun R, Ullmann U. Klebsiella spp as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev. 1998;11:589–603. doi: 10.1128/cmr.11.4.589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Razmyar J, Zamani AH. An outbreak of yolk sac infection and dead-in-shell mortality in common canary (Serinus canaria) caused by Klebsiella pneumoniae. Iran. J. Vet. Res. 2016;17:141–143. [PMC free article] [PubMed] [Google Scholar]
  17. Ripabelli G, Tamburro M, Guerrizio G, Fanelli I, Flocco R, Scutellà M, Sammarco ML. Tracking multidrug-resistant Klebsiella pneumoniae from an Italian hospital: molecular epidemiology and surveillance by PFGE, RAPD and PCR-based resistance genes prevalence. Curr. Microbiol. 2018;75:977–987. doi: 10.1007/s00284-018-1475-3. [DOI] [PubMed] [Google Scholar]
  18. Roberts DE, McClain HM, Hansen DS, Currin P, Howerth EW. An outbreak of Klebsiella pneumoniae infection in dogs with severe enteritis and septicemia. J. Vet. Diagn. Invest. 2000;12:168–173. doi: 10.1177/104063870001200215. [DOI] [PubMed] [Google Scholar]
  19. Saidenberg AB, Teixeira RHF, Guedes NMR, Allgayer MDC, Melville PA, Benites NR. Molecular detection of enteropathogenic Escherichia coli in asymptomatic captive psittacines. Pesqui. Vet. 2012;32:922–926. [Google Scholar]
  20. Shokrpoor S, Baghkheirati AA, Yazdani A, Razmyar J. Cutaneous xanthogranuloma associated with Klebsiella pneumoniea in a budgerigar (Melopsittacus undulatus) Vet. Res. Forum. 2019;10:365–367. doi: 10.30466/vrf.2019.102621.2445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Vuotto C, Longo F, Balice MP, Donelli G, Varaldo PE. Antibiotic resistance related to biofilm formation in Klebsiella pneumoniae. Pathogens. 2014;3:743–758. doi: 10.3390/pathogens3030743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Yang F, Deng B, Liao W, Wang P, Chen P, Wei J. High rate of multi-resistant Klebsiella pneumoniae from human and animal origin. Infect. Drug Resist. 2019;12:2729–2737. doi: 10.2147/IDR.S219155. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES