Skip to main content
Springer Nature - PMC COVID-19 Collection logoLink to Springer Nature - PMC COVID-19 Collection
. 2022 Nov 22;54(6):394. doi: 10.1007/s11250-022-03398-y

Prevalence of three Mycoplasma sp. by multiplex PCR in cattle with and without respiratory disease in central Mexico

L M Maya-Rodríguez 1, E M Carrillo-Casas 2, V Rojas-Trejo 1, F Trigo-Tavera 3, R E Miranda-Morales 1,
PMCID: PMC9685072  PMID: 36417039

Abstract

This study aimed to identify Mycoplasma bovis, Myc. dispar, and Myc. bovirhinis, which are involved in bovine respiratory disease through a multiplex PCR as an alternative to culture’s features that hamper Mycoplasma isolation. Nasal swabs were taken from 335 cattle with and without respiratory disease background (RDB) from dairy herds in the central region of Mexico. Each sample was divided in two; the first part was processed for the direct DNA extraction of the nasal swab and the second for Mycoplasma isolation, culture, and then the multiplex PCR was performed. In the nasal swabs, Myc. bovis was identified in 21.1%; Myc. dispar, in 11.8%; and Myc. bovirhinis, in 10.8% in cattle with RDB. Isolates were identified as Myc. bovis, 20.1%; Myc. dispar, 11.8%; and Myc. bovirhinis, 6.1%. There is a strong correlation between the presence of Mycoplasma identified by PCR and the clinical history of the disease (ρ < 0.0000). In animals without RDB, Myc. bovirhinis was the only species detected in 6.1% of the samples processed directly for multiplex PCR, and in 2% of the isolates. There is an excellent correlation (kappa 0.803) between the isolation and the 16S PCR and a high correlation (kappa 0.75) between the isolation and the multiplex PCR. Therefore, we conclude that the PCR multiplex test is highly sensitive and may be used for the diagnosis and surveillance of the three species in biological samples and mycoplasma isolates.

Supplementary Information

The online version contains supplementary material available at 10.1007/s11250-022-03398-y.

Keywords: Cattle, Bovine respiratory disease, Mycoplasma, Myc. bovis, Myc. dispar, Myc. bovirhinis

Introduction

Bovine respiratory disease (BRD) causes estimated losses between $800 million and $900 million annually due to death, reduced feed efficiency, and treatment costs (Brooks et al. 2011). These losses result from the generalized state of immunosuppression of the animal, favoured by the stress during handling together with environmental factors that contribute to the establishment of its multifactorial aetiology (Fulton et al. 2022; Gaudino et al. 2022). The viruses mainly associated with the BRD are bovine herpesvirus-1, the cause of the infectious bovine rhinotracheitis (IBR) (Jones and Chowdhury, 2007, 2010); bovine parainfluenza virus-3 (BPIV-3) (Bryson et al., 1979; Mehinagic et al. 2019); bovine viral diarrhoea virus 1 and 2 (BVDV-1–2) (Burciaga-Robles et al. 2010; Goto et al. 2021); bovine respiratory syncytial virus (BRSV) (Fulton et al. 2000; Sorden et al. 2000; Makoschey and Berge 2021); bovine adenovirus A–D (BAdV-A–D) (Fent et al 2002; Fulton, 2009) and bovine coronavirus (BCoV) (Storz et al. 1996; Frucchi et al 2022; Soules et al., 2022). The associated bacteria belong to the Pasteurellaceae Family Mannheimia haemolytica (Rice et al. 2007; Confer and Ayalew. 2018; Frucchi et al 2022), Pasteurella multocida (DeRosa et al. 2000; Storz et al. 2000; Frucchi et al 2022), Histophilus somni (Corbeil 2007; Shirbroun 2020), and the genus Mycoplasma: Myc. bovis, Myc. dispar and Myc. mycoides subsp. capri. Additionally, Myc. bovirhinis, a species that has been isolated from the nasopharyngeal cavity of healthy and diseased cattle, currently has been recognized as a species associated with BRD (Gourlay et al. 1979; Rosengarten and Citti, 1999; Angen et al. 2009; Bednarek et al. 2012).

Mycoplasma participates in host immunosuppression during the development of BRD (Simmons and Dybvig 2007; Maina et al., 2019) and causes acute clinical symptoms during viral coinfection. Mycoplasma is difficult to eliminate in herds, due to its ability to evade the defence mechanisms of the host’s immune system such as its surface variable lipoproteins (Christodoulides, et al. 2018), its ability to form biofilms (McAuliffe, et al. 2006) and adhesins that allow it to bind to neutrophils and lymphocytes (Askar, et al. 2021; Yiwen, et al. 2021). These characteristics, together with inadequate treatment and stress, perpetuate its persistence and spread in the cattle herd.

In dairy herds, the first 45 days of life are crucial in breeding cattle since in this period, the largest number of animals dies due to respiratory problems. Therefore, preventive measures such as the isolation of the animals and the use of vaccines are implemented to mitigate the economic impact of BRD (Loneragan et al. 2001; Dubrovsky et al. 2019). Hence, it is necessary to identify the causal agents to carry out the corrective biosecurity measures and the appropriate treatments for their control.

This study aimed to identify Myc. bovis, Myc. dispar and Myc. bovirhinis through their isolation and the application of a multiplex PCR in cattle with and without respiratory disease background to validate its use as a rapid diagnostic method allowing the reduction of the diagnosis time through culture.

Material and methods

Animals

A random sampling of cattle under 1 year of age was carried out in dairy herds of the central area of Mexico: Hidalgo, Aguascalientes, Guanajuato and Puebla. We considered clinically healthy animals that had not shown clinical symptoms of respiratory disease at the moment of the sampling, and according to the herd’s records, they had no respiratory disease reports in their lifetime. Animals considered to have respiratory disease were those that at the time of sampling had nasal discharges, cough, fever and/or pneumonia.

Each swab was stored in a sterile modified Hayflick medium (Jasper, 1981), transported to the laboratory at 4 °C, and then divided into two aliquots. The first one was for DNA extraction and the second for bacterial isolation. In compliance with the formula n = Z2 p.q/d2, the sample size was 335 cattle, from which 194 (57.91%) were sick animals with respiratory disease and 141 (42.08%) healthy animals.

Bacterial isolation

The Mycoplasma isolation was performed as stated by the methodology of Tully (1983); each sample was inoculated into modified Hayflick media, resuspended and divided into two aliquots. The first was used for DNA extraction directly from the nasal swab, and the second was serially diluted into a liquid medium from 10−1 to 10−3 for mycoplasma isolation. Each dilution was spread in a solid medium and further incubated at 37 °C in microaerophilic conditions in a candle jar. The pH changes, indicated by phenol-red, and/or slight turbidity were periodically examined as indicative of the bacteria development. Single Mycoplasma colonies were excised within tiny sections of agar, and they were inoculated into liquid media. The reseeding process was repeated at least three times until colonies had the typical fried egg appearance in a solid medium. Each Mycoplasma culture was assessed by 0.45 and 0.22 µm filtration, non-reversion to L-forms and digitonin sensitivity (Tully 1983; Howard and Rosenbusch, 1994).

DNA extraction

DNA was extracted from the nasal swabs by the guanidine thiocyanate protocol (Green and Sambrook, 2012). Mycoplasma has a long replication time, small size and small genome. Therefore, in order to harvest enough DNA, each Mycoplasma isolate was scaled up to 50 ml in Hayflick medium as follows. The first homogenization was performed by shaking the swab into 2 ml of Hayflick medium, from which 200 µl was added to 1.8 ml of fresh medium, and seeded in solid media to obtain single colony isolates. Then, each isolation was seeded in a fresh liquid medium, and as soon as the colour change of the prime culture was observed, approximately 12 h later, the prime culture was enriched with twice its volume to promote the development of Mycoplasma. This procedure was repeated until the required volume was obtained and harvested by centrifugation at 11,300 × g for 45 min at 4 °C, washed in triplicate with PBS (7.2 pH) and kept frozen at − 20 °C until the DNA extraction by the above-mentioned protocol. In our experience, a minimum of 20 ml of culture is sufficient for DNA extraction and will take about 15 to 20 days of incubation.

Endpoint PCR and multiplex PCR

The genus-specific PCR based on the 16S rRNA, with the primers forward 5′-CTGGCTGTGTGCCTAATACATGC-3′ and reverse 5′-CTTCGGGCATTACCAGCTCC-3′, was applied (L'Abee-Lund et al. 2003) with the following conditions: 96 °C for 5 min, followed by 30 cycles of 94 °C for 45 s, 68 °C for 1 min and 72 °C for 2 min, and a final extension at 72 °C for 5 min. The amplified product was 1370 bp. Myc. bovis DNA was used as positive control and Mannheimia haemolytica DNA as a negative control. The nasal swab samples and the isolates that were 16S rRNA PCR positive were subsequently assessed by multiplex PCR.

The multiplex PCR was based on the previously reported amplification of oppD and oppF from Myc. bovis (Hotzel et al. 1996), the rpoB gene for Myc. dispar identification (Rojas-Trejo, 2013) and new primers based on the rpoB gene of Myc. bovirhinis, GenBank accession number FJ765326.1 (Table 1). Reference strains of Myc. bovis (strain Donetta, ATCC 25,523), Myc. dispar (ATCC 27,140) and Myc. bovirhinis (ATCC 27,748) were used as controls. The reaction was prepared in 25 µl volume: 7.5 µl of H2O, 2.5 µl of 10 × buffer, 3.5 mm MgCl2, 200 mM dNTP, 10 µl DNA, 20 mM of each primer and 1.25 U Taq polymerase. The amplification program was 95 °C for 5 min, followed by 33 cycles of 94 °C for 45 s, 55 °C for 1 min, 72 °C for 1 min and a final extension at 72 °C for 7 min. PCR products were visualized by electrophoresis at 75 V for 55 min on a 1.5% agarose gel and stained with 0.5 mg/ml of ethidium bromide. DNA bands were visualized on a UV transilluminator and documented with a Gel Logic 212 Pro (Carestream, Woodbridge, CT, USA). As a molecular weight marker, a lane with 1 kb plus (Invitrogen) was included.

Table 1.

Multiplex PCR primers for the Mycoplasma species

Mycoplasma species Primer sequences (5′-3′) Product size (bp) Reference
Myc. bovis GCTCTTTTTGAACAAATACGTCAAGAG 1907 Hotzel et al. (1996)
GGCTCTCATTAAGAATGTCTTTGTCTAA
Myc. dispar GAGTTACTTCTCTTGGTCCTGGAGGTC 548 Rojas-Trejo (2013)
GCGGGCAATATCAGATTCAATTCCAGTTG
Myc. bovirhinis TGGATCAAATTAATCCATTATCAGAAGTTTC 397 This work
GTTCCGTTAGTATAAGTATAGTTACGACG

bp base pair

Statistical analysis

The non-parametric statistical analysis of chi-square was applied with 95% confidence (ρ = 0.005), with Statistical Package for the Social Sciences (SPSS), Windows, version 20.0. The accuracy measures for the multiplex PCR and Mycoplasma isolation were calculated, and the agreement measures between the multiplex PCR and isolation results were estimated by the Cohen’s kappa statistic (Cohen, 1960).

Results

The isolation of Mycoplasma spp. was possible in eighty-seven (25.97%) of the 335 nasal swabs; nine (10.34%) from healthy cattle, and seventy-eight (89.65%) from cattle with respiratory disease background. In three (3.4%) nasal swabs, more than one colony morphology was observed. All the isolates were bacteriologically typified as Mycoplasma spp. as they were digitonin sensitive, 0.45 and 0.22 µm filterable, retained their form and were positive to the genus-specific PCR based on the 16S rRNA (Supplementary Fig. S1; Diagram S1).

The PCR based on the 16S rRNA identified 115 (34.32%) positive nasal swabs; 99 (51.03%) from the 194 cattle with respiratory disease background and 16 (11.34%) from the 141 healthy cattle (Diagram S1). When the multiplex PCR was applied to the 99 nasal swabs from cattle with respiratory disease background, 79 were positive and 20 were negative to the species identified by this molecular tool remaining as Mycoplasma spp. in the light of the genus-specific PCR. When the multiplex PCR was applied to the 16 nasal swabs from healthy cattle, seven were positive and nine were negative, and also remained as Mycoplasma spp. (Table S1; Table 3; Diagram S1). These results mean that only 86 (74.78%) out of the 115 nasal swabs, previously identified by the 16S-PCR, were positive when the multiplex PCR was applied. These 86 positive nasal swabs to the multiplex PCR yielded 101 individual results as follows: Myc. bovis 43 (42.57%), Myc. bovirhinis 35 (34.65%) and Myc. dispar 23 (22.77%).

Table 3.

Comparison between the results of the multiplex PCR performed in healthy cattle and cattle with diseased backgrounds and the isolation results within both groups

Mycoplasma species Healthy cattle (total 141)
16 nasal swabs were 16S-PCR positive
Cattle with disease background (total 194)
99 nasal swabs were 16S-PCR positive and 78 were positive for isolation
Multiplex PCR Nasal swab Mycoplasma individual colony Multiplex PCR Nasal swab Mycoplasma
individual
colony
Myc. bovis 43 40
Myc. bovirhinis 7 4 28 16
Myc. dispar 23 23
Mycoplasma spp. 5 21c 11
Total 7a 9 78b 90

a3 of them had no isolation

b15 had more than one result

cNasal swabs that were 16S-PCR positive and negative to the multiplex PCR

Regarding the isolation, from the eighty-seven samples that showed bacterial growth, fifteen samples (17.24%) had more than one result for the mycoplasma species identified by the multiplex PCR, from which Myc. bovis was the most frequently isolated (Table 2; Tables S1, S2; Diagram S1). Twenty-nine samples that previously were positive for the 16S-PCR were negative for the mycoplasma species identified by the multiplex PCR, and 43 remained positive for only one mycoplasma species.

Table 2.

Comparison between the results of the multiplex PCR performed in the complete nasal swab samples and in the individual Mycoplasma colonies

graphic file with name 11250_2022_3398_Tab2_HTML.jpg

The multiplex PCR discriminates among the three mycoplasma species based on the length of the amplified products: 1907 bp (Myc. bovis), 548 bp (Myc. dispar) and 397 bp (Myc. bovirhinis) as shown in Supplementary Fig. 2. The limit of detection was calculated based on the genome sequences of each species and established at 2568 genome equivalents (GE) for the Myc. dispar PCR, at 6737 GE for the Myc. bovirhinis PCR and at 6730 GE for the Myc. bovis PCR. For the multiplex PCR, we used a mixture of the three DNAs to establish the limit of detection at 3516 GE. The estimation of GE was based on the 1,003,404 bp Myc. bovis ATCC 25,523 genome (Wise et al. 2011), the 1,065,810 bp Myc. dispar GS01 strain genome (Chen et al. 2019), the 948,039 bp Myc. bovirhinis strain HAZ141_2 genome (Hata et al. 2017) and the average molecular weight of a base pair of 617.96 g/mol.

Ninety-nine individual Mycoplasma colonies were retrieved from the 87 nasal swabs that were positive for the isolation. All of them were assessed by the multiplex PCR and identified as Myc. bovis 40 (40.40%), Myc. bovirhinis 20 (20.20%) and Myc. dispar 23 (23.23%) and sixteen colonies (16.16%) as Mycoplasma spp. (Table 2; Diagram S1).

The comparison between the isolation-positive nasal swabs from healthy cattle and cattle with disease backgrounds shows that in the nine healthy cattle, only four were identified by the multiplex PCR and five remained as Mycoplasma spp. in the light of the 16S-PCR. Aside from the seventy-eight isolation-positive nasal swabs from cattle with disease background, sixty-six were identified by the multiplex PCR with multiple results, and twelve remained positive to only Mycoplasma spp. in the light of the 16S-PCR (Table S1; Table 3; Diagram S1).

When comparing the individual colonies’ results with the multiplex PCR results, only four colonies out of nine isolated from healthy cattle were identified by the multiplex PCR as Myc. bovirhinis and five remain as Mycoplasma spp. Regarding the ninety individual colonies retrieved from cattle with disease backgrounds, 40 were identified as Myc. bovis, 23 as Myc. dispar, 16 as Myc. bovirhinis and 11 remained as Mycoplasma spp. (Table 3; Diagram S1). When Mycoplasma isolation is regarded as the gold standard, the kappa statistic (kappa 0.803) between the isolation and the 16S PCR was interpreted with “excellent agreement” (Fleiss et al., 2003) and that between isolation and the multiplex PCR was a high correlation (kappa 0.75). Regarding the measures of accuracy between the multiplex PCR results and isolation, based on the species level, the multiplex PCR showed 82% sensitivity and 46% specificity.

The prevalence of the Mycoplasma genus in dairy herds in the central region was 34.32%. There is a positive correlation between the previous background of respiratory disease and the presence of Mycoplasma identified by PCR in nasal swabs ρ < 0.0000. Additionally, Myc. bovirhinis was the most significant of the three species ρ = 0.005 (< 0.05) in healthy cattle and Myc. bovis in cattle with disease background. Both species were successfully identified by the multiplex PCR.

Discussion

The BRD at necropsy is associated with caseous bronchopneumonia and coagulative necrosis, with poor response to antibiotic treatment in chronic pneumonia, and the main species associated with this presentation is Myc. bovis. (Gagea et al. 2006; Caswell and Archambault 2007; Kleinschmidt et al. 2013). Myc. dispar has been reported mostly in adults, and it causes pneumonic lesions (Pirie and Allan 1975; Gourlay and Howard 1982), and in young animals, it causes immunosuppression. In this study, we identified Myc. dispar in cattle between ages of 180 and 225 days. Given that Myc. bovirhinis is part of the normal microbiota of cattle (Gourlay et al. 1979; Allen et al. 1992), we can explain why we identified this mycoplasma species in only 6.1% of healthy animals; these cattle were also identified as negative by the multiplex PCR, probably caused by a low yield of DNA during the extraction that may have been under the PCR limit of detection. On the other hand, Myc. bovis has been also identified in asymptomatic cattle and as the cause of mild pneumonia (Prysliak et al. 2011; Franca Dias de Oliveira et al. 2016; Murray et al. 2017). However, when there is the coinfection of bacteria and viruses, it will cause severe disease (Tegtmeier et al. 1999; Angen et al. 2009).

This genus has the feature of lacking a cell wall; it may survive in the environment for several days at temperatures up to 4 °C (Pfutzner, 1984) and perpetuates itself to take part in long-lasting mastitis, arthritis and otitis. These genus features explain why Myc. bovis, Myc. dispar and Myc. bovirhinis are species with a high incidence of up to 50% in the cattle herd in the country centre and the correlation between their identification by PCR and the respiratory disease background in the assessed cattle.

The isolation of a microorganism is subjected to its requirements, the bacterial load and other factors including the presence of inhibitory substances in the sample such as enzymes, antibodies and/or antibiotics, the disease stage and culture conditions; therefore, it is understandable the greater efficiency of PCR for the identification of the Mycoplasma genus. As for other mycoplasma species, the application of molecular techniques has more accuracy and sensitivity than culture (Stellrecht et al. 2004; Garcia et al. 2005; Hong et al. 2011; Jamalizadeh Bahaabadi et al. 2014). The multiplex PCR herein applied has a detection limit of 3515 GE. This limit follows previous reports of other applications for Mycoplasma spp. which are above 1000 GE (Stemke et al. 1994; Strait et al. 2008; Charlebois et al. 2014), or between 103 and 106 colony forming units (Razin, 1994). Additionally, results can be obtained in less than a week compared to the culture which can take 30 days.

The species-specific fragments amplified by the multiplex PCR were easily distinguished on the electrophoresis gel, showing their capacity for the identification with the minimum concentration of genomic DNA of the different species. In this study, Myc. dispar and Myc. bovirhinis were identified based on the rpoB gene. As confirmation, the products of the hypervariable region of the rpoB gene of some isolates were sequenced, which allows us to guarantee the specificity of the assay (Das et al. 2014).

Among the limitations of the study, the mycoplasmas that were not identified by multiplex PCR had to be preserved for later studies. Likewise, conventional PCR was chosen over qPCR because there are many places in our country that do not have access to sophisticated laboratories. In those locations, producers and field veterinarians have easier, faster and cheaper access to small laboratories with conventional equipment that may make this test available and affordable.

To the best of our knowledge, mucus does not have inhibitors in great amounts (Schrader et al. 2012), and the guanidine thiocyanate DNA extraction protocol removes some inhibitory substances, including mycoplasma growth inhibitors. Therefore, the inclusion of internal control was not considered since it must be included in the same reaction and multiplexed at the same time as the multiplex PCR, and a serious drawback is that it can cause the reaction to fail or give a false-positive result. Instead, external positive control, negative control and non-template control were included.

Altogether, the results herein presented showed that the multiplex PCR compared to Mycoplasma isolation was highly sensitive (82%), and it can be used as a diagnostic test and for the surveillance of the disease allowing the simultaneous identification of Myc. bovis, Myc. dispar and Myc. Bovirhinis.

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

LMMR is a MSc student from Programa de Maestría en Ciencias de la Salud y Producción animal, Universidad Nacional Autónoma de México (UNAM) and received fellowships 348956 and 283499 from CONACyT.

Author contribution

LMMR performed the material preparation, experiments, and fieldwork. VT contributed to the design and implementation of the research. EMCC provided critical feedback; did data analysis and wrote the manuscript. FTT and REMM designed and directed the research and provided critical feedback. All authors read and approved the final manuscript.

Funding

This work was supported by grants DGAPA-UNAM-PAPIIT IN222412-3 and DGAPA-UNAM-PAPIIT IN222515.

Data availability

Supplementary tables are included.

Code availability

Not applicable.

Declarations

Ethics approval

This study was performed with the consent of all farmers. All handing of animals in connection with sampling was performed, considering animal welfare and following international and national guidelines.

Consent to participate

Verbal informed consent was obtained prior to the interview of the dairy farmers.

Consent for publication

The interviewed dairy farmers have consented to the submission of the results of this study to the journal.

Conflict of interest

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Allen JW, Viel L, Bateman KG, Rosendal S. Changes in the bacterial flora of the upper and lower respiratory tracts and bronchoalveolar lavage differential cell counts in feedlot calves treated for respiratory diseases. Canadian Journal of Veterinary Research = Revue Canadienne de Recherche Veterinaire. 1992;56:177–183. [PMC free article] [PubMed] [Google Scholar]
  2. Angen Ø, Thomsen J, Larsen LE, Larsen J, Kokotovic B, Heegaard PMH, Enemark JMD. Respiratory disease in calves: Microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein response. Veterinary Microbiology. 2009;137:165–171. doi: 10.1016/j.vetmic.2008.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Askar H, Chen S, Hao H, Yan X, Ma L, Liu Y, Chu Y. Immune Evasion of Mycoplasma bovis. Pathogens. 2021;10:297. doi: 10.3390/pathogens10030297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bednarek D, Ayling RD, Nicholas RAJ, Dudek K, Szymańska-Czerwińska M. Serological survey to determine the occurrence of respiratory Mycoplasma infections in the Polish cattle population. Veterinary Record. 2012;171:45. doi: 10.1136/vr.100545. [DOI] [PubMed] [Google Scholar]
  5. Brooks KR, Raper KC, Ward CE, Holland BP, Krehbiel CR, Step DL. Economic effects of bovine respiratory disease on feedlot cattle during backgrounding and finishing phases 1. The Professional Animal Scientist. 2011;27:195–203. doi: 10.15232/S1080-7446(15)30474-5. [DOI] [Google Scholar]
  6. Bryson DG, McNulty MS, Ball HJ, Neill SD, Connor TJ, Cush PF. The experimental production of pneumonia in calves by intranasal inoculation of parainfluenza type III virus. The Veterinary Record. 1979;105:566–573. [PubMed] [Google Scholar]
  7. Burciaga-Robles LO, Step DL, Krehbiel CR, Holland BP, Richards CJ, Montelongo MA, Confer AW, Fulton RW. Effects of exposure to calves persistently infected with bovine viral diarrhea virus type 1b and subsequent infection with Mannheimia haemolytica on clinical signs and immune variables: model for bovine respiratory disease via viral and bacterial interaction. Journal of Animal Science. 2010;88:2166–2178. doi: 10.2527/jas.2009-2005. [DOI] [PubMed] [Google Scholar]
  8. Caswell JL, Archambault M. Mycoplasma bovis pneumonia in cattle. Animal Health Research Reviews. 2007;8:161–186. doi: 10.1017/S1466252307001351. [DOI] [PubMed] [Google Scholar]
  9. Charlebois A, Marois-Crehan C, Helie P, Gagnon CA, Gottschalk M, Archambault M. Genetic diversity of Mycoplasma hyopneumoniae isolates of abattoir pigs. Veterinary Microbiology. 2014;168:348–356. doi: 10.1016/j.vetmic.2013.11.006. [DOI] [PubMed] [Google Scholar]
  10. Chen S, Hao H, Yan X, Liu Y, Chu Y. Genome-wide analysis of Mycoplasma dispar provides insights into putative virulence factors and phylogenetic relationships. G3 (Bethesda) 2019;9:317–325. doi: 10.1534/g3.118.200941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Christodoulides A, Gupta N, Yacoubian V, Maithel N, Parker J, Kelesidis T. The Role of lipoproteins in Mycoplasma-mediated immunomodulation. Frontiers in Microbiology. 2018;9:1682. doi: 10.3389/fmicb.2018.01682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cohen J. A coefficient of agreement for nominal scales. Educational and Psychological Measurement. 1960;20:37–46. doi: 10.1177/001316446002000104. [DOI] [Google Scholar]
  13. Confer AW, Ayalew S. Mannheimia haemolytica in bovine respiratory disease: immunogens, potential immunogens, and vaccines. Animal Health Research Reviews. 2018;19:79–99. doi: 10.1017/S1466252318000142. [DOI] [PubMed] [Google Scholar]
  14. Corbeil L. Histophilus somni host-parasite relationships. Animal Health Research Reviews. 2007;8:151–160. doi: 10.1017/S1466252307001417. [DOI] [PubMed] [Google Scholar]
  15. Das S, Dash HR, Mangwani N, Chakraborty J, Kumari S. Understanding molecular identification and polyphasic taxonomic approaches for genetic relatedness and phylogenetic relationships of microorganisms. Journal of Microbiological Methods. 2014;103:80–100. doi: 10.1016/j.mimet.2014.05.013. [DOI] [PubMed] [Google Scholar]
  16. DeRosa DC, Mechor GD, Staats JJ, Chengappa MM, Shryock TR. Comparison of Pasteurella spp. simultaneously isolated from nasal and transtracheal swabs from cattle with clinical signs of bovine respiratory disease. Journal of Clinical Microbiology. 2000;38:327–332. doi: 10.1128/JCM.38.1.327-332.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dubrovsky SA, Van Eenennaam AL, Karle BM, Rossitto PV, Lehenbauer TW, Aly SS. Epidemiology of bovine respiratory disease (BRD) in preweaned calves on California dairies: The BRD 10K study. Journal of Dairy Science. 2019;102:7306–7319. doi: 10.3168/jds.2018-14774. [DOI] [PubMed] [Google Scholar]
  18. Dias Franca, de Oliveira BA, Carrillo Gaeta N, Mendonca Ribeiro BL, Reyes Aleman MA, Miranda Marques L, Timenetsky J, Melville PA, Avansi Marques J, Marvulle V, Gregory L. Determination of bacterial aetiologic factor on tracheobronchial lavage in relation to clinical signs of bovine respiratory disease. Journal of Medical Microbiology. 2016;65:1137–1142. doi: 10.1099/jmm.0.000345. [DOI] [PubMed] [Google Scholar]
  19. Fent GM, Fulton RW, Saliki JT, Caseltine SL, Lehmkuhl HD, Confer AW, Purdy CW, Briggs RE, Loan RW, Duff GC. Bovine adenovirus serotype 7 infections in postweaning calves. American Journal of Veterinary Research. 2002;63:976–978. doi: 10.2460/ajvr.2002.63.976. [DOI] [PubMed] [Google Scholar]
  20. Fleiss, J. L., Levin, B., Paik, M. C., 2003. Statistical Methods for Rates and Proportions. Wiley Series in Probability and Statistics, Hoboken, NJ. pp 768. 10.1002/0471445428.
  21. Frucchi A, Dall Agnol AM, Bronkhorst DE, Beuttemmuller EA, Alfieri AA, Alfieri AF. Bovine coronavirus co-infection and molecular characterization in dairy calves with or without clinical respiratory disease. Frontiers in Veterinary Science. 2022;9:895492. doi: 10.3389/fvets.2022.895492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fulton RW, Purdy CW, Confer AW, Saliki JT, Loan RW, Briggs RE, Burge LJ. Bovine viral diarrhea viral infections in feeder calves with respiratory disease: interactions with Pasteurella spp., parainfluenza-3 virus, and bovine respiratory syncytial virus. Canadian Journal of Veterinary Research = Revue Canadienne de Recherche Veterinaire. 2000;64:151–159. [PMC free article] [PubMed] [Google Scholar]
  23. Fulton RW, Cook BJ, Step DL, Confer AW, Saliki JT, Payton ME, Burge LJ, Welsh RD, Blood KS. Evaluation of health status of calves and impact on feedlot performance: assessment of retained ownership program for postweaning calves. Canadian Journal of Veterinary Research = Revue Canadienne de Recherche Veterinaire. 2022;66:173–180. [PMC free article] [PubMed] [Google Scholar]
  24. Fulton, R.W., 2009. Viral diseases of the bovine respiratory tract - abstract - Europe PMC. Food Animal Practice, Jan, 171–191.
  25. Gagea MI, Bateman KG, Shanahan RA, van Dreumel T, McEwen BJ, Carman S, Archambault M, Caswell JL. Naturally occurring Mycoplasma bovis-associated pneumonia and polyarthritis in feedlot beef calves. Journal of veterinary diagnostic investigation: official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2006;18:29–40. doi: 10.1177/104063870601800105. [DOI] [PubMed] [Google Scholar]
  26. Garcia M, Ikuta N, Levisohn S, Kleven SH. Evaluation and comparison of various PCR methods for detection of Mycoplasma gallisepticum infection in chickens. Avian Diseases. 2005;49:125–132. doi: 10.1637/7261-0812204R1. [DOI] [PubMed] [Google Scholar]
  27. Gaudino M, Nagamine B, Ducatez MF, Meyer G. Understanding the mechanisms of viral and bacterial coinfections in bovine respiratory disease: a comprehensive literature review of experimental evidence. Veterinary Research. 2022;53:70. doi: 10.1186/s13567-022-01086-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Goto Y, Yaegashi G, Fukunari K, Suzuki T. Clinical analysis for long-term sporadic bovine viral diarrhea transmitted by calves with an acute infection of bovine viral diarrhea virus 2. Viruses. 2021;13:621. doi: 10.3390/v13040621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gourlay RN, Howard CJ. Respiratory mycoplasmosis. Advances in Veterinary Science and Comparative Medicine. 1982;26:289–332. [PubMed] [Google Scholar]
  30. Gourlay RN, Howard CJ, Thomas LH, Wyld SG. Pathogenicity of some Mycoplasma and Acholeplasma species in the lungs of gnotobiotic calves. Research in Veterinary Science. 1979;27:233–237. doi: 10.1016/S0034-5288(18)32836-4. [DOI] [PubMed] [Google Scholar]
  31. Green, M.R. and Sambrook J., 2012. 4th edition, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY, USA: CSH Press), pp1936.
  32. Hata, E., Nagai, K., Murakami, K., 2017. Complete genome sequence of Mycoplasma bovirhinis Strain HAZ141_2 from bovine nasal discharge in Japan, Genome Announcements, 5, e01000-01017. [DOI] [PMC free article] [PubMed]
  33. Hong S, Lee HA, Park SH, Kim O. Sensitive and specific detection of Mycoplasma species by consensus polymerase chain reaction and dot blot hybridization. Laboratory Animal Research. 2011;27:141–145. doi: 10.5625/lar.2011.27.2.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hotzel H, Sachse K, Pfutzner H. Rapid detection of Mycoplasma bovis in milk samples and nasal swabs using the polymerase chain reaction. The Journal of Applied Bacteriology. 1996;80:505–510. doi: 10.1111/j.1365-2672.1996.tb03249.x. [DOI] [PubMed] [Google Scholar]
  35. Howard CJ, Rosenbusch RF. Mycoplasmosis in Animals: Laboratory Diagnosis. Ames: Iowa State University Press; 1994. [Google Scholar]
  36. Jamalizadeh Bahaabadi S, Mohseni Moghadam N, Kheirkhah B, Farsinejad A, Habibzadeh V. Isolation and molecular identification of Mycoplasma hominis in infertile female and male reproductive system. Nephro-Urology Monthly. 2014;6:e22390. doi: 10.5812/numonthly.22390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Jasper DE. Bovine mycoplasmal mastitis. Advances in Veterinary Science and Comparative Medicine. 1981;25:121–157. [PubMed] [Google Scholar]
  38. Jones C, Chowdhury S. A review of the biology of bovine herpesvirus type 1 (BHV-1), its role as a cofactor in the bovine respiratory disease complex and development of improved vaccines. Animal Health Research Reviews. 2007;8:187–205. doi: 10.1017/S146625230700134X. [DOI] [PubMed] [Google Scholar]
  39. Jones C, Chowdhury S. Bovine herpesvirus type 1 (BHV-1) is an important cofactor in the bovine respiratory disease complex, The Veterinary clinics of North America. Food Animal Practice. 2010;26:303–321. doi: 10.1016/j.cvfa.2010.04.007. [DOI] [PubMed] [Google Scholar]
  40. Kleinschmidt S, Spergser J, Rosengarten R, Hewicker-Trautwein M. Long-term survival of Mycoplasma bovis in necrotic lesions and in phagocytic cells as demonstrated by transmission and immunogold electron microscopy in lung tissue from experimentally infected calves. Veterinary Microbiology. 2013;162:949–953. doi: 10.1016/j.vetmic.2012.11.039. [DOI] [PubMed] [Google Scholar]
  41. L'Abee-Lund TM, Heiene R, Friis NF, Ahrens P, Sorum H. Mycoplasma canis and urogenital disease in dogs in Norway. The Veterinary Record. 2003;153:231–235. doi: 10.1136/vr.153.8.231. [DOI] [PubMed] [Google Scholar]
  42. Loneragan GH, Dargatz DA, Morley PS, Smith MA. Trends in mortality ratios among cattle in US feedlots. Journal of the American Veterinary Medical Association. 2001;219:1122–1127. doi: 10.2460/javma.2001.219.1122. [DOI] [PubMed] [Google Scholar]
  43. Maina T, Prysliak T, Perez-Casal J. Mycoplasma bovis delay in apoptosis of macrophages is accompanied by increased expression of anti-apoptotic genes, reduced cytochrome C translocation and inhibition of DNA fragmentation. Veterinary Immunology and Immunopathology. 2019;208:16–24. doi: 10.1016/j.vetimm.2018.12.004. [DOI] [PubMed] [Google Scholar]
  44. Makoschey B, Berge AC. Review on bovine respiratory syncytial virus and bovine parainfluenza - usual suspects in bovine respiratory disease - a narrative review. BMC Veterinary Research. 2021;17:261. doi: 10.1186/s12917-021-02935-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. McAuliffe L, Ellis RJ, Miles K, Ayling RD, Nicholas RAJ. Biofilm formation by Mycoplasma species and its role in environmental persistence and survival. Microbiology. 2006;152:913–922. doi: 10.1099/mic.0.28604-0. [DOI] [PubMed] [Google Scholar]
  46. Mehinagic K, Pilo P, Vidondo B, Stokar-Regenscheit N. Coinfection of Swiss cattle with bovine parainfluenza virus 3 and Mycoplasma bovis at acute and chronic stages of bovine respiratory disease complex. Journal of Veterinary Diagnostic Investigation: Official Publication of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2019;31:674–680. doi: 10.1177/1040638719861686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Murray GM, O'Neill RG, Lee AM, McElroy MC, More SJ, Monagle A, Earley B, Cassidy JP. The bovine paranasal sinuses: Bacterial flora, epithelial expression of nitric oxide and potential role in the in-herd persistence of respiratory disease pathogens. PloS One. 2017;12:e0173845. doi: 10.1371/journal.pone.0173845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Pfutzner H. Tenazität von Mycoplasma bovis. Zentralblatt Fur Bakteriologie, Mikrobiologie, Und Hygiene Series a, Medical Microbiology, Infectious Diseases, Virology, Parasitology. 1984;258:38–41. doi: 10.1016/S0176-6724(84)80006-1. [DOI] [PubMed] [Google Scholar]
  49. Pirie HM, Allan EM. Mycoplasmas and cuffing pneumonia in a group of calves. The Veterinary Record. 1975;97:345–349. doi: 10.1136/vr.97.18.345. [DOI] [PubMed] [Google Scholar]
  50. Prysliak T, van der Merwe J, Lawman Z, Wilson D, Townsend H, van Little D, van den Hurk S, Perez-Casal J. Respiratory disease caused by Mycoplasma bovis is enhanced by exposure to bovine herpes virus 1 (BHV-1) but not to bovine viral diarrhea virus (BVDV) type 2. The Canadian Veterinary Journal = La Vevue Veterinaire Canadienne. 2011;52:1195–1202. [PMC free article] [PubMed] [Google Scholar]
  51. Razin S. DNA probes and PCR in diagnosis of mycoplasma infections. Molecular and Cellular Probes. 1994;8:497–511. doi: 10.1006/mcpr.1994.1071. [DOI] [PubMed] [Google Scholar]
  52. Rice JA, Carrasco-Medina L, Hodgins DC, Shewen PE. Mannheimia haemolytica and bovine respiratory disease. Animal Health Research Reviews. 2007;8:117–128. doi: 10.1017/S1466252307001375. [DOI] [PubMed] [Google Scholar]
  53. Rojas-Trejo, V., 2013. Tipificación de micoplamas aislados de bovinos con problemas respiratorios en México. (MSc thesis, Department of Microbiology and Immunology. National Autonomous University of Mexico, Mexico) p.87.
  54. Rosengarten, R. and Citti, C., 1999. The role of ruminant mycoplasmas in systemic infections. In: L. Stipkovits, L., Rosengarten, R., and J. Frey. (eds), COST: 826 Agriculture and biotechnology, Mycoplasmas of ruminants: pathogenicity, diagnostics, epidemiology and molecular genetics. European Cooperation on Scientific and Technical Research, Belgium. 3, p.14–17.
  55. Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors-occurrence, properties, and removal. Journal of Applied Microbiology. 2012;113:1014–1026. doi: 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]
  56. Shirbroun RM. Histophilus somni: Antigenic and Genomic Changes Relevant to Bovine Respiratory Disease. The Veterinary clinics of North America. Food Animal Practice. 2020;36:279–295. doi: 10.1016/j.cvfa.2020.02.003. [DOI] [PubMed] [Google Scholar]
  57. Simmons WL, Dybvig K. How some Mycoplasmas evade Host Immune Responses. Microbe. 2007;2:537–543. [Google Scholar]
  58. Sorden SD, Kerr RW, Janzen ED. Interstitial pneumonia in feedlot cattle: concurrent lesions and lack of immunohistochemical evidence for bovine respiratory syncytial virus infection. Journal of Veterinary Diagnostic Investigation: Official Publication of the American Association of Veterinary Laboratory Diagnosticians, Inc. 2000;12:510–517. doi: 10.1177/104063870001200604. [DOI] [PubMed] [Google Scholar]
  59. Soules KR, Rahe MC, Purtle L, Moeckly C, Stark P, Samson C, Knittel JP. Bovine coronavirus infects the respiratory tract of cattle challenged Intranasally. Frontiers in Veterinary Science. 2022;9:878240. doi: 10.3389/fvets.2022.878240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Stellrecht KA, Woron AM, Mishrik NG, Venezia RA. Comparison of multiplex PCR assay with culture for detection of genital mycoplasmas. Journal of Clinical Microbiology. 2004;42:1528–1533. doi: 10.1128/JCM.42.4.1528-1533.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Stemke GW, Phan R, Young TF, Ross RF. Differentiation of Mycoplasma hyopneumoniae, M. flocculare, and M. hyorhinis on the basis of amplification of a 16S rRNA gene sequence. American Journal of Veterinary Research. 1994;55:81–84. [PubMed] [Google Scholar]
  62. Storz J, Stine L, Liem A, Anderson GA. Coronavirus isolation from nasal swab samples in cattle with signs of respiratory tract disease after shipping. Journal of the American Veterinary Medical Association. 1996;208:1452–1455. [PubMed] [Google Scholar]
  63. Storz J, Lin X, Purdy CW, Chouljenko VN, Kousoulas KG, Enright FM, Gilmore WC, Briggs RE, Loan RW. Coronavirus and Pasteurella infections in bovine shipping fever pneumonia and Evans' criteria for causation. Journal of Clinical Microbiology. 2000;38:3291–3298. doi: 10.1128/JCM.38.9.3291-3298.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Strait EL, Madsen ML, Minion FC, Christopher-Hennings J, Dammen M, Jones KR, Thacker EL. Real-time PCR assays to address genetic diversity among strains of Mycoplasma hyopneumoniae. Journal of Clinical Microbiology. 2008;46:2491–2498. doi: 10.1128/JCM.02366-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tegtmeier C, Uttenthal A, Friis NF, Jensen NE, Jensen HE. Pathological and microbiological studies on pneumonic lungs from Danish calves. Zentralblatt Fur Veterinarmedizin Reihe B Journal of Veterinary Medicine Series B. 1999;46:693–700. doi: 10.1046/j.1439-0450.1999.00301.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tully, J.G., 1983. C12 - Cloning and filtration techniques for Mycoplasmas. In: S. Razin and J.G. Tully (eds), Methods in Mycoplasmology,1983, (Academic Press),173–177.
  67. Wise KS, Calcutt MJ, Foecking MF, Röske K, Madupu R, Methé BA. Complete genome sequence of Mycoplasma bovis type strain PG45 (ATCC 25523) Infection and Immunity. 2011;79:982. doi: 10.1128/IAI.00726-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Yiwen C, Yueyue W, Lianmei Q, Cuiming Z, Xiaoxing Y. Infection strategies of mycoplasmas: Unraveling the panoply of virulence factors. Virulence. 2021;12:788–817. doi: 10.1080/21505594.2021.1889813. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Supplementary tables are included.

Not applicable.


Articles from Tropical Animal Health and Production are provided here courtesy of Nature Publishing Group

RESOURCES