Skip to main content
NCBI home page
Springer logoLink to Springer
. 2022 Aug 9;46(4):1209–1219. doi: 10.1007/s11259-022-09980-x

Spotted fever group Rickettsia, Anaplasma and Coxiella-like endosymbiont in Haemaphysalis ticks from mammals in Thailand

Supanee Hirunkanokpun 1, Arunee Ahantarig 2, Visut Baimai 2, Pairot Pramual 3, Pakavadee Rakthong 4, Wachareeporn Trinachartvanit 2,✉
PMCID: PMC9684344  PMID: 35945408

Abstract

Ticks are ectoparasites of vertebrates and vectors of various pathogenic microorganisms. In this study, the presence of bacteria and protozoa was evaluated by PCR and DNA sequencing in 233 mammal ticks collected from 8 provinces in Thailand. Sequence and phylogenetic analyses of partial rickettsial ompA, ompB, sca4 and partial Coxiella 16S rRNA, GroEL, rpoB genes clearly revealed, for the first time, a co-infection of SFG Rickettsia belonging to R. massiliae subgroup and Coxiella-like endosymbiont (CLE), Cox-hein, in a male of Haemaphysalis heinrichi tick infesting Burmese ferret-badger in Loei province. Moreover, a male of H. hystricis tick infesting the same host was infected with another CLE, Cox-hys. Based on the 16S rRNA gene sequence, Anaplasma sp., closely related to Anaplasma bovis was also detected in a male of H. heinrichi infesting the same Burmese ferret-badger. In addition, the third CLE, Cox-asia, found in H. asiatica collected from Asian palm civet in Chiang Rai province, was different from both Cox-hein and Cox-hys. This study provided important data and broadened our knowledge on tick-borne pathogens and endosymbionts in Thailand and Southeast Asia.

Keywords: Tick, SFG Rickettsia, Coxiella, Anaplasma, Burmese ferret-badger, Asian palm civet

Introduction

Ticks are important vectors of infectious pathogens including bacteria, protozoa, and viruses. The obligate intracellular bacteria, Rickettsia, is notorious for causing infection and mild to severe diseases in humans and other mammals (Raoult and Roux 1997). Based on phylogenomic analyses, members of the genus Rickettsia are classified into four groups, namely, spotted fever group (SFG), typhus group (TG), transitional group (TRG), and ancestral group (AG) (Gillespie et al. 2007).

Coxiella burnetii is the etiological agent of a worldwide zoonotic disease called Q fever. In Thailand, infective endocarditis caused by C. burnetii has been reported (Pachirat et al. 2012). Both animals and humans can be infected by this bacterium, usually through inhalation of contaminated aerosols. Its reservoir hosts comprise mammals, birds, and arthropods, particularly ticks (Raoult and Marrie 1995). However, the role of ticks as the vector of C. burnetii remains controversial. Many Ixodidae and Argasidae ticks, including Amblyomma, Dermacentor, Haemaphysalis, Ixodes, Rhipicephalus, Argas, and Ornithodoros also harbor Coxiella-like endosymbionts (CLE) (Duron et al. 2015). Thus far, there is no evidence of the transmission of CLE by ticks to vertebrates. In addition to CLE, another endosymbiont commonly found in many arthropods and filarial nematodes is Wolbachia bacteria. In arthropods, Wolbachia has been reported to manipulate host reproduction including cytoplasmic incompatibility, parthenogenesis, feminization of genetic males, and male killing. Therefore, current research focuses on Wolbachia application to protect humans from vector-borne diseases (Werren et al. 2008).

Anaplasma and Ehrlichia are tick-transmitted bacteria in the family Anaplasmataceae, order Rickettsiales. Anaplasma is an obligate intracellular bacterium living in mammal blood cells. Members of this genus include tick-borne pathogens causing fatal infectious diseases in humans and catastrophic diseases in animals (Dumler et al. 2001). Anaplasmosis in humans is principally caused by Anaplasma phagocytophilum. Anaplasma has also been found in ticks of the family Ixodidae, including the genera Amblyomma, Dermacentor, Ixodes, and Rhipicephalus (Dumler et al. 2001). Ehrlichia spp. are obligatory intracellular bacteria that cause ehrlichiosis in animals and humans. In Thailand, several Ehrlichia spp. that are the etiologic agents of ehrlichiosis including E. canis, E. chaffeensis, and E. platys, have been reported (Parola et al. 2003; Pinyoowong et al. 2008).

Lyme disease is a tick-borne disease caused by Borrelia burgdorferi, whose main vectors are Ixodes ticks, i.e., Ixodes ricinus and Ixodes scapularis. This bacterial pathogen has also been reported to be carried by other tick genera, namely Amblyomma, Dermacentor, Haemaphysalis, Hyalomma, and Rhipicephalus. Moreover, other members of the genus Borrelia are known to be the cause of human diseases, for example, B. afzelii and B. garinii (Margos et al. 2009).

Babesia spp. and Hepatozoon canis are tick-transmitted apicomplexan parasites that are causative agents found in dogs, cattle, and wild animal species (Baneth 2011; Gray et al. 2019). Babesiosis is caused by several Babesia spp. which are transmitted by hard ticks such as Rhipicephalus sanguineus, H. longicornis, and H. elliptica (Gray et al. 2019). Hepatozoon canis is the causative agent of hepatozoonosis widely distributed in many countries (Baneth 2011). Although the brown dog tick, R. sanguineus, is the main vector of H. canis, this pathogen also infects several other tick species, e.g., Ambylomma ovale, H. flava, H. longicornis, R. microplus, and R. turanicus (Baneth 2011; Demoner et al. 2013; Giannelli et al. 2017).

The study of pathogens that are transmitted by ticks will be useful for understanding the role of ticks as vectors of human and other animal disease agents. This information is crucial for effective monitoring and control of tick-borne diseases. Thus, the aim of this study was to investigate the presence of bacteria and protozoa in mammal ticks collected from several regions in Thailand using molecular approaches.

Materials and methods

Tick collection and identification

A total of 233 ticks were collected from domestic and road-killed mammals (23 hosts belonging to 7 species) in 8 provinces of Thailand during 2015–2019 (Table 2). All tick samples were kept in labeled collection vials individualized per host, containing 70% ethanol. They were identified morphologically by using a stereomicroscope following previously published taxonomic keys (Cooley 1946; Wassef and Hoogstraal 1984; Tanskul and Inlao 1989). Species of ticks were molecularly identified by partial sequencing of 16S rRNA gene (Black and Piesman 1994) to confirm their morphological identifications.

Table 2.

PCR results of Rickettsia, Coxiella, and Anaplasma in mammal ticks collected from 8 provinces in Thailand

Province Mammal host (No.) Tick species (No.) No. of samples tested PCR results: No. of positive ticks
Rickettsia Coxiella Anaplasma
1. Chiang Rai Dog (2) Rhipicephalus sanguineus (22) 12M, 10F - - -
Cow (2) Rhipicephalus microplus (9) 4M, 5F - - -
Asian palm civet (1) Haemaphysalis asiatica (15) 9M, 6F - 6M -
2. Loei Burmese ferret-badger (1) Haemaphysalis heinrichi (6) 1M - - 1M
1M 1M* 1M* -
2M, 2F - - -
Haemaphysalis hystricis (1) 1M - 1M -
Dermacentor auratus (8) 8N - - -
3. Roi Et Cow (1) Haemaphysalis bispinosa (11) 5M, 6F - - -
Cow (1) Rhipicephalus microplus (15) 4M, 2F - - -
1PN (n=5) - - -
1PN (n=4) - - -
4. Chumphon Dog (2) Rhipicephalus sanguineus (18) 9M, 9F - - -
5. Surat Thani Dog (3) Rhipicephalus sanguineus (21) 7M, 9F - - -
1PN (n=5) - - -
6. Ranong Dog (2) Rhipicephalus sanguineus (10) 6M, 4F - - -
Cow (1) Rhipicephalus microplus (15) 4M, 11F - - -
7. Phang Nga Cow (2) Rhipicephalus microplus (32) 14M, 18F - - -
Sheep (1) Haemaphysalis bispinosa (11) 2M, 9F - - -
Goat (1) Haemaphysalis bispinosa (20) 3M, 17F - - -
8. Satun Cat (1) Haemaphysalis bispinosa (15) 1PN (n=3) - - -
1PN (n=3) - - -
1PL (n=5) - - -
1PL (n=4) - - -
Sheep (1) Haemaphysalis bispinosa (2) 2M - - -
Goat (1) Haemaphysalis bispinosa (2) 1PN (n=2) - - -
Total 23 233 210 1 8 1
Open in a new tab

F female; M male; N nymph; PN pooled nymphs; PL pooled larvae; - PCR negative; * co-infection

DNA extraction and PCR amplification

Each individual tick was rinsed in 10% sodium hypochlorite, 70% ethanol, and sterile distilled water three times (1 min each). Genomic DNA was extracted from individual adults, nymphs, pooled nymphs, and pooled larvae using the QIAamp DNA Extraction Kit for Tissue (QIAGEN) according to the manufacturer’s protocol. The presence of bacteria and protozoa, including Anaplasma, Borrelia, Coxiella, Ehrlichia, Rickettsia, Wolbachia, Babesia, and Hepatozoon in tick samples was initially screened by Polymerase Chain Reaction (PCR) using primers as shown in Table 1. For Rickettsia characterization, the primers Rr17.61p/Rr17.492n were initially used to amplify a 434 bp fragment of the 17-kDa antigen gene. Subsequently, the 17-kDa-positive samples were amplified and sequenced with primers specific to gltA, ompA, ompB, and sca4 genes (Webb et al. 1990; Regnery et al. 1991; Roux and Raoult 2000; Jiang et al. 2005). For Coxiella, the 16S rRNA positive samples were further amplified with primers targeting rpoB (DNA directed RNA polymerase beta) and GroEL (60 kDa chaperone heat shock protein B) genes (Duron et al. 2014, 2015). Additionally, the positive sample tested with EHR16SD/EHR16SR primers was amplified and sequenced with Anaplasma 16S rRNA primers as previously described by Zobba et al. (2014) (Table 1).

Table 1.

Primers used for PCR detection of bacterial/protozoal microorganisms and tick DNA

Target organism Target gene Primer name Primer sequences (5´-3´) Amplification fragment size (bp) References
Rickettsia spp. 17-kDa antigen Rr17.61p GCTCTTGCAACTTCTATGTT 434 Webb et al. 1990
Rr17.492n CATTGTTCGTCAGGTTGGCG
Citrate synthase (gltA) RpCS.877p GGGGGCCTGCTCACGGCGG 381 Regnery et al. 1991
RpCS.1258n ATTGCAAAAAGTACAGTGAACA
190-kDa protein antigen (ompA) Rr190.70p ATGGCGAATATTTCTCCAAAA 532 Regnery et al. 1991
Rr190.602n AGTGCAGCATTCGCTCCCCCT
120-kDa protein antigen (ompB) RicF CAGCAAGGTAATAAGTTTAATAC  ~ 800 Hirunkanokpun et al. 2022
RicR GCTATACCGCCTGTAGTAACAG
120-kDa cytoplasmic protein (sca4) RrD749F TGGTAGCATTAAAAGCTGATGG  ~ 1,090 Jiang et al. 2005
RrD1826R TCTAAATKCTGCTGMATCAAT
Coxiella spp. 16S rRNA 16S rRNA F GGGGAAGAAAGTCTCAAGGGTAATATCCTT 532 Almeida et al. 2012
16S rRNA R TGCATCGAATTAAACCACATGCTCCACCGC
rpoB CoxrpoBF2 GGGCGNCAYGGWAAYAAAGGSGT 607–610 Duron et al. 2015
CoxrpoBR1 CACCRAAHCGTTGACCRCCAAATTG
CoxrpoBF3 TCGAAGAYATGCCYTATTTAGAAG 539–542
CoxrpoBR3 AGCTTTMCCACCSARGGGTTGCTG
GroEL CoxGrF1 TTTGAAAAYATGGGCGCKCAAATGGT 655 Duron et al. 2014
CoxGrR2 CGRTCRCCAAARCCAGGTGC
CoxGrF2 GAAGTGGCTTCGCRTACWTCAGACG 619
CoxGrFR1 CCAAARCCAGGTGCTTTYAC
Anaplasmataceae 16S rRNA EHR16SD GGTACCYACAGAAGAAGTCC 345 Parola et al. 2000
EHR16SDR TAGCACTCATCGTTTACAGC
Anaplasma spp. 16S rRNA AnaplsppF AGAAGAAGTCCCGGCAAACT  ~ 800 Zobba et al. 2014
AnaplR3 GAGACGACTTTTACGGATTAGCTC
Babesia spp. 18S rRNA F GTTTCTGMCCCATCAGCTTGAC 422–440 Hilpertshauser et al. 2006
R CAAGACAAAAGTCTGCTTGAAAC
Borrelia spp. 16S rRNA 16SF1 ATAACGAAGAGTTTGATCCTGGC 1,350 Masuzawa et al. 1999
16SR CAGCCGCACTTTCCAGTACG
Hepatozoon spp. 18S rRNA HepF300 GTTTCTGACCTATCAGCTTTCGAC G  ~ 600 Ujvari et al. 2004
Hep900 C AAATCTAAGAATTTCACCTCTGAC
Wolbachia ftsZ ftsF GTATGCCGATTGCAGAGCTTG 769 Holden et al. 1993
ftsR GCCATGAGTATTCACTTGGCT
Tick 16S rRNA 16S + 1 CTGCTCAATGATTTTTTAAATTGCTGTGG 460 Black and Piesman 1994
16S-1 CCGGTCTGAACTCAGATCAAGT
Open in a new tab

DNA sequencing and phylogenetic analysis

All positive amplicons were purified using the GF-1 Ambi Clean kit (Vivantis) according to the manufacturer’s instructions and sequenced in both directions on an ABI 3730xl DNA analyzer (Applied Biosystems). All obtained DNA sequences were assembled and edited using BioEdit (Alzohairy 2011). Edited sequences were assembled into a contig using SeqMan software (DNASTAR, Lasergene), and thus were subjected to BLASTn analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to find sequence similarity to known sequences. Phylogenetic analyses were performed using the maximum parsimony method (PAUP v. 4.0b1) and bootstrap analysis was calculated with 1,000 replicates.

Results

Identification of ticks

A total of 23 mammals from 8 provinces of Thailand were examined for tick infestation. These mammals belonged to seven species: dogs (Canis lupus familiaris), cat (Felis catus), sheep (Ovis aries), goats (Capra aegagrus hircus), cattle (Bos primigenius taurus), Asian palm civet (Paradoxurus hermaphroditus), and Burmese ferret-badger (Melogale personata). In total, 233 tick specimens comprising seven species belonging to three genera were identified as follows: R. sanguineus (71/233; 30.5%), R. microplus (71/233; 30.5%), H. bispinosa (61/233; 26.2%), H. asiatica (15/233; 6.4%), H. heinrichi (6/233; 2.6%), H. hystricis (1/233; 0.4%), and Dermacentor auratus (8/233; 3.4%) (Table 2).

The results of tick molecular identifications were consistent with morphological identifications using taxonomic key. The partial mitochondrial 16S rRNA gene sequences of ticks were submitted to GenBank under accession numbers as following: ON055731 (H. asiatica), ON062951 (H. hystricis), and ON074588 (H. heinrichi).

Detection of tick-borne bacteria and protozoa in tick samples

A total of 233 tick specimens were molecularly detected for bacterial and protozoal microorganisms by PCR technique. All tick samples collected from domestic mammals showed PCR negative results while some of the ticks collected from Burmese ferret-badger in Loei province and from Asian palm civet in Chiang Rai province were positive for Rickettsia (0.4%; 1/233) and Coxiella (3.4%; 8/233) (Table 2). Rickettsial DNA was detected in a male of H. heinrichi. Coxiella-like endosymbionts were detected in a male of H. hystricis (Cox-hys), six males of H. asiatica (Cox-asia), and a male of H. heinrichi (Cox-hein) which was co-infected with SFG Rickettsia sp. Interestingly, Anaplasma DNA was detected in another male of H. heinrichi infesting Burmese ferret-badger from Loei province (Table 2). None of the 233 mammal ticks gave specific PCR products of Borrelia, Ehrlichia, Wolbachia, Babesia, and Hepatozoon.

DNA sequencing and phylogenetic analysis of tick-borne bacteria

The partial sequences of Rickettsia sp. in a male of H. heinrichi were submitted to GenBank under accession numbers MW415893 (17-kDa antigen), MW415895 (gltA), MW415897 (ompA), OK031073 (ompB), and OK031072 (sca4). The DNA sequences of CLE detected in H. heinrichi (Cox-hein), H. hystricis (Cox-hys), and H. asiatica (Cox-asia) were submitted to GenBank under accession numbers: MW404679, MW404677, and MW404676 for partial 16S rRNA; OK031069, OK031070, and OK031071 for partial GroEL; OK031066, OK031067, and OK031068 for partial rpoB. The GenBank accession number of partial 16S rRNA of Anaplasma sp. detected from a male of H. heinrichi was MW405449.

The BLAST result of partial sequences of 17-kDa amplified from a male of H. heinrichi indicated a high nucleotide sequence similarity (99.08–99.54%) to SFG rickettsiae members, namely R. rhipicephali (MN477896), R. massiliae (KY069262), and R. raoultii (MW321554). Likewise, the BLAST result of partial gltA derived from the same tick showed high similarity (98.17–98.69%) to R. rhipicephali (KX018048), R. massiliae (KY640405), and other members of SFG rickettsiae, including R. raoultii, R. japonica, and R. heilongjiangensis. However, a more variable gene, ompA partial sequence obtained from this tick, was highly similar (98.12–98.31%) only to members of R. massiliae subgroup: R. rhipicephali (CP003342) and R. massiliae (MT309019, MW779485, etc.). Correspondingly, the results for partial ompB and sca4 sequences demonstrated the highest similarity to members of R. massiliae subgroup; 96.65% with R. rhipicephali (AF123719, CP003342) and 96.97% with R. massiliae (CP003319, DQ503429). Phylogenetic trees inferred from partial sequences of these genes revealed three groups of rickettsiae, comprising SFG, TRG, and TG. The SFG rickettsiae sequences utilized in phylogenetic analysis contained two subgroups: R. rickettsii and R. massiliae. Rickettsia sp. detected in this study was grouped in the SFG clade, clustered with members of the R. massiliae subgroup, including R. rhipicephali, R. massiliae, R. aeschimannii, Rickettsia sp. TwKM01, and Rickettsia sp. Bar29 (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Maximum parsimony tree of Rickettsia spp. based on the partial sequences of ompA (a), ompB (b), and sca4 (c) genes. The bootstrap values are shown above or near branch. Rickettsia spp. detected in present study are indicated in bold

Based on three partial sequences of 16S rRNA, GroEL, and rpoB, all Coxiella spp. amplified from three Haemaphysalis tick species were CLE. In contrast, C. burnetii was not detected in this study. Nucleotide sequences of the three CLE (Cox-hein, Cox-hys, and Cox-asia) were different from each other. The BLAST results of these Coxiella partial 16S rRNA sequences indicated that their nucleotide sequences were highly similar to other CLE of several Haemaphysalis tick species represented in GenBank (98.52–100%). However, BLAST results of partial GroEL and rpoB sequences showed lower level of nucleotide sequence similarity to other CLE available in GenBank than that found with 16S rRNA. The nucleotide sequence similarity of CLE detected in this study was 89.42–93.64% for GroEL and 91.04–100% for rpoB. Phylogenetic analysis of partial 16S rRNA revealed that Cox-hein and Cox-hys in ticks removed from Burmese ferret-badger were grouped in the same subclade of clade D, while Cox-asia in ticks removed from Asian palm civet was placed in another subclade (Fig. 2). In contrast, the phylogenetic trees generated from the partial sequences of GroEL and rpoB, Cox-hein were more closely related to Cox-asia than to Cox-hys (Fig. 2). However, all three CLE detected in this study were grouped in clade D with other CLE of Haemaphysalis ticks from previous reports.

Fig. 2.

Fig. 2

Open in a new tab

Maximum parsimony tree of Coxiella spp. based on the partial sequences of 16S rRNA (a), GroEL (b), and rpoB (c) genes. The bootstrap values were shown above or near the branch. Coxiella endosymbionts detected in this study are indicated in bold. Three clades of Coxiella are indicated as A, B, and D which were originally defined by Duron et al. 2015

Anaplasma sp. was found only in a male of H. heinrichi using PCR with 16S rRNA primers. BLAST results of the partial sequences of 16S rRNA illustrated a remarkably high similarity (99.73%; 730/732 bp) to several strains of A. bovis, for example, Zhengxiaocon-goat-48 (MH255939), ZJ69 (KP062958), sika35 (LC060988), NR07 (AB196475), and many other strains. Based on phylogenetic analysis of partial 16S rRNA gene sequences, Anaplasma sp. detected in this study manifestly belonged to the same clade with A. bovis with strong bootstrap support (100%) (Fig. 3). The results of BLAST and phylogenetic analysis thus explicitly demonstrated that a male of H. heinrichi was infected with Anaplasma sp. closely related to A. bovis.

Fig. 3.

Fig. 3

Open in a new tab

Maximum parsimony tree of Anaplasma spp. based on the partial 16S rRNA gene sequences. The bootstrap values are shown above the branch. The Anaplasma sp. sequence obtained in present study is indicated in bold

Discussion

Ticks serve as vectors and/or reservoirs of several pathogens such as Anaplasma, Coxiella, Ehrlichia, and Rickettsia (Walker and Yu 2012). To better understand tick-associated microorganisms among various mammal ticks in Thailand, we conducted specific molecular screening for the presence of bacterial and protozoal microorganisms. Previous studies showed that Rickettsia spp. were widely distributed throughout Thailand in various locations, hosts, and in tick species, including H. ornithophila, Amblyomma testudinarium, H. shimoga, H. lagrangei, A. helvolum, and A. varanense (Hirunkanokpun et al. 2003; Ahantarig et al. 2011; Sumrandee et al. 2014; Malaisri et al. 2015; Nooroong et al. 2018). In this study, a SFG Rickettsia sp. was detected in a male of H. heinrichi infesting Burmese ferret-badger in Loei province, northeastern Thailand. The members of SFG rickettsiae have been categorized into four subgroups: R. rickettsii, R. massiliae, R. helvetica, and R. akari (Merhej and Raoult 2011). Our results revealed five partial rickettsial sequences of 17-kDa, gltA, ompA, ompB, and sca4 genes that were amplified and sequenced from a H. heinrichi tick. The analysis of partial 17-kDa and gltA sequences indicated that the Rickettsia sp. was a member of SFG rickettsiae. However, these two genes could not differentiate whether it belonged to the R. massiliae or R. rickettsii subgroups. Since 17-kDa and gltA genes are highly conserved among SFG rickettsiae, previous studies have suggested that less conservative rickettsial genes such as ompA, ompB, and sca4 should be more suitable for the comparisons of closely related SFG species (Robinson et al. 2019). Therefore, these gene sequences were used for characterization of Rickettsia sp. in this study. BLAST and phylogenetic analyses of the partial ompA, ompB, and sca4 genes showed that the detected SFG Rickettsia sp. found in this study was a member of R. massiliae subgroup and was closely related to both R. rhipicephali and R. massiliae. However, it remains uncertain whether this Rickettsia sp. is pathogenic R. massiliae or non-pathogenic R. rhipicephali. Further characterizations by amplification and sequencing of additional genes, such as sca2 and GroEL, are required to clarify this point. In Thailand, a Rickettsia sp. closely related to members of the R. massiliae subgroup has been reported in H. lagrangei collected from sambar deer (Sumrandee et al. 2016). We reported herein for the first time SFG Rickettsia sp. belonging to the R. massiliae subgroup in H. heinrichi infesting a wild Burmese ferret-badger.

The distribution and diversity of tick species may be crucial to the investigation of tick-borne diseases. Cornet et al. (2009) indicated that Haemaphysalis was one of the most common genera widely distributed throughout Thailand and was capable of transmitting tick-borne diseases to humans. Humans bitten by infected Haemaphysalis ticks are consequently exposed to a high risk of bacterial infection. Haemaphysalis heinrichi was previously found infesting four species of mammal hosts: Arctonyx collaris, Bos domesticus, Canis familiaris, and Melogale personata in Chiang Mai, Chiang Rai, Khon Kaen, Bangkok, Nakhon Ratchasima, Prachinburi, and Ubon Ratchathani (Tanskul et al. 1983). Our findings have provided additional evidence of H. heinrichi infesting Burmese ferret-badger in Loei province, northeastern Thailand. Further study of the abundance and distribution of H. heinrichi and related tick species and the prevalence of bacterial infection will provide a better understanding of the epidemiology of rickettsioses and other tick-borne diseases in Thailand.

Coxiella-like endosymbionts have frequently been found in ticks (Ahantarig et al. 2011; Almeida et al. 2012; Arthan et al. 2015; Duron et al. 2015). Multilocus sequence analysis of five Coxiella housekeeping genes indicated that Coxiella endosymbiont in ticks served as the common ancestor of C. burnetii (Duron et al. 2015). The endosymbiont may play a vital role in providing vitamin and cofactor biosynthesis pathways and in defining the reproductive fitness of tick hosts (Smith et al. 2015). Consequently, understanding its role in sustaining growth and survival of ticks may provide new methods for control and management of tick populations. Q fever and seroprevalence of C. burnetii have been reported in rural areas of Malaysia and Thailand (Suputtamongkol et al. 2003; Bina Rai et al. 2011). In Malaysia, both C. burnetii and Coxiella endosymbiont were reported in H. hystricis ticks collected from the same wild boar. In this study, C. burnetii was not detected in all tick samples and CLE were detected solely in one (Haemaphysalis) of three analyzed tick genera. We identified three different types of CLE, namely Cox-hein in H. heinrichi, Cox-hys in H. hystricis, and Cox-asia in H. asiatica. Phylogenetic analysis with five concatenated gene sequences by Duron et al. (2015) showed that the genus Coxiella was divided into four clades (A-to-D) corresponding to the host genera. In this study, the phylogenetic trees generated from partial 16S rRNA, GroEL, and rpoB gene sequences demonstrated that the three CLE were clustered with those of Haemaphysalis ticks and were placed in clade D. The result of CLE partial 16S rRNA sequences obtained in this study was in accordance with previous authors who suggested that CLE detected from the same host genera were clustered within the same clade (Khoo et al. 2016; Trinachartvanit et al. 2018). However, GroEL and rpoB gene sequences did not cluster together with those previously reported in the same host genera (Khoo et al. 2016; Trinachartvanit et al. 2018). In Thailand, co-infections of Rickettsia and Coxiella have been reported in H. lagrangei and A. testudinarium (Nooroong et al. 2018; Sumrandee et al. 2016). Our results have also demonstrated the first case of co-infection of CLE and SFG Rickettsia sp. closely related to R. massiliae subgroup in H. heinrichi infesting Burmese ferret-badger. Interestingly, many wild animals have been reported as reservoirs of pathogenic bacterial agents of humans, including A. phagocytophilum, C. burnetii, and Rickettsia spp. (Meerburg and Reusken 2011; Silaghi et al. 2014). Further investigation in this field of research will provide more information on the prevalence of tick-borne pathogens in various tick species infesting wild mammals in Thailand before any conclusion can be made.

Anaplasmosis is an infectious hemotropic disease of cattle, sheep, goats, and other ruminants worldwide. Several Anaplasma species are causative agents of anaplasmosis in ruminants, e.g., A. phagocytophilum, A. marginale, and A. bovis (Inokuma 2007). In Thailand, Anaplasma spp. have been reported in both domestic and wild mammals and their associated ticks, including A. platys which have been detected from blood of mammal hosts i.e., cats, dogs, rodents, sambar deer, and wild boar, or from their parasitic ticks (Parola et al. 2003; Pinyoowong et al. 2008; Foongladda et al. 2011; Salakij et al. 2012; Sumrandee et al. 2016). Anaplasma marginale and A. phagocytophilum were found in water buffalo and ticks collected from vegetation, respectively (Nguyen et al. 2020; Nooroong et al. 2018); A. bovis has been reported in ticks infesting bear, sambar deer, rodents, and ticks collected from vegetation (Parola et al. 2003; Malaisri et al. 2015; Sumrandee et al. 2016; Takhampunya et al. 2019). In this study, an Anaplasma sp. closely related to A. bovis was detected in H. heinrichi removed from Burmese ferret-badger. Thus, the results of the present and previous studies in Thailand demonstrated that A. bovis were commonly found in ticks parasitizing domestic and wild mammals.

Ixodid ticks of the genera Ixodes, Dermacentor, Rhipicephalus, and Amblyomma are the main vectors of Anaplasma bacteria (Dumler et al. 2001). However, this bacterium has also been found in Haemaphysalis ticks in Asia and North America (Goethert and Telford 2003; Kim et al. 2003; Qin et al. 2018; Fukui and Inokuma 2019). In Thailand, Anaplasma spp. have been detected in ticks such as A. platys in D. auratus (Parola et al. 2003) and R. sanguineus (Foongladda et al. 2011); A. phagocytophilum in D. auratus (Nooroong et al. 2018); A. bovis in H. lagrangei (Parola et al. 2003; Sumrandee et al. 2016), H. shimoga (Malaisri et al. 2015), H. obesa (Sumrandee et al. 2016), and H. bandicota (Takhampunya et al. 2019). In this study, the presence of Anaplasma sp. closely related to A. bovis in H. heinrichi has been demonstrated by sequence and phylogenetic analysis of partial Anaplasma 16S rRNA. Our findings support previous studies in Thailand and other countries in Asia in which A. bovis is mostly found in Haemaphysalis, and this tick genus also associates with the transmission of Anaplasma (Goethert and Telford 2003; Parola et al. 2003; Lee and Chae 2010; Yoshimoto et al. 2010; Malaisri et al. 2015; Sumrandee et al. 2016). To our knowledge, this is the first report of Anaplasma sp. closely related to A. bovis in H. heinrichi tick-infested Burmese ferret-badger.

In summary, we identified tick-borne bacteria among various mammal ticks collected from 8 provinces of Thailand. Based on DNA sequencing and phylogenetic analyses, we found SFG Rickettsia sp. in the R. massiliae subgroup in H. heinrichi and three CLE, namely Cox-hein, Cox-hys in H. heinrichi and H. hystricis ticks infesting a Burmese ferret-badger, and Cox-asia in H. asiatica. Co-infection of SFG Rickettsia sp. and CLE (Cox-hein) was detected in H. heinrichi. This study also provided the first evidence for the presence of an Anaplasma sp. closely related to A. bovis in a H. heinrichi tick. Our results extended the knowledge of geographic distribution of ticks parasitizing different species of mammals and vector-borne bacteria in Southeast Asia.

Acknowledgements

We thank Dr. Adrian Plant and Phattranit Phattharajiranan for invaluable comments, Satian Chunta for providing some tick samples. We also thank Waranya Prempree and Ronnayuth Sudsangiem for technical assistance.

Authors’ contributions

All authors contributed to the study conception and design. AA, SH, PR and PP carried out the field collection of samples. The majority of the laboratory works were carried out by SH, AA, and WT. SH wrote the manuscript with guidance from VB. All authors discussed the results and commented on the previous version as well as approved the final versions of this manuscript.

Funding

This research was supported by the Thailand Research Fund-Chinese Academy of Science Grant (DBG6180027), Center of Excellence on Biodiversity, Office of Higher Education Commission (BDC-PG3-163005), and Mahidol University.

Data availability

All data included in this study are available on request to the corresponding author.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval

All applicable institutional, national and international guidelines for the care and use of animals were followed.

Consent to participate

Not applicable.

Consent for publication

All authors read and approved the final manuscript.

Conflict of interest

The authors declare no conflict of interest.

Footnotes

The original version of this article was revised: This article was originally published with an incorrect author name, the 4th author’s name from "Prirot Pramual" should be "Pairot Pramual ".

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

8/22/2022

A Correction to this paper has been published: 10.1007/s11259-022-09988-3

References

  1. Ahantarig A, Malaisri P, Hirunkanokpun S, Sumrandee C, Trinachartvanit W, Baimai V. Detection of Rickettsia and a novel Haemaphysalis shimoga symbiont bacterium in ticks in Thailand. Curr Microbiol. 2011;62:1496–1502. doi: 10.1007/s00284-011-9887-3. [DOI] [PubMed] [Google Scholar]
  2. Almeida PA, Marcili A, Leite RC, Nieri-Bastos FA, Domingues LN, Martins JR, et al. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: Argasidae) Ticks Tick Borne Dis. 2012;3:203–206. doi: 10.1016/j.ttbdis.2012.02.003. [DOI] [PubMed] [Google Scholar]
  3. Alzohairy AM. Bioedit: an important software for molecular biology. Gerf Bull Biosci. 2011;2:60–61. [Google Scholar]
  4. Arthan W, Sumrandee C, Hirunkanokpun S, Kitthawee S, Baimai V, Trinachartvanit W, et al. Detection of Coxiella-like endosymbiont in Haemaphysalis tick in Thailand. Ticks Tick Borne Dis. 2015;6:63–68. doi: 10.1016/j.ttbdis.2014.09.005. [DOI] [PubMed] [Google Scholar]
  5. Baneth G. Perspectives on canine and feline hepatozoonosis. Vet Parasitol. 2011;181:3–11. doi: 10.1016/j.vetpar.2011.04.015. [DOI] [PubMed] [Google Scholar]
  6. Bina Rai S, Kamaludin F, Chow T, Yoon C. First documented zoonotic case of Q fever in Penang, Malaysia. Outbreak Surveil Invest Rep. 2011;4:1–5. [Google Scholar]
  7. Black WC, Piesman J. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci USA. 1994;91:10034–10038. doi: 10.1073/pnas.91.21.10034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cooley RA. The genera Boophilus, Rhipicephalus, and Haemaphysalis (Ixodoidea) of the New World. Bull Nat Inst Health. 1946;187:1–54. [Google Scholar]
  9. Cornet JP, Demoraes F, Souris M, Kittayapong P, Gonzalez JP. Spatial distribution of ticks in Thailand: a discussion basis for tick-borne virus spread assessment. Int J Geoinform. 2009;5:57–62. [Google Scholar]
  10. Demoner L, Rubini AS, Paduan K, Metzger B, de Paula Antunes JM, Martins TF, et al. Investigation of tick vectors of Hepatozoon canis in Brazil. Ticks Tick Borne Dis. 2013;4:542–546. doi: 10.1016/j.ttbdis.2013.07.006. [DOI] [PubMed] [Google Scholar]
  11. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001;51:2145–2165. doi: 10.1099/00207713-51-6-2145. [DOI] [PubMed] [Google Scholar]
  12. Duron O, Jourdain E, McCoy KD. Diversity and global distribution of the Coxiella intracellular bacterium in seabird ticks. Ticks Tick Borne Dis. 2014;5:557–563. doi: 10.1016/j.ttbdis.2014.04.003. [DOI] [PubMed] [Google Scholar]
  13. Duron O, Noel V, McCoy KD, Bonazzi M, Sidi-Boumedine K, Morel O, et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella Burnetii. Plos Pathog. 2015;11:e1004892. doi: 10.1371/journal.ppat.1004892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Foongladda SD, Kositanont IU, Gaywee J. Rickettsia, Ehrlichia, Anaplasma, and Bartonella in ticks and fleas from dogs and cats in Bangkok. Vector Borne Zoonotic Dis. 2011;11:1335–1341. doi: 10.1089/vbz.2010.0174. [DOI] [PubMed] [Google Scholar]
  15. Fukui Y, Inokuma H. Molecular detection of Anaplasma phagocytophilum from larvae of Haemaphysalis longicornis in Ibaraki, Japan. Jpn J Infect Dis. 2019;72:423–425. doi: 10.7883/yoken.JJID.2019.076. [DOI] [PubMed] [Google Scholar]
  16. Giannelli A, Lia RP, Annoscia G, Buonavoglia C, Lorusso E, Dantas-Torres F, et al. Rhipicephalus turanicus, a new vector of Hepatozoon canis. Parasitology. 2017;144:730–737. doi: 10.1017/S003118201600250X. [DOI] [PubMed] [Google Scholar]
  17. Gillespie JJ, Beier MS, Rahman MS, Ammerman NC, Shallom JM, Purkayastha A, et al. Plasmids and rickettsial evolution: insight from Rickettsia felis. PLoS ONE. 2007;2:e266. doi: 10.1371/journal.pone.0000266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Goethert HK, Telford SR., 3rd Enzootic transmission of Anaplasma bovis in Nantucket cottontail rabbits. J Clin Microbiol. 2003;41:3744–3747. doi: 10.1128/JCM.41.8.3744-3747.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gray JS, Estrada-Peña A, Zintl A. Vectors of babesiosis. Annu Rev Entomol. 2019;64:149–165. doi: 10.1146/annurev-ento-011118-111932. [DOI] [PubMed] [Google Scholar]
  20. Hilpertshauser H, Deplazes P, Schnyder M, Gern L, Mathis A. Babesia spp. identified by PCR in ticks collected from domestic and wild ruminants in southern Switzerland. Appl Environ Microbiol. 2006;72:6503–6507. doi: 10.1128/AEM.00823-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hirunkanokpun S, Kittayapong P, Cornet JP, Gonzalez JP. Molecular evidence for novel tick-associated spotted fever group rickettsiae from Thailand. J Med Entomol. 2003;40:230–237. doi: 10.1603/0022-2585-40.2.230. [DOI] [PubMed] [Google Scholar]
  22. Hirunkanokpun S, Ahantarig A, Baimai V, Pramual P, Trinachartvanit W. A new record of Rickettsia japonica in ticks infesting a Burmese ferret-badger in Thailand. Trop Biomed. 2022;39:55–59. doi: 10.47665/tb.39.1.007. [DOI] [PubMed] [Google Scholar]
  23. Holden PR, Brookfield JF, Jones P. Cloning and characterization of an ftsZ homologue from a bacterial symbiont of Drosophila melanogaster. Mol Gen Genet. 1993;240:213–220. doi: 10.1007/BF00277059. [DOI] [PubMed] [Google Scholar]
  24. Inokuma H. Vectors and reservoir hosts of Anaplasmataceae. In: Raoult D, Parola P, editors. Rickettsial Diseases. New York: Taylor & Francis Group LLC; 2007. pp. 199–212. [Google Scholar]
  25. Jiang J, Sangkasuwan V, Lerdthusnee K, Sukwit S, Chuenchitra T, Rozmajzl PJ, et al. Human infection with Rickettsia honei, Thailand. Emerg Infect Dis. 2005;11:1473–1475. doi: 10.3201/eid1109.050011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Khoo JJ, Chen F, Kho KL, Ahmad Shanizza AI, Lim FS, Tan KK, et al. Bacterial community in Haemaphysalis ticks of domesticated animals from the Orang Asli communities in Malaysia. Ticks Tick Borne Dis. 2016;7:929–937. doi: 10.1016/j.ttbdis.2016.04.013. [DOI] [PubMed] [Google Scholar]
  27. Kim CM, Kim MS, Park MS, Park JH, Chae JS. Identification of Ehrlichia chaffeensis, Anaplasma phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks from Korea. Vector Borne Zoonotic Dis. 2003;3:17–26. doi: 10.1089/153036603765627424. [DOI] [PubMed] [Google Scholar]
  28. Lee MJ, Chae JS. Molecular detection of Ehrlichia chaffeensis and Anaplasma bovis in the salivary glands from Haemaphysalis longicornis ticks. Vector Borne Zoonotic Dis. 2010;10:411–413. doi: 10.1089/vbz.2008.0215. [DOI] [PubMed] [Google Scholar]
  29. Malaisri P, Hirunkanokpun S, Baimai V, Trinachartvanit W, Ahantarig A. Detection of Rickettsia and Anaplasma from hard ticks in Thailand. J Vector Ecol. 2015;40:262–268. doi: 10.1111/jvec.12163. [DOI] [PubMed] [Google Scholar]
  30. Margos G, Vollmer SA, Cornet M, Garnier M, Fingerle V, Wilske B, et al. A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Appl Environ Microbiol. 2009;75:5410–5416. doi: 10.1128/AEM.00116-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Masuzawa T, Fukui T, Miyake M, Oh HB, Cho MK, Chang WH, et al. Determination of members of a Borrelia afzelii-related group isolated from Ixodes nipponensis in Korea as Borrelia valaisiana. Int J Syst Bacteriol. 1999;49(Pt 4):1409–1415. doi: 10.1016/s0035-9203(00)90243-8. [DOI] [PubMed] [Google Scholar]
  32. Meerburg BG, Reusken CBEM. The role of wild rodents in spread and transmission of Coxiella burnetii needs further elucidation. Wildl Res. 2011;38:617–625. doi: 10.1071/WR10129. [DOI] [Google Scholar]
  33. Merhej V, Raoult D. Rickettsial evolution in the light of comparative genomics. Biol Rev Camb Philos Soc. 2011;86:379–405. doi: 10.1111/j.1469-185X.2010.00151.x. [DOI] [PubMed] [Google Scholar]
  34. Nguyen AHL, Tiawsirisup S, Kaewthamasorn M. Molecular detection and genetic characterization of Anaplasma marginale and Anaplasma platys-like (Rickettsiales: Anaplasmataceae) in water buffalo from eight provinces of Thailand. BMC Vet Res. 2020;16:380. doi: 10.1186/s12917-020-02585-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Nooroong P, Trinachartvanit W, Baimai V, Ahantarig A. Phylogenetic studies of bacteria (Rickettsia, Coxiella, and Anaplasma) in Amblyomma and Dermacentor ticks in Thailand and their co-infection. Ticks Tick Borne Dis. 2018;9:963–971. doi: 10.1016/j.ttbdis.2018.03.027. [DOI] [PubMed] [Google Scholar]
  36. Pachirat O, Fournier PE, Pussadhamma B, Taksinachanekij S, Lulitanond V, Baggett HC, et al. The first reported cases of Q fever endocarditis in Thailand. Infect Dis Rep. 2012;4:17–18. doi: 10.4081/idr.2012.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Parola P, Roux V, Camicas JL, Baradji I, Brouqui P, Raoult D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans R Soc Trop Med Hyg. 2000;94:707–708. doi: 10.1016/s0035-9203(00)90243-8. [DOI] [PubMed] [Google Scholar]
  38. Parola P, Cornet JP, Sanogo YO, Miller RS, Thien HV, Gonzales JP, et al. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam. J Clin Microbiol. 2003;41:1600–1608. doi: 10.1128/JCM.41.4.1600-1608.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pinyoowong D, Jittapalapong S, Suksawat F, Stich RW, Thamchaipenet A. Molecular characterization of Thai Ehrlichia canis and Anaplasma platys strains detected in dogs. Infect Genet Evol. 2008;8:433–438. doi: 10.1016/j.meegid.2007.06.002. [DOI] [PubMed] [Google Scholar]
  40. Qin XR, Han FJ, Luo LM, Zhao FM, Han HJ, Zhang ZT, et al. Anaplasma species detected in Haemaphysalis longicornis tick from China. Ticks Tick Borne Dis. 2018;9:840–843. doi: 10.1016/j.ttbdis.2018.03.014. [DOI] [PubMed] [Google Scholar]
  41. Raoult D, Marrie T. Q fever. Clin Infect Dis. 1995;20:489–496. doi: 10.1093/clinids/20.3.489. [DOI] [PubMed] [Google Scholar]
  42. Raoult D, Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997;10:694–719. doi: 10.1128/CMR.10.4.694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173:1576–1589. doi: 10.1128/jb.173.5.1576-1589.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Robinson MT, Satjanadumrong J, Hughes T, Stenos J, Blacksell SD. Diagnosis of spotted fever group Rickettsia infections: the Asian perspective. Epidemiol Infect. 2019;147:e286. doi: 10.1017/S0950268819001390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB) Int J Syst Evol Microbiol. 2000;50:1449–1455. doi: 10.1099/00207713-50-4-1449. [DOI] [PubMed] [Google Scholar]
  46. Salakij C, Lertwatcharasarakul P, Salakij J, Nunklang K, Rattanakunuprakarn J. Molecular characterization of Anaplasma platys in a domestic cat from Thailand. Comp Clin Pathol. 2012;21:345–348. doi: 10.1007/s00580-011-1378-1. [DOI] [Google Scholar]
  47. Silaghi C, Pfister K, Overzier E. Molecular investigation for bacterial and protozoan tick-borne pathogens in wild boars (Sus scrofa) from southern Germany. Vector Borne Zoonotic Dis. 2014;14:371–373. doi: 10.1089/vbz.2013.1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Smith TA, Driscoll T, Gillespie JJ, Raghavan R. A Coxiella-like endosymbiont is a potential vitamin source for the Lone Star tick. Genome Biol Evol. 2015;7:831–838. doi: 10.1093/gbe/evv016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sumrandee C, Hirunkanokpun S, Doornbos K, Kitthawee S, Baimai V, Grubhoffer L, et al. Molecular detection of Rickettsia species in Amblyomma ticks collected from snakes in Thailand. Ticks Tick Borne Dis. 2014;5:632–640. doi: 10.1016/j.ttbdis.2014.04.013. [DOI] [PubMed] [Google Scholar]
  50. Sumrandee C, Baimai V, Trinachartvanit W, Ahantarig A. Molecular detection of Rickettsia, Anaplasma, Coxiella and Francisella bacteria in ticks collected from Artiodactyla in Thailand. Ticks Tick Borne Dis. 2016;7:678–689. doi: 10.1016/j.ttbdis.2016.02.015. [DOI] [PubMed] [Google Scholar]
  51. Suputtamongkol Y, Rolain JM, Losuwanaruk K, Niwatayakul K, Suttinont C, Chierakul W, et al. Q fever in Thailand. Emerging Infect Dis. 2003;9:1186–1188. doi: 10.3201/eid0909.030086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Takhampunya R, Korkusol A, Pongpichit C, Yodin K, Rungrojn A, Chanarat N, et al. Metagenomic approach to characterizing disease epidemiology in a disease-endemic environment in Northern Thailand. Front Microbiol. 2019;10:319. doi: 10.3389/fmicb.2019.00319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tanskul P, Inlao I. Keys to the adult ticks of Haemaphysalis Koch, 1844, in Thailand with notes on changes in taxonomy (Acari: Ixodoidea: Ixodidae) J Med Entomol. 1989;26:573–600. doi: 10.1093/jmedent/26.6.573. [DOI] [PubMed] [Google Scholar]
  54. Tanskul P, Stark HE, Inlao I. A checklist of ticks of Thailand (Acari: Metastigmata: Ixodoidea) J Med Entomol. 1983;20:330–341. doi: 10.1093/jmedent/20.3.330. [DOI] [PubMed] [Google Scholar]
  55. Trinachartvanit W, Maneewong S, Kaenkan W, Usananan P, Baimai V, Ahantarig A. Coxiella-like bacteria in fowl ticks from Thailand. Parasit Vectors. 2018;11:670. doi: 10.1186/s13071-018-3259-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Ujvari B, Madsen T, Olsson M. High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. J Parasitol. 2004;90:670–672. doi: 10.1645/GE-204R. [DOI] [PubMed] [Google Scholar]
  57. Walker DH, Yu XJ. Rickettsia, orientia, ehrlichia, anaplasma, and coxiella. Typhus; spotted fevers; scrub typhus; ehrlichioses; Q fever. In: Greenwood D, Barer M, Slack R, Irving W, editors. Medical Microbiology. 18. Nottingham: Churchill Livingstone; 2012. pp. 390–399. [Google Scholar]
  58. Wassef HY, Hoogstraal H. Dermacentor (Indocentor) auratus (Acari: Ixodoidea: Ixodidae): identity of male and female. J Med Entomol. 1984;21:169–173. doi: 10.1093/jmedent/21.2.169. [DOI] [PubMed] [Google Scholar]
  59. Webb L, Carl M, Malloy DC, Dasch GA, Azad AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:530–534. doi: 10.1128/jcm.28.3.530-534.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Werren JH, Baldo L, Clark ME. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol. 2008;6:741–751. doi: 10.1038/nrmicro1969. [DOI] [PubMed] [Google Scholar]
  61. Yoshimoto K, Matsuyama Y, Matsuda H, Sakamoto L, Matsumoto K, Yokoyama N, et al. Detection of Anaplasma bovis and Anaplasma phagocytophilum DNA from Haemaphysalis megaspinosa in Hokkaido, Japan. Vet Parasitol. 2010;168:170–172. doi: 10.1016/j.vetpar.2009.10.008. [DOI] [PubMed] [Google Scholar]
  62. Zobba R, Anfossi AG, Pinna Parpaglia ML, Dore GM, Chessa B, Spezzigu A, et al. Molecular investigation and phylogeny of Anaplasma spp. in Mediterranean ruminants reveal the presence of neutrophil-tropic strains closely related to A. platys. Appl Environ Microbiol. 2014;80:271–280. doi: 10.1128/AEM.03129-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data included in this study are available on request to the corresponding author.

Articles from Veterinary Research Communications are provided here courtesy of Springer

RESOURCES