Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Aug 1.
Published in final edited form as: Gene Ther. 2022 May 24;30(1-2):115–121. doi: 10.1038/s41434-022-00345-2

Effects of intracardiac delivery of aldehyde dehydrogenase 2 gene in myocardial salvage

Guodong Pan 1,2, Bipradas Roy 1,2, Pamela Harding 1,2, Thomas Lanigan 3, Roland Hilgarth 3, Rajarajan A Thandavarayan 4, Suresh Selvaraj Palaniyandi 1,2,*
PMCID: PMC9684354  NIHMSID: NIHMS1808729  PMID: 35606494

Abstract

Intrinsic activity of aldehyde dehydrogenase (ALDH)2, a cardiac mitochondrial enzyme, is vital in detoxifying 4-hydroxy-2-nonenal (4HNE) like cellular reactive carbonyl species (RCS) and thereby conferring cardiac protection against pathological stress. It was also known that a single point mutation (E487K) in ALDH2 (prevalent in East Asians) known as ALDH2*2 reduces its activity intrinsically and was associated with increased cardiovascular diseases. We and others have shown that ALDH2 activity is reduced in several pathologies in WT animals as well. Thus, exogenous augmentation of ALDH2 activity is a good strategy to protect the myocardium from pathologies. In this study, we will test the efficacy of intracardiac injections of the ALDH2 gene in mice. We injected both wild type (WT) and ALDH2*2 knock-in mutant mice with ALDH2 constructs, AAv9-cTNT-hALDH2-HA tag-P2A-eGFP or their control constructs, AAv9-cTNT-eGFP. We found that intracardiac ALDH2 gene transfer increased myocardial levels of ALDH2 compared to GFP alone after 1 and 3 weeks. When we subjected the hearts of these mice to 30 min global ischemia and 90 min reperfusion (I-R) using the Langendorff perfusion system, we found reduced infarct size in the hearts of mice with ALDH2 gene vs GFP alone. A single time injection has shown increased myocardial ALDH2 activity for at least 3 weeks and reduced myocardial 4HNE adducts and infarct size along with increased contractile function of the hearts while subjected to I-R. Thus, ALDH2 overexpression protected the myocardium from I-R injury by reducing 4HNE protein adducts implicating increased 4HNE detoxification by ALDH2. In conclusion, intracardiac ALDH2 gene transfer is an effective strategy to protect the myocardium from pathological insults.

Introduction

Aldehyde dehydrogenases (ALDHs) are one of the primary enzyme systems that oxidize cellular aldehydes into carboxylic acids1. There are 19 isozymes of human ALDHs. The location and substrate selectivity differs among ALDHs. The ALDH2 gene is located on chromosome 12q24 and which codes for a 517–amino acid polypeptide2. ALDH2 with its N-terminal 17–amino acid mitochondrial targeting sequence (MTS) enters the mitochondrial matrix3. After cleaving off MTS sequence, the mature 500–amino acid protein forms an active homotetramer with a molecular weight of 56 kDa, possessing three domains including coenzyme- or NAD+-binding domain, catalytic domain, and oligomerization domain. ALDH2 was first known to catalyze acetaldehyde with a very low Km4. It also detoxifies 4-hydroxy-2-nonenal (4HNE)5 like reactive carbonyls, which are generated upon lipid peroxidation in physiological conditions and further augmented during oxidative stress in the pathological state. 4HNE is a highly reactive aliphatic aldehyde that can form adducts with cellular macromolecules6, 7, and contributes to cytotoxicity8-14. Increased 4HNE adducts were found in the cardiac pathologies15, 16. Earlier studies have pointed out that both ischemia and reperfusion (I-R) contributes to the release of 4HNE17, 18. Thus, accelerated removal of 4HNE during I-R injury may protect the myocardium19.

A single-point mutation (E487K) in ALDH2, termed as ALDH2*2, leads to low intrinsic ALDH2 activity in ~ 30% of East Asians (8% of the world’s populations)20-24. Several epidemiological studies in East Asians indicate that ALDH2 is critical during cardiovascular diseases. Inactive ALDH2 genotype is associated with a higher incidence of myocardial infarction (MI)25, 26 and angina27. All these studies implicate that low ALDH2 activity is associated with increased myocardial I-R injury. Increasing ALDH2 levels and thus its activity specifically in the cardiac tissue can be possible by using adeno associated virus 9 (AAV9) vector with cardiomyocyte specific promoter, cardiac troponin T (CTnT). Thus, our objective of the study is to exogenously increase ALDH2 activity by overexpressing ALDH2 gene using AAV9 vector with CTnT promoter by intracardiac injection.

Materials and Methods

Animals: C57/BL6 mice and ALDH2*2 E487K knock-in mutant mice

Both male and female C57/BL6 mice, the wild-type (WT) mice, and ALDH2*2 E487K knock-in mutant mice that mimic E487K mutation in East Asians (ALDH2*2 mice) with age of 8 weeks were employed in this study. We obtained the ALDH2*2 mice that were developed by Mochly-Rosen as reported earlier28. The mice were bred and grown in our animal care facility and genotyped by Transnetyx Inc. (Cordova, TN). We have used these ALDH2*2 mutant mice earlier29. We used n=6 mice per group based on sample size power analysis and previous experience. The animal protocols were approved by the Wayne State University Institutional Animal Care and Use Committee.

Intracardiac delivery of ALDH2 gene using AAV9 viral vector

We randomly selected mice to receive ALDH2 gene or GFP based on the cages they were present. After anesthetizing with 3% isoflurane, the mice were placed in a supine position under a heating lamp. We orally intubated the mice for artificial respiration which was maintained with a rodent ventilator. The maintenance anesthesia (1-2% of isoflurane) was delivered through another spout of the rodent ventilator. The heart was exposed by cutting the left third and fourth ribs and intercostal muscles. The pericardium was removed, the heart was elevated within the chest cavity, and a syringe fitted with a 29-G needle was inserted through the apex into the left anterior wall of the heart. We slowly injected 10 μl/site of adeno associated viral vector 9 (AAV9) (1012 viral particles, diluted in PBS with Hoechst 33342 dye, 0.5μg/ml) with ALDH2 gene/eGFP containing cardiac troponin T (CTnT) as a promoter (AAV9- CTnT-hALDH2-HA tag-P2A-eGFP or AAV9-cTnT-eGFP (A map of the construct is shown in Fig 1) into a few areas of cardiac muscle (as shown in Fig 2). After closing the wounds, the animals were kept on a heating pad until they awoke, then returned to Animal Facilities and monitored. After 1 week or 3 weeks, the mice were sacrificed to evaluate cardiac ALDH2 level, activity and 4HNE protein adducts. In another set of mice, we isolated hearts and subjected them to I-R as described below.

Figure 1. Map of ALDH2 construct.

Figure 1.

Open in a new tab

AAV9 pCWB-cTNT-hALDH2-HA tag-P2A-eGFP

Human ALDH2 was subcloned into the SalI/NotI sites of pCWB cTNT-eGFP. ALDH2-HA-P2a was PCR amplified from an ALDH2 containing clone obtained from Dharmacon (clone MHS6278-202828919 clone ID: 3543343). PCR primers used to amplify the H.s. ALDH2-HA-P2a are as follows:

ALDH2 SalI F Primer: 5’- TCCGTGGATATCTAGACGCGTCGACCACC

ATGTTGCGCGCTGCCGCCCGCT-3’.

ALDH2 HA-P2a NcoI R Pirmer: 5’-AGCTCCTCGCC

CTTGCTCACCATGGTAGGACCGGGGTTTTCTTCCACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCTCCGGATCCAGCGTAATCTGGAACATCGTATGGGTATGCTGAGTTCTTCTGAGGCA-3’.

Map shows single cutting restriction enzyme sites.

Figure 2. Immunofluorescence imaging of Hoechst dye from injection, GFP from the construct and ALDH2 from staining show effective transduction.

Figure 2.

Open in a new tab

Representative micrographs of cardiac sections showing intracardiac injection sites in the myocardial tissue with Hoechst dye (A, B & E) as well as GFP (C & F) and ALDH2 (D & G) immunofluorescence staining from both AAV9-GFP and AAV9-ALDH2-GFP. N=3 per group

The white arrows show the injection site in the myocardium where cells took up Hoechst dye as the constructs were injected with Hoechst dye.

Induction of ex vivo myocardial I-R injury in WT and ALDH2*2 mutant mice.

After 3 weeks of intracardiac injection, we sacrificed WT and ALDH2*2 mutant mice and excised and mounted their hearts on the cannula of the Langendorff perfusion apparatus (AD Instruments). Then, we subjected them to 30 minutes of ischemia and 90 minutes of reperfusion protocol as described elsewhere29. The global ischemia was induced by stopping the perfusion of K-H buffer and restoration of K-H buffer perfusion is regarded as reperfusion. Cardiac performance was assessed by inserting a small latex balloon catheter in the left ventricle. The cardiac contraction sensed by the latex balloon catheter (SPR-1000, Millar Inc) was transmitted to the Power Lab system using a transducer. Heart rate (HR), left ventricular pressure (LVP), left ventricular pressure rise (+dP/dt) and decline (–dP/dt), and coronary perfusion pressure (PP) were recorded, analyzed, and calculated using lab chart software (Adinstruments, Lab Chart 7.3.8 Windows) 29.

Immunofluorescence staining

Frozen cardiac tissue sections were used for immunostaining to determine the transfection efficiency by checking the eGFP florescence in mice received AAV9-ALDH2-eGFP and AAV9-GFP and as well as checking the staining for ALDH2 with anti-ALDH2 mouse polyclonal antibody (Thermo Fisher Scientific Inc, MA5-17029; 1:100 and 4 °C for overnight incubation): The secondary antibodies were conjugated with Alexa fluor 546 (Invitrogen, A11030, wavelength excitation peaks at 556 nm and emission peaks at 573 nm) at a concentration of 1:500 at room temperature for 1 hour. Immunofluorescence positive staining was analyzed using a fluorescent microscope (Olympus IX81) and an image analyzer (Olympus IX2-UCB). The representative micrographs were selected and presented.

Infarct size measurement by triphenyl tetrazolium chloride (TTC) staining

After the end of I-R protocol, the heart was cut into 2-mm transverse slices in the mid-cardiac tissue. The slices were incubated in 1% TTC (pH 7.4) at 37°C for 5 min and then placed in 4% formaldehyde for quantitative analysis. The unstained infarcted heart appeared pale white in color, and viable heart tissue appeared red in color. After scanning the slices, the percentage of infarcted versus non-infarcted regions was analyzed using the ImageJ software and expressed as the percentage of cardiac tissue with infarction versus total area, as previously described29.

ALDH activity assay

ALDH2 activity was measured as described elsewhere15, 16. After homogenizing the whole heart tissue, enzymatic activity of ALDH2 from cardiac tissue homogenates was determined spectrophotometrically by reductive reaction of NAD+ to NADH at λ340 nm. All assays were carried out at 25°C in 0.1M sodium pyrophosphate buffer, pH = 9.5 with 2.4 mM NAD+ as a cofactor and 10 mM acetaldehyde as the substrate.

Western immunoblotting

Western blot was performed as described earlier29. In brief, whole cardiac tissue was homogenized and then the tissue samples were separated on SDS-polyacrylamide gels by electrophoresis and were transferred to immobilon-P membranes (Millipore Sigma, ABN294). The levels of each protein were determined using specific antibodies: anti-ALDH2 mouse polyclonal antibody (Thermofisher Scientific Inc, MA5-17029); anti-4HNE-Cys/His/Lys rabbit polyclonal antibody (Millipore Sigma, 303207) and anti-β actin mouse monoclonal antibody (Abcam, sc-47778). All the antibodies are used at a concentration of 1:1000. The bound antibody was visualized with horseradish peroxidase (HRP)-coupled secondary antibody. The band intensities were quantified using Image J software.

Statistical analysis

Data are presented as mean ± standard error of the mean (S.E.M). We used One-Way ANOVA for group comparisons and the post-hoc analysis was performed using Student T-test. We used Student t-test for the comparison between two groups. We used Microsoft Excel for all statistical analysis.

Results

Effective transduction of injected genes via intracardiac transfer

Intramyocardial injections of cTnT containing AAV9 vector along with Hoechst dye show that cells around the injection site took up the dye (Figs 2A-2C). Intramyocardial injections of cTnT containing AAV9 vector in the cardiac muscle tissue transduced the GFP (green fluorescence) in both control AAV9-GFP and AAV9-ALDH2-GFP groups (Figs 2C and 2F). In contrast, ALDH2 transduction (red fluorescence) was observed in only AAV9-ALDH2-GFP group with immunostaining (Figs 2D and 2G).

Intracardiac injection of ALDH2 gene increased cardiac ALDH2 levels

Cardiac ALDH2 protein levels were significantly increased 1-week and 3-weeks after intracardiac injection of ALDH2 gene in WT mice compared to their GFP injected counterparts (Figs 3A-3D).

Figure 3. Cardiac ALDH2 levels after one and three weeks of intracardiac transfection.

Figure 3.

Open in a new tab

Representative Western blot images of ALDH2 and β-actin one week (A) and three weeks (B) after transfection. The quantification data of cardiac ALDH2 levels for one week, (C) and 3 weeks, (D) were shown. Data are presented as mean ± standard error of the mean (SEM). N=6 per group; by ***P<0.001 VS AAV-GFP.

Intracardiac injection of ALDH2 gene increased ALDH2 level, ALDH2 activity and reduced 4HNE adducts in the hearts subjected to global ischemia-reperfusion injury.

We found cardiac ALDH2 levels and activity were significantly increased in both WT and ALDH2*2 mice that received ALDH2 gene compared to the mice that received GFP gene (Figs 4A-4C). We also found cardiac ALDH2 levels and activity were significantly higher in WT mice with AAV9-GFP compared to ALDH2*2 mice with AAV9-GFP (Figs 4A-4C). However, the increases in cardiac ALDH2 levels and activity in both WT and ALDH2*2 mice that received the ALDH2 gene were comparable (Figs 4A-4C). Intracardiac transfer of ALDH2 gene reduced myocardial 4HNE protein adducts in the I-R subjected hearts compared to their counterparts with AAV9-GFP transfection (Figs 4A and 4D). The cardiac 4HNE adduct levels were higher in I-R subjected ALDH2*2 mouse hearts compared to I-R subjected WT mouse hearts that all were treated with AAV9-GFP (Figs 4A and 4D).

Figure 4. Cardiac ALDH2 levels, ALDH2 activity and 4HNE protein adducts in the WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Figure 4.

Open in a new tab

Representative Western blot images of ALDH2, 4HNE protein adducts and β-actin were shown from the homogenized hearts that were subjected to I-R injury (A). The quantitative data of ALDH2 activity (B, F=46.6 and p<0.001 in One-Way ANOVA), ALDH2 levels (C, F=138.1 and p<0.001 in One-Way ANOVA) and multiple 4HNE adduct bands (D, F>2 and p<0.05 of each band in ANOVA) were shown. Data are presented as mean ± standard error of the mean (SEM). N=6 per group; *P<0.05, **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.

Intracardiac injection of ALDH2 gene decreased myocardial infarct size after global I-R injury.

We found a decrease in % myocardial infarct size after I-R injury with AAV9-ALDH2-GFP compared to AAV9-GFP in both WT and ALDH2*2 mouse hearts (Figs 5A and 5B). It is worthy to mention that % myocardial infarct size was higher in AAV9-GFP treated ALDH2*2 mouse hearts subjected to I-R compared to AAV9-GFP treated WT mouse hearts subjected to I-R (Figs 5A and 5B).

Figure 5. Myocardial infarct size measurements of WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Figure 5.

Open in a new tab

Representative macroscopic images of TTC stained myocardial slices from WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections. The red color indicates viable myocardium while the * symbol labelled pale color area indicates infarcted tissue (A). The quantitative data of % myocardial infarction was shown, (B, F=54.2 and p<0.001 in One-Way ANOVA). Data are presented as mean ± standard error of the mean (SEM). N=6 per group; **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.

Intracardiac injection of ALDH2 gene improved contractile function after global I-R injury.

There was no difference in basal cardiac functional parameters {HR (Fig 6A), LVP (Fig 6B), +dP/dt (Fig 6C), −dP/dt (Fig 6D) and PP (Fig 6E)} in AAV9-ALDH2-GFP treated WT and ALDH2*2 mouse hearts that were subjected to I-R versus AAV9-GFP treated WT and ALDH2*2 mouse hearts that underwent I-R.

Figure 6. Changes in cardiac functional indices of WT and ALDH2*2 mutant mouse hearts subjected to global ischemia-reperfusion injury after AAV9-ALDH2-GFP and AAV9-GFP transfections.

Figure 6.

Open in a new tab

Basal cardiac functional parameters {HR (A, F=0.17 and p>0.05 in ANOVA), LVP, (B, F=0.11 and p>0.05 in ANOVA), +dP/dt (C, F=1.0 and p>0.05 in ANOVA), −dP/dt (D, F=1.8 and p>0.05 in ANOVA) and PP (E, F=0.19 and p>0.05 in ANOVA)} and post I-R mediated cardiac functional changes {HR (F, F=10.2 and p<0.01 in ANOVA), LVP (G, F=11.8 and p<0.001 in ANOVA), +dP/dt (H, F=31.5 and p<0.001 in ANOVA), −dP/dt (I, F=31.5 and p<0.001 in ANOVA) and PP (J, F=0.24 and p>0.05 in ANOVA)} were shown. N=6 per group; *P<0.05, **P<0.01 and ***P<0.001 refer to the difference between individual groups as shown.

Significant improvements in cardiac functional parameters {HR (Fig 6F), LVP (Fig 6G), +dP/dt (Fig 6H) and −dP/dt (Fig 6L)} were found in AAV9-ALDH2-GFP treated WT and ALDH2*2 mouse hearts that were subjected to I-R relative to respective AAV9-GFP treated WT and ALDH2*2 mouse hearts that had undergone I-R. LVP (Fig 6G), +dP/dt (Fig 6H) and −dP/dt (Fig 6I)} were significantly higher in WT mice treated with AAV9-GFP compared to ALDH2*2 mice treated with AAV9-GFP. There was no difference of PP between among groups after I-R (Fig 6J).

Discussion

Intracardiac delivery of exogenous ALDH2 gene protected the myocardium from global I-R injury by increasing ALDH2 protein expression and its activity along with a decrease in 4HNE protein adducts in both WT and ALDH2*2 mutant mice. This cardioprotection by ALDH2 gene therapy was evident from reduced myocardial infarct size and improved cardiac function.

In an earlier study, we demonstrated that I-R damage was exacerbated when low cardiac ALDH2 activity was present with either long standing diabetes or ALDH2*2 mutant mice which contain intrinsically low ALDH2 activity29. When ALDH2 activity was increased either by the small molecule ALDH2 activator, Alda-119 or using transgenic mice with global ALDH2 overexpression30, it increased ALDH2 activity and reduced 4HNE protein adducts and thereby attenuated myocardial infarct size with I-R injury. Even though cardiac ALDH2 was identified as a critical target for cardiovascular disease including myocardial I-R injury31,none of the studies focused on strategies which specifically enhanced myocardial ALDH2 activity via exogenous ALDH2 gene therapy, in vivo. To address this gap, in this present study, for the first time, we injected an AAV9 vector with a cardiomyocyte specific CTnT promoter to specifically express ALDH2 gene in the cardiac tissue by intracardiac route. We found a significant increase in cardiac ALDH2 protein levels at least up to 3 weeks after transfection. The intracardiac delivery AAV9 vector offers efficient transfection and transduction in cardiac tissue to ward off accumulating into off target tissues as earlier study showed highest liver accumulation of AAV9 with systemic injection32. Our results showed that the intracardiac route is effective in enabling ectopic ALDH2 expression in the cardiac tissue specifically. Since the liver has higher levels of ALDH2 in comparison to myocardium33 and systemic delivery such as i.v. injection of viral vectors including AAV9 accumulated more in liver 32, which would have further enhanced liver ALDH2 level and activity. By this way, we cannot rule out the contribution of liver ALDH2 activity also in the cardioprotection. In fact, recent studies point out the cross talk between the liver-heart axis in cardiac diseases34 which is another interesting area to focus, but it was not the goal of the present study. Thus, our choice to use ALDH2 gene transfer via intracardiac route is helpful in selectively determining the effect of myocardial ALDH2 in salvaging myocardium from I-R injury. In an earlier study, we injected EP4 gene containing AAV9 vector to efficiently transfect the myocardium with a different cardiomyocyte promoter i.e., myosin heavy chain promoter via intracardiac delivery35. Although intracardiac injections require open heart surgery, the advantage of this route in enabling cardiac tissue specific ectopic expression of genes and their efficacious biological action outweighs the surgery. The alternative approach to this surgery is less invasive tail-vein injection with cardiomyocyte specific promoter for the transduction of interested genes in the myocardial tissue, which we will plan as our future study. Nevertheless, among the viral vectors, AAV9 was shown to be efficient in cardiac tissue specific transfection32, 36, 37 as well as it has less immunogenic property38 among several AAV subtypes. Cardiomyocytes, a nondividing cell type, are promising target cells for AAV vectors. Given the enormous clinical need for the development of improved treatment options of both inherited and acquired cardiovascular diseases, it is not surprising that extensive preclinical research has been performed to test AAV vectors to treat cardiovascular diseases36, 37. Our findings from current study further reaffirms that AAV vectors are useful to transfect myocardial tissue.

Even though in this study we are not investigating the signaling mechanism, in an earlier study, it was demonstrated that ALDH2 overexpression in mice, although not exogenously transferred gene, increased cardioprotection against I-R injury via an AMPK-dependent induction of autophagy during ischemia and a paradoxical Akt-dependent reduction in autophagy during reperfusion39. This was attributed to the efficient detoxification of 4HNE by overexpressed ALDH239. In the current study also, we found a significant decrease in 4HNE protein adduct formation. Apart from mice with ALDH2 overexpression 39, several studies used Alda-1, a small molecule ALDH2 activator, which was shown to increase ALDH2 activity and thus reduce I/R injury by lowering 4HNE adducts 19. It was shown that Alda-1 can protect the myocardium either with acute or chronic treatments 40. We have recently shown that Alda-1 treatment can reduce 4HNE perfusion mediated cardiac damage 29. Although Alda-1 was demonstrated as specific drug in activating ALDH2 19, 31, however our approach to overexpress ALDH2 via intracardiac gene transfer using cardiomyocyte-specific promoter should offer superior specificity. Nevertheless, it is a proof-of-concept gene therapy study which can advanced the field in this direction.

In conclusion, we report that intracardiac ALDH2 gene transfer using AAV9 with cTnT promoter increase ALDH2 protein levels and its activity which decreased 4HNE adducts and thus I-R mediated myocardial infarct size with an improvement in cardiac contractile function in both WT and ALDH2*2 mutant hearts.

• Funding

SSP was supported by a grant from the National Heart, Lung, and Blood Institute 1R56HL131891-01A1, 1R01HL139877-01A1 and an internal grant from Henry Ford Health System A10249.

Footnotes

The Author(s) declare(s) that there is no conflict of interest.

No disclosures to report.

We thank Durga Dham and Saswat Saravanan for her English editing

• Availability of data and materials

All the data are within the manuscript. All materials were obtained from commercial vendors.

Ethics approval

All applicable national, and/or institutional guidelines for the care and use of animals were followed

References

  • 1.Yoshida A, Rzhetsky A, Hsu LC, Chang C. Human aldehyde dehydrogenase gene family. Eur J Biochem 1998; 251(3): 549–57. [DOI] [PubMed] [Google Scholar]
  • 2.Raghunathan L, Hsu LC, Klisak I, Sparkes RS, Yoshida A, Mohandas T. Regional localization of the human genes for aldehyde dehydrogenase-1 and aldehyde dehydrogenase-2. Genomics 1988; 2(3): 267–9. [DOI] [PubMed] [Google Scholar]
  • 3.Braun T, Bober E, Singh S, Agarwal DP, Goedde HW. Evidence for a signal peptide at the amino-terminal end of human mitochondrial aldehyde dehydrogenase. FEBS Lett 1987; 215(2): 233–6. [DOI] [PubMed] [Google Scholar]
  • 4.Eriksson CJ, Marselos M, Koivula T. Role of cytosolic rat liver aldehyde dehydrogenase in the oxidation of acetaldehyde during ethanol metabolism in vivo. Biochem J 1975; 152(3): 709–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Vasiliou V, Pappa A, Petersen DR. Role of aldehyde dehydrogenases in endogenous and xenobiotic metabolism. Chem Biol Interact 2000; 129(1-2): 1–19. [DOI] [PubMed] [Google Scholar]
  • 6.Roede JR, Jones DP. Reactive species and mitochondrial dysfunction: mechanistic significance of 4-hydroxynonenal. Environ Mol Mutagen 2010; 51(5): 380–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Esterbauer H, Schaur RJ, Zollner H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med 1991; 11(1): 81–128. [DOI] [PubMed] [Google Scholar]
  • 8.Bulteau AL, Lundberg KC, Humphries KM, Sadek HA, Szweda PA, Friguet B et al. Oxidative modification and inactivation of the proteasome during coronary occlusion/reperfusion. J Biol Chem 2001; 276(32): 30057–63. [DOI] [PubMed] [Google Scholar]
  • 9.Ferrington DA, Kapphahn RJ. Catalytic site-specific inhibition of the 20S proteasome by 4-hydroxynonenal. FEBS letters 2004; 578(3): 217–23. [DOI] [PubMed] [Google Scholar]
  • 10.Farout L, Mary J, Vinh J, Szweda LI, Friguet B. Inactivation of the proteasome by 4-hydroxy-2-nonenal is site specific and dependant on 20S proteasome subtypes. Archives of biochemistry and biophysics 2006; 453(1): 135–42. [DOI] [PubMed] [Google Scholar]
  • 11.Akude E, Zherebitskaya E, Roy Chowdhury SK, Girling K, Fernyhough P. 4-Hydroxy-2-nonenal induces mitochondrial dysfunction and aberrant axonal outgrowth in adult sensory neurons that mimics features of diabetic neuropathy. Neurotoxicity research 2010; 17(1): 28–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kaplan P, Tatarkova Z, Racay P, Lehotsky J, Pavlikova M, Dobrota D. Oxidative modifications of cardiac mitochondria and inhibition of cytochrome c oxidase activity by 4-hydroxynonenal. Redox report : communications in free radical research 2007; 12(5): 211–8. [DOI] [PubMed] [Google Scholar]
  • 13.Keller JN, Mark RJ, Bruce AJ, Blanc E, Rothstein JD, Uchida K et al. 4-Hydroxynonenal, an aldehydic product of membrane lipid peroxidation, impairs glutamate transport and mitochondrial function in synaptosomes. Neuroscience 1997; 80(3): 685–96. [DOI] [PubMed] [Google Scholar]
  • 14.Keith RJ, Haberzettl P, Vladykovskaya E, Hill BG, Kaiserova K, Srivastava S et al. Aldose reductase decreases endoplasmic reticulum stress in ischemic hearts. Chemico-biological interactions 2009; 178(1-3): 242–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mali VR, Ning R, Chen J, Yang XP, Xu J, Palaniyandi SS. Impairment of aldehyde dehydrogenase-2 by 4-hydroxy-2-nonenal adduct formation and cardiomyocyte hypertrophy in mice fed a high-fat diet and injected with low-dose streptozotocin. Exp Biol Med (Maywood) 2014; 239(5): 610–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mali VR, Pan G, Deshpande M, Thandavarayan RA, Xu J, Yang XP et al. Cardiac Mitochondrial Respiratory Dysfunction and Tissue Damage in Chronic Hyperglycemia Correlate with Reduced Aldehyde Dehydrogenase-2 Activity. PLoS One 2016; 11(10): e0163158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Eaton P, Li JM, Hearse DJ, Shattock MJ. Formation of 4-hydroxy-2-nonenal-modified proteins in ischemic rat heart. Am J Physiol 1999; 276(3 Pt 2): H935–43. [DOI] [PubMed] [Google Scholar]
  • 18.Lucas DT, Szweda LI. Declines in mitochondrial respiration during cardiac reperfusion: age-dependent inactivation of alpha-ketoglutarate dehydrogenase. Proc Natl Acad Sci U S A 1999; 96(12): 6689–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen CH, Budas GR, Churchill EN, Disatnik MH, Hurley TD, Mochly-Rosen D. Activation of aldehyde dehydrogenase-2 reduces ischemic damage to the heart. Science 2008; 321(5895): 1493–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Goedde HW, Agarwal DP, Fritze G, Meier-Tackmann D, Singh S, Beckmann G et al. Distribution of ADH2 and ALDH2 genotypes in different populations. Hum Genet 1992; 88(3): 344–6. [DOI] [PubMed] [Google Scholar]
  • 21.Luo HR, Wu GS, Pakstis AJ, Tong L, Oota H, Kidd KK et al. Origin and dispersal of atypical aldehyde dehydrogenase ALDH2487Lys. Gene 2009; 435(1-2): 96–103. [DOI] [PubMed] [Google Scholar]
  • 22.Harada S, Agarwal DP, Goedde HW, Ishikawa B. Aldehyde dehydrogenase isozyme variation and alcoholism in Japan. Pharmacol Biochem Behav 1983; 18 Suppl 1: 151–3. [DOI] [PubMed] [Google Scholar]
  • 23.Crabb DW, Edenberg HJ, Bosron WF, Li TK. Genotypes for aldehyde dehydrogenase deficiency and alcohol sensitivity. The inactive ALDH2(2) allele is dominant. J Clin Invest 1989; 83(1): 314–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhong Z, Hou J, Li B, Zhang Q, Li C, Liu Z et al. Genetic Polymorphisms of the Mitochondrial Aldehyde Dehydrogenase ALDH2 Gene in a Large Ethnic Hakka Population in Southern China. Med Sci Monit 2018; 24: 2038–2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jo SA, Kim EK, Park MH, Han C, Park HY, Jang Y et al. A Glu487Lys polymorphism in the gene for mitochondrial aldehyde dehydrogenase 2 is associated with myocardial infarction in elderly Korean men. Clin Chim Acta 2007; 382(1-2): 43–7. [DOI] [PubMed] [Google Scholar]
  • 26.Takagi S, Iwai N, Yamauchi R, Kojima S, Yasuno S, Baba T et al. Aldehyde dehydrogenase 2 gene is a risk factor for myocardial infarction in Japanese men. Hypertens Res 2002; 25(5): 677–81. [DOI] [PubMed] [Google Scholar]
  • 27.Furfaro AL, Menini S, Patriarca S, Pesce C, Odetti P, Cottalasso D et al. HNE-dependent molecular damage in diabetic nephropathy and its possible prevention by N-acetyl-cysteine and oxerutin. Biofactors 2005; 24(1-4): 291–8. [DOI] [PubMed] [Google Scholar]
  • 28.Zambelli VO, Gross ER, Chen CH, Gutierrez VP, Cury Y, Mochly-Rosen D. Aldehyde dehydrogenase-2 regulates nociception in rodent models of acute inflammatory pain. Sci Transl Med 2014; 6(251): 251ra118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pan G, Roy B, Palaniyandi SS. Diabetic Aldehyde Dehydrogenase 2 Mutant (ALDH2*2) Mice Are More Susceptible to Cardiac Ischemic-Reperfusion Injury Due to 4-Hydroxy-2-Nonenal Induced Coronary Endothelial Cell Damage. J Am Heart Assoc 2021; 10(18): e021140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ma H, Guo R, Yu L, Zhang Y, Ren J. Aldehyde dehydrogenase 2 (ALDH2) rescues myocardial ischaemia/reperfusion injury: role of autophagy paradox and toxic aldehyde. Eur Heart J 2011; 32(8): 1025–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chen CH, Ferreira JCB, Mochly-Rosen D. ALDH2 and Cardiovascular Disease. Adv Exp Med Biol 2019; 1193: 53–67. [DOI] [PubMed] [Google Scholar]
  • 32.Zincarelli C, Soltys S, Rengo G, Rabinowitz JE. Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther 2008; 16(6): 1073–80. [DOI] [PubMed] [Google Scholar]
  • 33.Dipple KM, Crabb DW. The mitochondrial aldehyde dehydrogenase gene resides in an HTF island but is expressed in a tissue-specific manner. Biochem Biophys Res Commun 1993; 193(1): 420–7. [DOI] [PubMed] [Google Scholar]
  • 34.Anstee QM, Mantovani A, Tilg H, Targher G. Risk of cardiomyopathy and cardiac arrhythmias in patients with nonalcoholic fatty liver disease. Nat Rev Gastroenterol Hepatol 2018; 15(7): 425–439. [DOI] [PubMed] [Google Scholar]
  • 35.Bryson TD, Gu X, Khalil RM, Khan S, Zhu L, Xu J et al. Overexpression of prostaglandin E2 EP4 receptor improves cardiac function after myocardial infarction. J Mol Cell Cardiol 2018; 118: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Weber C, Neacsu I, Krautz B, Schlegel P, Sauer S, Raake P et al. Therapeutic safety of high myocardial expression levels of the molecular inotrope S100A1 in a preclinical heart failure model. Gene Ther 2014; 21(2): 131–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Woitek F, Zentilin L, Hoffman NE, Powers JC, Ottiger I, Parikh S et al. Intracoronary Cytoprotective Gene Therapy: A Study of VEGF-B167 in a Pre-Clinical Animal Model of Dilated Cardiomyopathy. J Am Coll Cardiol 2015; 66(2): 139–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.DiMattia MA, Nam HJ, Van Vliet K, Mitchell M, Bennett A, Gurda BL et al. Structural insight into the unique properties of adeno-associated virus serotype 9. J Virol 2012; 86(12): 6947–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ma H, Li J, Gao F, Ren J. Aldehyde dehydrogenase 2 ameliorates acute cardiac toxicity of ethanol: role of protein phosphatase and forkhead transcription factor. J Am Coll Cardiol 2009; 54(23): 2187–96. [DOI] [PubMed] [Google Scholar]
  • 40.Gomes KM, Campos JC, Bechara LR, Queliconi B, Lima VM, Disatnik MH et al. Aldehyde dehydrogenase 2 activation in heart failure restores mitochondrial function and improves ventricular function and remodelling. Cardiovasc Res 2014; 103(4): 498–508. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES