Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2022 Nov 7;96(22):e01473-22. doi: 10.1128/jvi.01473-22

Transmissible Gastroenteritis Virus Nucleocapsid Protein Interacts with Na+/H+ Exchanger 3 To Reduce Na+/H+ Exchanger Activity and Promote Piglet Diarrhea

Zheng Niu a,b,#, ShaSha Xu a,#, YiLing Zhang a, ZiFei Kan a, JingYi Zhang a, Xiangyang Liu a,d, ShuJuan Zhang a, Hong Zou a, ZhenHui Song a,c,
Editor: Tom Gallaghere
PMCID: PMC9682987  PMID: 36342433

ABSTRACT

Transmissible gastroenteritis virus (TGEV) is member of the family Coronaviridae and mainly causes acute diarrhea. TGEV infection is characterized by vomiting, watery diarrhea, and severe dehydration, resulting in high mortality rates in neonatal piglets. TGEV infection symptoms are related to an imbalance of sodium absorption in small intestinal epithelial cells; however, the etiology of sodium imbalance diarrhea caused by TGEV remains unclear. In this study, we performed transcriptomic analysis of intestinal tissues from infected and healthy piglets and observed that the expression of NHE3, encoding Na+/H+ exchanger 3 (NHE3), the main exchanger of electroneutral sodium in intestinal epithelial cells, was significantly reduced upon TGEV infection. We also showed that specific inhibition of intestinal NHE3 activity could lead to the development of diarrhea in piglets. Furthermore, we revealed an interaction between TGEV N protein and NHE3 near the nucleus. The binding of TGEV N to NHE3 directly affected the expression and activity of NHE3 on the cell surface and affected cellular electrolyte absorption, leading to diarrhea. Molecular docking and computer-aided screening techniques were used to screen for the blocker of the interaction between TGEV N and NHE3, which identified irinotecan. We then demonstrated that irinotecan was effective in relieving TGEV-induced diarrhea in piglets. These findings provide new insights into the mechanism of TGEV-induced sodium imbalance diarrhea and could lead to the design of novel antiviral strategies against TGEV.

IMPORTANCE A variety of coronaviruses have been found to cause severe diarrhea in hosts, including TGEV; however, the pathogenic mechanism is not clear. Therefore, prompt determination of the mechanism and identification of efficient therapeutic agents are required, both for public health reasons and for economic development. In this study, we demonstrated that NHE3 is the major expressed protein of NHEs in the intestine, and its expression decreased by nearly 70% after TGEV infection. Also, specific inhibition of intestinal NHE3 resulted in severe diarrhea in piglets. This demonstrated that NHE3 plays an important role in TGEV-induced diarrhea. In addition, we found that TGEV N directly regulates NHE3 expression and activity through protein-protein interaction, which is essential to promote diarrhea. Molecular docking and other techniques demonstrated that irinotecan could block the interaction and diarrhea caused by TGEV. Thus, our results provide a basis for the development of novel therapeutic agents against TGEV and guidance for the development of drugs for other diarrhea-causing coronaviruses.

KEYWORDS: TGEV N, NHE3, Na+ imbalance diarrhea, irinotecan

INTRODUCTION

Transmissible gastroenteritis (TGE) is an acute, highly contagious intestinal disease caused by transmissible gastroenteritis virus (TGEV) in piglets, with clinical signs of severe diarrhea, vomiting, and dehydration (1). TGE has a very high mortality rate in piglets less than 2 weeks old and poses a great danger to the pig industry; however, the cause of diarrhea is not fully understood (2, 3). Under normal conditions, water is mostly absorbed in the intestinal lumen via osmosis, in which the osmotic gradient formed by Na+ absorption is the main driving force for water absorption (4). When laxative substances act on the intestine, they change the expression and activity of ion channels and transporters, thus disrupting the balance between absorption and secretion, resulting in a large loss of water and electrolytes, which in turn raises the osmotic pressure in the intestinal lumen and causes water to passively enter the intestinal lumen, ultimately causing diarrhea (5).

Na+/H+ exchanger 3 (NHE3) is mainly present in the intestine and kidney in pigs, where it is responsible for Na+ absorption and is the main transporter of electroneutral Na+ (6). It is mainly distributed on the striate margin and the brush border membrane of the renal tubule and in the intracellular organelles and cell membrane. Under physiological conditions, NHE3 is transcribed, translated, and carried by endosomes between the cytoplasm and membrane; however, NHE3 can function as an ion exchanger only when it is on the cell membrane (7, 8). The predominant regulatory mechanism of NHE3 is translocation, i.e., the recruitment of stored NHE3 to the cytoplasmic membrane, which changes its concentration on the membrane to exerts its effects (9, 10).

The TGEV nucleocapsid (N) protein is a phosphorylated structural protein of approximately 382 amino acids, which binds to the RNA genome of TGEV to form a helix complex and constitutes the viral nucleocapsid (11). The N protein of coronaviruses consists of an N-terminal domain (NTD), a linker region (LKR), and a C-terminal domain (CTD). The N protein plays an important role as a chaperone protein of viral RNA in viral replication and proliferation, structural maintenance, and induction of the body’s immune response (1214).

Our previous studies showed that NHE3 plays an important role in the diarrhea resulting from TGEV infection; however, its exact mechanism of action is unclear (1517). In the present study, we determined the interaction between TGEV N protein and NHE3 using fluorescence colocalization and coimmunoprecipitation (co-IP) and then explored the regulatory effect of TGEV N on NHE3 by overexpressing and depleting the N protein. We found that TGEV N significantly downregulated the expression and activity of NHE3. Then, using molecular docking and computer-assisted screening techniques, we identified irinotecan as a blocker of the interaction between TGEV N and NHE3. Cellular and animal assays confirmed the effective viral suppression and diarrhea treatment effects of irinotecan. This result of the present study partially explains the mechanism of NHE3 regulation by TGEV and provides a lead compound for the clinical treatment of TGE, as well as a new method for the treatment of diarrhea caused by coronavirus in animals.

RESULTS

TGEV infection leads to reduced NHE3 expression in porcine intestinal epithelial cells.

TGEV was administered to piglets to construct a TGE-positive experimental group, while 0.9% saline was administered to piglets in the mock group. After the TGE-positive experimental group showed obvious diarrhea symptoms, the piglets in both groups were slaughtered at the same time to observe their gastrointestinal morphology and symptoms. The results are shown in Fig. 1A. The piglets in the TGE group had obvious diarrhea symptoms and their intestines were puffy and transparent, while the intestinal contents were obviously watery and contained some undigested cheese pieces. In the mock group, the intestine was in a healthy state, without obvious lesions.

FIG 1.

FIG 1

NHE3 is significantly downregulated after TGEV infection. (A) Fecal excretion and intestinal lesions after TGEV infection and dissection compared with mock-infected intestines; (B) results of clustering heat map analysis of NHEs in the transcriptome; (C) qRT-PCR validation of heat map results; (D) Western blotting detection of NHE3 levels in intestinal epithelial cells.

A portion of jejunal tissue was taken for transcriptome sequencing, and the expression levels of NHE genes were analyzed by the Z-score to construct a clustering heat map (Fig. 1B). NHE2, NHE3, NHE5, NHE6, NHE7, and NHE9 all showed decreased expression in the TGE group compared with that in the mock group, except for NHE4, which was not expressed in either group. Among them, NHE3 expression was the most downregulated, decreasing by 69% compared with that in the mock group. Quantitative real-time reverse transcription-PCR (qRT-PCR) validation also showed that the decrease in NHE3 expression was highly significant (P < 0.001) (Fig. 1C).

We further examined the NHE3 protein levels in intestinal epithelial cells obtained by Ca2+ chelation, and the results indicated that NHE3 protein level was significantly decreased after TGEV infection (Fig. 1D).

These results suggest that NHE3 may play an important role in the diarrhea-causing process of TGEV.

Specifically inhibiting intestinal NHE3 activity can lead to the development of diarrhea in piglets.

Piglets that were treated with tenapanor, a specific inhibitor of intestinal NHE3, showed obvious watery diarrhea, and the intestine showed bulging and transparency after dissection (Fig. 2A). The mRNA and protein expression levels of NHE3 in intestinal epithelial cells were significantly downregulated after tenapanor treatment (Fig. 2B).

FIG 2.

FIG 2

Diarrhea symptoms and other pathological changes in piglets after specific inhibition of intestinal NHE3. (A) Intestinal pathological changes and fecal morphology in piglets after specific inhibition of intestinal NHE3; (B) verification of NHE3 mRNA expression and protein levels after specific inhibition of intestinal NHE3; (C) H&E staining, IHC, and IF staining in piglets’ intestinal sections; (D) statistics of the length change of the piglets’ intestinal villi; (E) statistics of the change in the number of intestinal villi in the piglets; (F) statistics of the number of NHE3-positive loci in the IHC results; (G) statistics of the number of NHE3-positive loci in the IF results.

Next, we performed hematoxylin and eosin (H&E), immunohistochemical (IHC), and immunofluorescence (IF) staining on paraffin sections of the intestine of piglets in the mock group, TGEV group, and tenapanor instillation group (Fig. 2C). Quantitative analysis revealed that the intestinal villi showed a significant reduction in length and number after TGEV infection or tenapanor treatment (Fig. 2D and E). In addition, IHC and IF analyses of NHE3 showed that the protein expression of NHE3 was significantly downregulated in both experimental groups compared with that in the mock group, which was consistent with the results of Western blotting (Fig. 2F and G).

Here, we demonstrated that inhibition of NHE3 using tenapanor, an intestinal NHE3-specific inhibitor, caused diarrhea in piglets, which revealed the importance of NHE3 in diarrhea and also the important role of NHE3 in the diarrhea-causing process of TGEV.

TGEV N protein interacts with NHE3.

Immunofluorescence staining of piglet intestinal tissues obtained after TGEV infection was performed using antibodies against TGEV N protein and NHE3. Laser confocal microscopy detection was also performed. We observed spatial colocalization of the TGEV N protein with NHE3, which was not present in the mock group (Fig. 3A). To confirm the relationship between the two proteins, we used porcine small intestinal epithelial cells (IPEC-J2) as a model. First, we performed a colocalization assay after TGEV infection and transfection with the TGEV N protein overexpression plasmid, which demonstrated spatial colocalization between TGEV N protein and NHE3 near the nucleus (Fig. 3B and C). We then examined the TGEV-infected cells using co-IP, and NHE3 IP, which pulled down a specific band identified as TGEV N in the TGEV-infected group (Fig. 3D), which confirmed the existence of a reciprocal relationship between the TGEV N protein and NHE3.

FIG 3.

FIG 3

Determination of the interactions between TGEV N protein and NHE3. (A) Tissue IF showing that the TGEV N protein colocalized with NHE3 after TGEV infection. (B) After treatment of IPEC-J2 cells with TGEV and TGEV N protein overexpression plasmids, an overlap between the TGEV N protein and NHE3 could be observed. (C) After TGEV infection of IPEC-J2 cells, there was colocalization between TGEV N protein and NHE3. (D) Co-IP assay demonstrating the mutual interaction between the TGVE N protein and NHE3.

At the same time, we also detected NHE3 by TGEV N IP (Fig. 4A) and by other experiments, which demonstrated that TGEV N proteins did not interact with NHE1 or NHE2 (Fig. 4B and C), and there was no interaction between NHE3 and the TGEV S protein (Fig. 4D).

FIG 4.

FIG 4

Screening of interaction between TGEV and NHEs. (A) Reverse validation of TGEV N interaction with NHE3; (B) verification of the absence of a reciprocal binding relationship between TGEV N and NHE1; (C) verification of the absence of a reciprocal binding relationship between TGEV N and NHE2; (D) verification of the absence of a reciprocal binding relationship between TGEV S and NHE3.

TGEV N protein significantly regulates the amount and activity of NHE3.

First, we examined the effects of transfection with the TGEV N recombinant overexpression vector pEGFP-N and interference vector pLVX-shRNA2 (expressing a short hairpin RNA [shRNA] targeting the TGEV N mRNA) using immunofluorescence and Western blotting. The results showed that both the overexpression vector and interference vector could be stably and consistently expressed in IPEC-J2 cells, which could support subsequent experiments (Fig. 5).

FIG 5.

FIG 5

Transfection and expression of TGEV N recombinant overexpression pEGFP-N and interference plasmids pLVX-shRNA-N. (A) Fluorescent expression of TGEV N after transfection with the recombinant overexpression plasmid; (B) protein levels of TGEV N after transfection with the recombinant overexpression plasmid pEGFP-N; (C) fluorescent expression of TGEV N after transfection with the recombinant interference plasmid; (D) protein levels of TGEV N after transfection with the recombinant interference plasmid pLVX-shRNA-N.

Western blotting showed that TGEV N overexpression significantly reduced the total NHE3 level after 12 h. In contrast, TGEV N interference significantly reversed the decreasing trend in the total NHE3 protein compared with TGEV infection alone (Fig. 6A and B). In addition, the detection of TGEV N protein levels revealed that the TGEV N protein level had an inverse relationship with NHE3 levels (Fig. 6C).

FIG 6.

FIG 6

Detection of NHE3 total protein and TGEV N expression. (A) Western blotting results of total NHE3 protein and TGEV N level after TGEV infection, TGEV N protein overexpression, and interference; (B) quantitative analysis of NHE3 total protein levels; (C) quantitative analysis of TGEV N levels.

NHE3, as a type of Na+/H+ exchanger, exerts its physiological role in the intestine mainly on the intestinal epithelial cell surface. Therefore, detecting its expression on the cell surface could reflect the changes of cellular Na+/H+ exchange activity to some extent. We found that TGEV N caused a significant decrease in the expression of NHE3 on the cell surface (Fig. 7), which was confirmed using immunofluorescence (Fig. 8).

FIG 7.

FIG 7

Determination of NHE3 expression on the cell membrane surface. (A) Western blotting results of NHE3 protein and TGEV N expression after TGEV infection, TGEV N protein overexpression, and interference on the cell membrane surface; (B) quantitative analysis of NHE3 surface protein expression.

FIG 8.

FIG 8

Total and surface NHE3 fluorescence expression in cells after TGEV N overexpression or interference via plasmid transfection. (A) Differential fluorescent expression of total NHE3 in cells after overexpression and interference with TGEV N; (B) differential fluorescent expression of surface NHE3 in cells after overexpression and interference with TGEV N.

By assaying Na+ inside and outside the cell, it was found that the trends of Na+ changes in the extracellular fluid were similar in the three experimental groups, while the Na+ concentration in the extracellular fluid was consistently decreased in the interference group (Fig. 9A). In the detection of sodium ions in the cytoplasm, the TGEV group showed a decreasing trend followed by an increase, while the interference group showed a gradual decrease after a dramatic increase, and the Na+ concentration in N protein overexpression group decreased to a more stable level after an initial increase (Fig. 9B). This suggests that the TGEV N protein can cause changes in the exchange of sodium ions inside and outside the cell and lead to a difference in ion concentration inside and outside the cell.

FIG 9.

FIG 9

Effects of TGEV infection and TGEV N protein on the Na+ concentration inside and outside cells. (A) Effects of TGEV infection, TGEV N protein overexpression, and interference on Na+ levels in the extracellular fluid; (B) effects of TGEV infection, TGEV N protein overexpression, and interference on Na+ in the cytoplasm.

The above results demonstrated that TGEV infection decreases the expression of NHE3 in the cell surface through the N protein, which, in turn, affects its normal physiological function, causing an imbalance in the intra- and extracellular Na+ concentrations and eventually leading to diarrhea.

Screening the specific blocker irinotecan using TGEV N with NHE3 simulated docking conformation.

The TGEV N and NHE3 proteins were modeled based on their amino acid sequences, followed by rigid and flexible docking using Z-Dock and Rosetta, respectively, to select the optimal conformation based on the output model scores. The FDA-approved drugs in the ZINC15 database were used as a library of small molecules for screening, and molecular docking was performed using Autodock Vina. In this process, we identified 10 small-molecule blockers (see Table S1 in the supplemental material). After comprehensive consideration, irinotecan was selected based on its binding free energy and the accessibility of the small molecule. Its chemical structure is shown in Fig. 10A. Thereafter, visualization and interaction force analysis using PyMOL (Fig. 10B and C) showed many direct-acting hydrogen bonds and π-alkyl interactions between the two proteins and irinotecan at several amino acid sites, such as Met343, Tyr339, Lys46, Gly44, and Val294, as well as a certain amount of van der Waals forces, π-π interactions, and salt bridges. Then, using NHE3 IP, we examined the amount of TGEV N that interacted with NHE3 after irinotecan treatment. The results showed that the interaction between NHE3 with TGEV N protein was blocked by irinotecan, demonstrating and confirming the reliability of the screening (Fig. 10D). The results indicated that irinotecan can effectively bind to the interaction regions of TGEV N and NHE3 protein and could be used for follow-up experiments.

FIG 10.

FIG 10

Irinotecan inhibited the interaction between TGEV N and NHE3. (A) Irinotecan chemical structure; (B) irinotecan action position analysis between the two proteins; (C) irinotecan action force analysis with the two proteins; (D) IP validation that irinotecan blocks the interaction between TGEV N and NHE3.

Irinotecan reverses the decrease in NHE3 and diarrhea caused by TGEV in vitro and in vivo.

First, the 50% lethal dose (LD50) of irinotecan on IPEC-J2 cells was determined as 2 mM using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Fig. 11A). We then verified the effects of different concentrations of irinotecan on the expression of NHE3 on the cell membrane surface (Fig. 11B). Irinotecan decreased the expression of NHE3 in a concentration-dependent manner. As shown in Fig. 11C, treatment of TGEV-infected cells with 4 mM irinotecan resulted in a significantly larger amount of NHE3 localized on the cell surface, even higher than that of the mock group. In contrast, irinotecan treatment of TGEV-infected cells resulted in a decrease in TGEV N protein levels, as well as a significant decrease in viral titer (Fig. 11D). In summary, the use of irinotecan after TGEV infection significantly reversed the reduction of NHE3 on the cell surface and significantly reduced TGEV replication.

FIG 11.

FIG 11

Effect of irinotecan on surface NHE3 expression and TGEV replication. (A) MTT assay to detect the LD50 of irinotecan on IPEC-J2 cells; (B) effect of irinotecan on the expression of NHE3 on the membrane surface of IPEC-J2 cells; (C) effect of different concentrations of irinotecan on surface NHE3 expression in IPEC-J2 cells after TGEV infection; (D) TCID50 assay to detect the effect of different concentrations of irinotecan on TGEV replication.

To determine the clinical effect of irinotecan, we used Rongchang pigs as an animal model and conducted clinical tests using irinotecan as a therapeutic and preventive drug for TGEV. The test results showed that the piglets showed diarrhea symptoms 36 h after TGEV infection, and irinotecan could effectively relieve the diarrhea symptoms of piglets when used as a therapeutic drug. The dissection results also showed that there was no significant change in the gastrointestinal tract of piglets treated with irinotecan compared with the mock group (Fig. 12A). qRT-qPCR was performed on intestinal epithelial cells obtained by Ca2+ chelation to verify the expression of the TGEV N gene, which showed that the viral TGEV N gene was not expressed in the intestinal epithelial cells after Irinotecan treatment (Fig. 12B). Western blotting showed that irinotecan treatment significantly reversed the reduction of NHE3 caused by TGEV infection and effectively impeded viral replication (Fig. 12C). Paraffin sectioning and H&E staining of the intestines showed that the number of jejunal villi in piglets returned to normal after irinotecan treatment, while their length was significantly greater than that in the mock group (Fig. 13A to C).

FIG 12.

FIG 12

Animal experiments to test the clinical effect of irinotecan. (A) Effect of irinotecan as a therapeutic and preventive drug on TGEV infection; (B) detection of TGEV N mRNA level in intestinal epithelial cells after irinotecan was used as a therapeutic drug in TGEV-infected piglets; (C) NHE3 and TGEV N protein levels in intestinal epithelial cells of the different experimental groups. h.p.t, hours post treatment.

FIG 13.

FIG 13

Effects of irinotecan on the number and length of intestinal villi. (A) H&E staining of intestinal tissue sections to observe intestinal villus lesions; (B) statistical analysis of intestinal villus length in the different experimental groups; (C) statistical analysis of intestinal villus number in the different experimental groups.

These experiments demonstrated that irinotecan could effectively treat diarrhea caused by TGEV and inhibit the replication of the virus.

DISCUSSION

The worldwide spread of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that started in 2020 has emphasized the importance of coronaviruses in public health. Some studies have shown that a certain percentage of SARS-CoV-2-infected populations show diarrheal symptoms; however, the mechanism is not yet clear (18). In studies conducted on animal coronaviruses, it was found that viral infestation of the intestine leads to villus breakage and atrophy, epithelial cell detachment, and reduced intracellular enzyme activity. The absorption of nutrients and water electrolytes is disturbed, triggering acute malabsorption in the intestine and eventually leading to exudative diarrhea resulting from increased intestinal luminal osmotic pressure and entry of tissue fluid into the intestinal lumen (19, 20). As an important channel protein family responsible for intracellular water and Na+ absorption, maintenance of the pH of the internal environment, and regulation of the homeostasis of the intestinal environment, NHEs have an important role in the process of coronavirus-induced diarrhea (21). However, the member(s) that plays the main role and how it functions was unknown, which became the main focus of our study.

The transcriptome results of jejunal tissue showed that NHE2, NHE3, NHE5, NHE6, and NHE9 all decreased after TGEV infection, while the expressions of NHE1 and NHE8 increased, indicating that NHEs played a role in diarrhea caused by TGEV infection. The member with the highest expression in the jejunum is NHE3, and studies have shown that knockout of NHE3 in mice can cause severe diarrhea (22, 23). Our previous findings revealed that TGEV infection of IPEC-J2 cells affects the expression of NHE3 (16, 17). For these reasons, combined with the results of piglet jejunum transcriptomics, NHE3 is the most reduced and significant of the intestinal NHEs. Therefore, we have examined NHE3 as a target in this research. Our results revealed that NHE3 is an important protein in the Na+ imbalance-induced diarrhea caused by TGEV infection, which provides a reference value for the study of other coronavirus diarrhea-causing mechanisms. Also, our screened drug was effective in treating diarrhea caused by TGEV infection, thus providing new ideas for screening novel therapeutic drugs for animal diseases.

Pigs are the natural host of TGEV, and TGEV infection mainly colonizes and replicates in intestinal epithelial cells; however, some viruses also infect respiratory tract tissues (24). When the pathogen is present, in addition to causing damage to the intestinal mucosa or reducing the absorption area, it also causes abnormalities in the function of intestinal mucosal crypt cells, which, in turn, lead to abnormal water electrolyte absorption, secretion, and retention in the intestines, ultimately causing diarrhea. Studies have shown that TGEV can affect the translocation of NHE3, ultimately leading to diarrhea through four pathways: the epidermal growth factor receptor (EGFR)/extracellular regulated mitogen-activated protein (MAP) kinase (Erk) pathway, the SGLT1-mediated p-38MAPK/AKT2 signaling pathway, the EGFR/EZrin and EGFR/Rsk2 pathways, and the Rab5a/Rab11a/Rab7a pathways (7, 16, 17, 25). Studies of these pathways focused on the regulation of the pathway by TGEV as a whole or by spike proteins (S proteins), which, in turn, affect the expression and activity of NHE3 on the surface, leading to diarrhea. In this study, we identified a TGEV structural protein, nucleocapsid protein (N protein), which directly interacts with NHE3. We also demonstrated that the N protein regulates the expression and activity of NHE3, resulting in impaired intra- and extracellular Na+ exchange and ultimately the development of severe diarrhea.

Coronavirus nucleocapsid proteins play important roles in many aspects, not only in virus proliferation and structure but also in influencing the cell cycle, inducing cellular autophagy, and activating cellular immune responses in the infected host. Current research on the TGEV N protein has focused on its ability to induce apoptosis, autophagy, and an immune response. The relationship between TGEV and diarrhea has been less well studied. It is believed that TGEV reaches the stomach through the respiratory tract and esophagus, entering the small intestine through the stomach, or reaches the small intestinal epithelial cells through the blood circulation from the respiratory tract (2629). The massive proliferation of the virus induces atrophy of the intestinal villi, decreases the length of the villi and the depth of the crypts, and disrupts the transport balance of Na+ and K+, which, in turn, leads to diarrhea and dehydration of the host and even death in piglets (15). In the present studies, the N protein was believed to not to play a major pathogenic role. In our study, we found that the N protein interacts with NHE3 after TGEV infection, and the direct effect of this relationship is a decrease in NHE3 expression and activity, which is an important cause of diarrhea.

The process of drug screening through computer simulation technology is called computer-aided drug virtual screening, in which a computer can be programmed to match small-molecule ligands in databases with specific target molecules, to finally obtain the most effective ligands through comprehensive scoring, followed by experimental validation. Commonly used databases include ZINC, PubChem, and DrugBank. These databases contain natural products, marketed drugs, and numerous active lead compounds. The screening process consists of two key steps. The first step is to obtain the conformation of the target molecule or the site to be docked and to score and rank the obtained conformations using a scoring function (30). The second step is to dock the obtained target molecules with the ligands in the database using machine learning. Irinotecan, identified as a blocker of the interaction between TGEV N and NHE3 in this study, is a water-soluble inhibitor of topoisomerase I. Irinotecan prevents DNA strand rejoining by binding to the topoisomerase I-DNA complex. The drug is used as a first-line agent for advanced colorectal cancer and also for postoperative adjuvant chemotherapy. It is also effective in lung, breast, and pancreatic cancers.

In conclusion, we identified the important role of NHE3 in TGEV-induced Na+ imbalance diarrhea using tenapanor in an animal model. We also identified the interaction between TGEV N protein and NHE3 at the tissue and cellular levels. We further showed that overexpression and interference with TGEV N affected the expression and activity of NHE3. Finally, we identified irinotecan as a potential lead compound to treat TGE and found that it has good therapeutic effects in our animal model (Fig. 14). The results increase our understanding of the potential role of coronavirus N protein in diarrhea-causing effects, which could lead to the development of novel drugs to treat infections by TGEV or other diarrhea-causing coronaviruses.

FIG 14.

FIG 14

NHE3 intracellular-surface transport mechanism. As shown in the physiological section (left), under normal physiological conditions, NHE3 translocates to the surface to exert its Na+/H+ transport function and maintain intra- and extracellular ion homeostasis. Under TGEV infection conditions, as shown in the lower portion, NHE3 cannot be transported to the surface properly because of the interaction between the N protein and NHE3, resulting in a difference in intra- and extracellular Na+ concentrations, which, in turn, leads to diarrhea. Irinotecan, as a therapeutic drug, blocks the interaction between TGEV N protein and NHE3, allowing NHE3 to be transported to the cell surface normally and perform its ion transport function, restoring the ion balance between the inside and the outside of the cell, thus effectively relieving diarrhea and eliminating TGEV.

MATERIALS AND METHODS

Cells, viruses, and reagents.

Porcine kidney cells (ST cells) and experimental pig jejunal cells (IPEC-J2 cells) were both cultured in RPMI 1640 culture medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco) under optimum conditions of 37°C and 5% CO2. IPEC-J2 and ST cells were purchased from Shanghai Sur Biotech Co., Ltd. (Shanghai, China). The TGEV Miller strain was preserved in our laboratory. The intestinal NHE3-specific inhibitor tenapanor was purchased from MedChemExpress (HY-15991; Monmouth Junction, NJ, USA). Irinotecan (97682-44-5) was purchased from MACKLIN (Shanghai, China). Viral fluids were collected from ST cells after replication and after approximately 72 h when the cells showed obvious cytopathic effects (CPEs).

Animal experiments.

Six 3-day-old lactating Rongchang piglets were randomly divided in groups of three into a mock group and a TGEV group. The mock group piglets received 10 mL of saline orally, and the TGEV group was orally infected with 15 mL of 1 × 107 50% tissue culture infective doses (TCID50)/mL of the TGEV Miller strain. After inoculation, clinical signs, such as diarrhea, were assessed daily. Piglets in both groups were uniformly dissected and observed for intestinal lesions after the appearance of significant diarrhea in the TGEV group. The jejunal tissues were immediately extracted, the part to be sectioned for examination was fixed with 4% formaldehyde, and the rest of the tissues were frozen at −80°C.

Thereafter, 10 mL of tenapanor was administered by instillation, and the mock group was treated with saline as described above. The piglets were uniformly dissected when they showed significant diarrhea. Six piglets were used in this experiment, three in each group.

For the irinotecan efficacy trial, we used 12 3-day-old piglets divided into four groups of three each. The mock and TGEV groups were treated in the same manner as described above. In the treatment group, the piglets were first infected with TGEV and then treated with 0.5 mg/kg of body weight of irinotecan fed after the piglets showed significant diarrhea. In the prevention group, the piglets were first fed with 0.5 mg/kg of irinotecan and then infected with TGEV; 72 h later, the piglets were killed and their tissues dissected for further tests.

All animal experiments were approved by the Southwestern University Institutional Animal Care and Use Committee (animal protocol approval number CQLA-2021−0122). The National Institutes of Health guidelines for animal experimental performance were followed.

Transcriptome determination.

(i) RNA isolation, purification, and quantification. Total RNA was isolated and purified using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. The RNA amount and purity of each sample were quantified using a NanoDrop ND-1000 instrument (NanoDrop, Wilmington, DE, USA). An Agilent 2100 instrument was used to check that the RNA integrity number was >7.0.

(ii) cDNA library construction. Poly(A) RNA was purified from total RNA (5 μg) using poly-T oligonucleotide-attached magnetic beads in two rounds of purification. The poly(A) RNA was fragmented into small pieces using divalent cations under high temperature. Subsequently, the cleaved RNA fragments were reverse transcribed to create the cDNA, which was used to synthesize U-labeled second-stranded DNAs with Escherichia coli DNA polymerase I, RNase H, and dUTP. An A-base was then added to the blunt ends of each strand and ligated to modified Illumina multiplex barcode adapters (Illumina, San Diego, CA, USA), which included custom unique molecular identifiers to minimize sequence-dependent bias and amplification noise (31). AMPureXP beads were used for size selection. After heat-labile uracil-DNA glycocasylase (UDG) enzyme treatment of the U-labeled second-stranded DNAs, the ligated products were amplified by PCR under the following conditions: initial denaturation at 95°C for 3 min, 8 cycles of denaturation at 98°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 30 s, and a final extension at 72°C for 5 min. The average insert size for the final cDNA library was 300 bp (±50 bp). Finally, we performed paired-end sequencing on an Illumina HiSeq 4000 instrument (LC Bio, Hangzhou, China), following the vendor’s recommended protocol.

Acquisition of intestinal epithelial cells.

Freshly isolated intestinal tissue epithelial cells were extracted using the Ca2+ chelation method, and the expression of NHE mRNAs and the NHE3 protein in them was determined. The small intestine obtained in the animal test was cut into small pieces, and the intestinal contents were rinsed out using prechilled phosphate-buffered saline (PBS). Thereafter, they were placed in a container containing 0.04% sodium hypochlorite to remove potential contaminants. The intestinal segments were stripped and placed into small conical flasks containing 15 mL of calcium-free phosphate and EDTA and incubated on ice for 15 min. The conical flask was shaken to release the intestinal epithelial cells. The procedure was repeated three times after removal of the chelated intestinal segments, and all suspensions were mixed in a test tube and centrifuged at 1,000 × g for 10 min at 4°C. The supernatant was discarded and the precipitate contained the small intestinal epithelial cells.

qRT-PCR.

Total RNA was extracted and reverse transcribed using RNAiso plus (Invitrogen) and 5× PrimeScript RT master mix (TaKaRa, Shiga, Japan), respectively. The target gene was amplified by quantitative real-time PCR (qPCR), with ACTB (encoding β-actin) as an internal standard. The experiment was performed using a 20-μL system consisting of 10 μL of SYBR PreMix Ex Taq II (TaKaRa), 0.5 μL of forward primer, 0.5 μL of reverse primer, 2 μL of template, and double-distilled water (ddH2O), without RNase. The reaction proceeded at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, and ended at 60°C for 15 s. For each sample, the procedure was repeated thrice. Each sample was repeated three times. The primers used are shown in Table 1. Data analysis was based on the measurement of the cycle threshold (CT). The relative expression levels of the mRNA of the target genes were calculated using the 2−ΔΔCT method (32).

TABLE 1.

Primers used in this study for qRT-PCR

Gene GenBank accession no. Sequence (5′–3′)a
NHE1 NM_001007103.1 F, TCATTGCTTCGGGAGTGG; R, GCAGGGTGCTGATGACAAA
NHE2 NM_001100189.1 F, GGCTTCATAGCGGCGTTT; R, GTGGTGTAGGATTTCTGGGAC
NHE3 FN552547.1 F, GACCATCAAGCCTCTGGTGC; R, AATGTCCTCGATGGCCGAGA
NHE4 XM_003354711.3 F, CTCCTTTCCCTACAGCAACC; R, CATACTCCTCATCCACCACG
NHE5 XM_021094077.1 F, GGCTATCACTACTGGAGGGACA; R, TGCGGCGTGGTTTGTAGA
NHE6 XM_005657924.3 F, ACGCTCACCATTCTCACGA; R, ATCTCCTGCAAGTTGTCCG
NHE7 XM_021080387.1 F, TCCTCGTCTATCGTTGCCTAC; R, GCAGCTTGGTGAACTTGGTC
NHE8 XM_021077956.1 F, ATGTCAGATGTCAGTGGGTGG; R, TCAGGAGGTAGGAAAGAGGG
NHE9 XM_021071131.1 F, GCAGCATTCTTCCAGTCCGT; R, AACAGTGCCGTGACAACAGC
ACTB XM_003124280.5 F, CTCTTCCAGCCCTCCTTCC; R, GGTCCTTGCGGATGTCG
a

F, forward; R, reverse.

Extraction of total proteins and surface proteins.

(i) Extraction of total protein. Cells were lysed using a lysis solution containing 100 mM protease inhibitor in radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Jiangsu, China) and placed in an ice bath for 10 to 15 min. The samples were then placed in liquid nitrogen at room temperature for three consecutive freeze-thaw cycles to completely lyse the cells. Centrifugation was performed at 12,000 × g and 4°C, and the supernatant obtained contained the total protein. The protein concentration was determined using bicinchoninic acid (BCA; Beyotime). Finally, 6× loading buffer equal to one-fifth of the remaining volume was added to the lysate, and then the proteins were denatured at 100°C for 5 min. The level of NHE3 in intestinal epithelial cells was detected using Western blotting.

(ii) Extraction of surface proteins. Surface protein extraction reagent A (1 mL; Beyotime) spiked with phenylmethylsulfonyl fluoride (PMSF) was mixed with the cells. The supernatant was transferred to a new centrifuge tube. Then 200 μL of surface protein extraction reagent B was added to the precipitate, which was vortexed for 5 s to resuspend the precipitate and then placed in an ice bath for 10 min. This procedure was repeated three times. Subsequently, the supernatant was collected by centrifugation at 14,000 × g for 5 min at 4°C. The subsequent steps were performed as described in “Extraction of total protein” above.

Western blotting.

The uniformly quantified protein samples were subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and then the separated proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Merck Millipore, Billerica, MA, USA). The membranes were blocked using 5% skim milk in Tris-buffered saline–Tween 20 (TBST) and then incubated with anti-NHE3 mouse polyclonal antibodies (1:200; GeneCreate Biological, Wuhan, China), anti-TGEV N rabbit polyclonal antibodies (1:200; produced in our laboratory), and anti-β-actin rabbit polyclonal antibodies (1:5,000; Proteintech, Rosemont, IL, USA) overnight at 4°C. The membranes were washed three times with TBST buffer and finally incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit or goat anti-mouse antibodies (Proteintech) for 90 min at 37°C. Images of the membranes were obtained using the FX5 imaging system (VILBER, Collégien, France), and the grayscale values of each band were analyzed by ImageJ software (NIH, Bethesda, MD, USA).

MTT assay.

The inhibitor and drug were dissolved in dimethyl sulfoxide (DMSO) and then diluted to different concentrations using ddH2O. IPEC-J2 cells were seeded in 96-well plates at 1 × 105 cells/mL and cultured overnight at 37°C in 5% CO2. When cells reached 90% confluence in the 96-well plates, the medium was discarded and 100 μL of each gradient dilution of inhibitor or drug was then added to each well. The mock medium was replaced with RPMI 1640. After 90 min of incubation, the supernatant was discarded and the cells were washed twice with PBS. Culture was continued and the CPE was observed daily. The maximum nontoxic dose of inhibitor/drug to the cells was detected using the MTT reagent (BBI, Shanghai, China). The MTT assay was repeated three times independently for each dilution.

H&E staining.

After the tissues were fixed at room temperature for 48 h, paraffin sections were routinely made. Hematoxylin and eosin (H&E) staining was performed using an automatic staining machine, and changes in histopathology and number of villi were observed under light microscopy. The lengths of intestinal villi were measured and analyzed for differences using ZEN software (Rochdale, UK).

Tissue immunological examination.

Paraffin sections were dewaxed and washed three times with ddH2O. After high-temperature and high-pressure repair, the sections were cooled to room temperature and washed twice with phosphate-buffered saline–Tween 20 (PBST). Sections were subjected to 3% hydrogen peroxide treatment for 30 min and then washed twice with 0.01 M PBST. Fetal bovine serum was added dropwise and incubated at room temperature for 30 min. After drying, diluted anti-NHE3 mouse-derived polyclonal antibodies were added dropwise and incubated at 4°C overnight. The next day, the sections were brought back to room temperature and washed three times with PBST. HRP-labeled goat anti-rabbit secondary antibody was added dropwise and incubated for 30 min at room temperature. PBST washes were followed by 3,3′-diaminobenzidine (DAB) color development. Sections were restained with hematoxylin, decolorized in 1% hydrochloric acid-ethanol, treated with anti-blue in PBST, dehydrated in gradient alcohol, and sealed with neutral gel. Finally, positive signals were observed using light microscopy and differences were analyzed by ImageJ software.

Tissue immunofluorescence.

All steps, from pretreatment of paraffin sections to incubation with primary antibody, were completed as described in the preceding paragraph. The sections were reheated to room temperature the next day, cleaned with PBST three times, nuclear stained using 4′,6-diamidino-2-phenylindole (DAPI), and sealed with an antifluorescence quenching reagent. Finally, a confocal laser microscope was used to observe the sections, and ZEN software was used to analyze the differences in the number of fluorescent spots and colocalization.

Co-IP.

Cells were washed with PBS and then 300 μL of precooled immunoprecipitation (IP) lysis/wash buffer was added and incubated on ice for 5 min. Afterward, the cells were transferred to an Eppendorf tube and centrifuged at 13,000 × g for 10 min and the supernatant.

The enhanced AminoLink coupling resin and reagents (Pierce immunoprecipitation kit; Pierce Biotechnology, Rockford, IL, USA) were equilibrated to room temperature and added to a Pierce centrifuge column. The resin was washed with cross-linking buffer and centrifuged, and the flowthrough liquid was discarded. The antibody solution, containing 75 μg of antibody, was added to the column containing the resin, followed by 3 μL of sodium cyanoborohydride solution, and incubated at room temperature for 120 min. After centrifugation, the column was washed twice using 200 μL of 1× cross-linking buffer. Thereafter, 200 μL of quenching buffer was added and centrifuged, and the flowthrough solution was discarded. Next, 200 μL of quenching buffer and 3 μL of sodium cyanoborohydride solution were added to the resin, mixed by inversion, and incubated for 15 min. After centrifugation, the resin was washed twice with 200 μL of 1× cross-linking buffer. Finally, the resin with the immobilized antibody was obtained by washing the resin six times with 150 μL of washing buffer. The sample obtained in the first step was added to the resin with the immobilized antibody. The spiral cap was closed and the column was incubated overnight on a rotary shaker at 4°C. The next day, the column was placed in a collection tube and centrifuged. The screw cap was removed and the column was placed into a new collection tube and washed three times using 200 μL of IP lysis/wash buffer, with centrifugation after each wash. The column was placed in a new collection tube, 10 μL of elution buffer was added, the column was centrifuged, and the supernatant was discarded. Next, 50 μL of elution buffer was added and the column was left to stand at room temperature for 5 min. The eluate containing the bound protein was obtained by centrifugation and collection of the flowthrough solution. The subsequent denaturation and Western blotting steps were carried out as described in “Western blotting” above.

Construction and transfection of overexpression and shRNA interference vectors.

The overexpression vector and shRNA vector (expressing 5′-GCAGAAAGAACAACAATATCC-3′) for the TGEV N protein were synthesized by GeneCreate (Wuhan, China). IPEC-J2 cells were transfected with the TGEV N protein overexpression vector and shRNA expression vector using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. The cells transfected with the shRNA were infected with TGEV. Cell transfected with the control vector were used as the mock group. The cells were assessed using Western blotting and immunofluorescence as described in “Western blotting” and “Tissue immunological examination” above.

Detection of intra- and extracellular Na+ concentrations.

Intracellular and extracellular sodium ion concentrations were detected using flame atomic absorption spectrometry. Plasma cells were lysed using RIPA solution as intracellular sodium ion samples and extracellular fluid samples were collected from the cell culture supernatant. One milliliter of 1,000-mg/mL Na+ standard solution was diluted into a standard working solution. Different concentrations of Na+ solutions were prepared to construct the standard curve. The samples were diluted 5 × 103 times and detected using a TAS-990 atomic absorption spectrometer (Beijing Purkinje General Instrument Co., Ltd., Beijing, China) with the following conditions: wavelength, 589 nm; negative high voltage, 297 V; current, 2 mA; and gas flow rate, 1,200 mL/min.

Molecular docking and drug screening.

Using the Phyre2 website, model construction was performed based on protein sequences (33). After construction, the model was energy released using Rosetta’s Relax module to achieve the optimal conformation for subsequent protein docking. The optimized protein model was scored on the SAVES 6.0 online website (https://saves.mbi.ucla.edu/), and subsequent protein docking and molecular docking were deemed possible based on the score (34). To initially confirm the interaction sites of the two proteins, protein docking was performed. Rigid docking was first performed using the Z-dock online server to obtain the initial conformation of the two proteins. Next, the flexible docking of the proteins was performed using “Docking_Prepack” and “Docking” of the Rosetta software. The models were scored according to the output “total_score,” and the model with the lowest score was selected as the model for subsequent analysis and molecular docking. Small molecules from the FDA-approved drugs in the Zinc15 database were used as a library for screening, and the Autodock Vina program was used for molecular docking (35, 36). Irinotecan was selected as the output based on binding free energy and small-molecule accessibility, and interaction force analysis was performed using PyMOL (37).

TCID50 assay for the virus titer.

IPEC-J2 cells treated with irinotecan were sampled at 24 h postinfection (hpi) and then frozen and thawed three times to collect the virus from the cells and supernatant. The virus was gradient diluted to 10−1 and 10−7. TGEV titers of IPEC-J2 cells treated with irinotecan for different times were assayed in 96-well plates using ST cells. Each dilution gradient was assayed in 12 replicate wells. The TCID50 of the virus in the different groups was calculated using the Reed and Muench method (38).

Statistical analysis.

All statistical analyses were performed using GraphPad Prism 8.0 (GraphPad Inc., La Jolla, CA, USA). All data are presented as the means ± standard deviations (SD) or with the standard errors of the mean (SE) from three independent experiments. One-way analysis of variance (ANOVA) and t tests were used to determine the statistical differences among multiple groups. P values less than 0.05 were considered statistically significant (in the figures, significance is indicated as follows: *, P value < 0.05; **, P value < 0.01; ***, P value < 0.001; and ****, P value < 0.0001).

Footnotes

Supplemental material is available online only.

Supplemental file 1
Table S1. Download jvi.01473-22-s0001.xlsx, XLSX file, 0.01 MB (12.7KB, xlsx)

Contributor Information

ZhenHui Song, Email: szh7678@126.com.

Tom Gallagher, Loyola University Chicago.

REFERENCES

  • 1.Laude H, Rasschaert D, Delmas B, Godet M, Gelfi J, Charley B. 1990. Molecular biology of transmissible gastroenteritis virus. Vet Microbiol 23:147–154. 10.1016/0378-1135(90)90144-K. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kim B, Chae C. 2001. In situ hybridization for the detection of transmissible gastroenteritis virus in pigs and comparison with other methods. Can J Vet Res 65:33–37. [PMC free article] [PubMed] [Google Scholar]
  • 3.Chae C, Kim O, Choi C, Min K, Cho WS, Kim J, Tai JH. 2000. Prevalence of porcine epidemic diarrhoea virus and transmissible gastroenteritis virus infection in Korean pigs. Vet Rec 147:606–608. 10.1136/vr.147.21.606. [DOI] [PubMed] [Google Scholar]
  • 4.Kiela PR, Ghishan FK. 2016. Physiology of intestinal absorption and secretion. Best Pract Res Clin Gastroenterol 30:145–159. 10.1016/j.bpg.2016.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Anderegg MA, Gyimesi G, Ho TM, Hediger MA, Fuster DG. 2022. The less well-known little brothers: the SLC9B/NHA sodium proton exchanger subfamily—structure, function, regulation and potential drug-target approaches. Front Physiol 13:898508. 10.3389/fphys.2022.898508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Alexander RT, Grinstein S. 2009. Tethering, recycling and activation of the epithelial sodium-proton exchanger, NHE3. J Exp Biol 212:1630–1637. 10.1242/jeb.027375. [DOI] [PubMed] [Google Scholar]
  • 7.Ran L, Yan T, Zhang Y, Niu Z, Kan Z, Song Z. 2021. The recycling regulation of sodium-hydrogen exchanger isoform 3(NHE3) in epithelial cells. Cell Cycle 20:2565–2582. 10.1080/15384101.2021.2005274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chow CW, Khurana S, Woodside M, Grinstein S, Orlowski J. 1999. The epithelial Na+/H+ exchanger, NHE3, is internalized through a clathrin-mediated pathway. J Biol Chem 274:37551–37558. 10.1074/jbc.274.53.37551. [DOI] [PubMed] [Google Scholar]
  • 9.D’Souza S, Garcia-Cabado A, Yu F, Teter K, Lukacs G, Skorecki K, Moore HP, Orlowski J, Grinstein S. 1998. The epithelial sodium-hydrogen antiporter Na+/H+ exchanger 3 accumulates and is functional in recycling endosomes. J Biol Chem 273:2035–2043. 10.1074/jbc.273.4.2035. [DOI] [PubMed] [Google Scholar]
  • 10.Pang T, Su X, Wakabayashi S, Shigekawa M. 2001. Calcineurin homologous protein as an essential cofactor for Na+/H+ exchangers. J Biol Chem 276:17367–17372. 10.1074/jbc.M100296200. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang Q, Ying X, Rong C, Tong D, Xu X. 2018. Transmissible gastroenteritis virus N protein causes endoplasmic reticulum stress, up-regulates interleukin-8 expression and its subcellular localization in the porcine intestinal epithelial cell. Res Vet Sci 119:109–115. 10.1016/j.rvsc.2018.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kopecky-Bromberg SA, Martinez-Sobrido L, Frieman M, Baric RA, Palese P. 2007. Severe acute respiratory syndrome coronavirus open reading frame (ORF) 3b, ORF 6, and nucleocapsid proteins function as interferon antagonists. J Virol 81:548–557. 10.1128/JVI.01782-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fernandes-Siqueira LO, Ferreira FAP, Sousa BG, Mebus-Antunes NC, Neves-Martins TC, Almeida FCL, Ferreira GC, Salmon D, Wermelinger LS, Da Poian AT. 2022. On the caveats of a multiplex test for SARS-CoV-2 to detect seroconversion after infection or vaccination. Sci Rep 12:10366. 10.1038/s41598-022-14294-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Masters PS. 2019. Coronavirus genomic RNA packaging. Virology 537:198–207. 10.1016/j.virol.2019.08.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sánchez CM, Gebauer F, Suñé C, Mendez A, Dopazo J, Enjuanes L. 1992. Genetic evolution and tropism of transmissible gastroenteritis coronaviruses. Virology 190:92–105. 10.1016/0042-6822(92)91195-Z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yang Z, Ran L, Yuan P, Yang Y, Wang K, Xie L, Huang S, Liu J, Song Z. 2018. EGFR as a negative regulatory protein adjusts the activity and mobility of NHE3 in the cell membrane of IPEC-J2 cells with TGEV infection. Front Microbiol 9:2734. 10.3389/fmicb.2018.02734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yang Y, Yu Q, Song H, Ran L, Wang K, Xie L, Huang S, Niu Z, Zhang Y, Kan Z, Yan T, Song Z. 2020. Decreased NHE3 activity and trafficking in TGEV-infected IPEC-J2 cells via the SGLT1-mediated P38 MAPK/AKt2 pathway. Virus Res 280:197901. 10.1016/j.virusres.2020.197901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Britton GJ, Chen-Liaw A, Cossarini F, Livanos AE, Spindler MP, Plitt T, Eggers J, Mogno I, Gonzalez-Reiche AS, Siu S, Tankelevich M, Grinspan LT, Dixon RE, Jha D, van de Guchte A, Khan Z, Martinez-Delgado G, Amanat F, Hoagland DA, tenOever BR, Dubinsky MC, Merad M, van Bakel H, Krammer F, Bongers G, Mehandru S, Faith JJ. 2021. Limited intestinal inflammation despite diarrhea, fecal viral RNA and SARS-CoV-2-specific IgA in patients with acute COVID-19. Sci Rep 11:13308. 10.1038/s41598-021-92740-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Praetorius J. 2010. Na+-coupled bicarbonate transporters in duodenum, collecting ducts and choroid plexus. J Nephrol 23(Suppl 16):S35–S42. [PubMed] [Google Scholar]
  • 20.Feng Y, Xu Z, Zhu L. 2020. Prevalence and phylogenetic analysis of porcine deltacoronavirus in Sichuan province, China. Arch Virol 165:2883–2889. 10.1007/s00705-020-04796-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Arena EA, Longo WE, Roberts KE, Geibel P, Nateqi J, Brandstetter M, Geibel JP. 2012. Functional role of NHE4 as a pH regulator in rat and human colonic crypts. Am J Physiol Cell Physiol 302:C412–C418. 10.1152/ajpcell.00163.2011. [DOI] [PubMed] [Google Scholar]
  • 22.Singh V, Yang J, Cha B, Chen T, Sarker R, Yin J, Avula LR, Tse M, Donowitz M. 2015. Sorting nexin 27 regulates basal and stimulated brush border trafficking of NHE3. Mol Biol Cell 26:2030–2043. 10.1091/mbc.E14-12-1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Enns CB, Keith BA, Challa N, Harding JCS, Loewen ME. 2020. Impairment of electroneutral Na+ transport and associated downregulation of NHE3 contributes to the development of diarrhea following in vivo challenge with Brachyspira spp. Am J Physiol Gastrointest Liver Physiol 318:G288–G297. 10.1152/ajpgi.00011.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jia S, Feng B, Wang Z, Ma Y, Gao X, Jiang Y, Cui W, Qiao X, Tang L, Li Y, Wang L, Xu Y. 2019. Dual priming oligonucleotide (DPO)-based real-time RT-PCR assay for accurate differentiation of four major viruses causing porcine viral diarrhea. Mol Cell Probes 47:101435. 10.1016/j.mcp.2019.101435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Stegeman H, Span PN, Kaanders JHAM, Bussink J. 2014. Improving chemoradiation efficacy by PI3-K/AKT inhibition. Cancer Treat Rev 40:1182–1191. 10.1016/j.ctrv.2014.09.005. [DOI] [PubMed] [Google Scholar]
  • 26.Delmas B, Gelfi J, L’Haridon R, Vogel LK, Sjöström H, Norén O, Laude H. 1992. Aminopeptidase N is a major receptor for the enteropathogenic coronavirus TGEV. Nature 357:417–420. 10.1038/357417a0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rossen JW, Bekker CP, Voorhout WF, Strous GJ, van der Ende A, Rottier PJ. 1994. Entry and release of transmissible gastroenteritis coronavirus are restricted to apical surfaces of polarized epithelial cells. J Virol 68:7966–7973. 10.1128/JVI.68.12.7966-7973.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lu X, Yang Y, Wang J, Jing Y, Qian Y. 2018. Impact of TGEV infection on the pig small intestine. Virol J 15:102. 10.1186/s12985-018-1012-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Schwegmann-Wessels C, Bauer S, Winter C, Enjuanes L, Laude H, Herrler G. 2011. The sialic acid binding activity of the S protein facilitates infection by porcine transmissible gastroenteritis coronavirus. Virol J 8:435. 10.1186/1743-422X-8-435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Meng XY, Zhang HX, Mezei M, Cui M. 2011. Molecular docking: a powerful approach for structure-based drug discovery. Curr Comput Aided Drug Des 7:146–157. 10.2174/157340911795677602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Shiroguchi K, Jia TZ, Sims PA, Xie XS. 2012. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes. Proceedings of the National Academy of Sciences 109:1347–1352. 10.1073/pnas.1118018109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408. 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 33.Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJE. 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10:845–858. 10.1038/nprot.2015.053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Colovos C, Yeates TO. 1993. Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci 2:1511–1519. 10.1002/pro.5560020916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sterling T, Irwin JJ. 2015. ZINC 15—ligand discovery for everyone. J Chem Inf Model 55:2324–2337. 10.1021/acs.jcim.5b00559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Trott O, Olson AJ. 2009. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31:455–461. 10.1002/jcc.21334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schrödinger, LLC. 2015. The PyMOL molecular graphics system, version 1.8.
  • 38.Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. Am J Hyg 27:493–497. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Table S1. Download jvi.01473-22-s0001.xlsx, XLSX file, 0.01 MB (12.7KB, xlsx)


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES