Abstract
Background
Genomic analysis indicated that the genomes of ascomycetes might carry dozens of biosynthetic gene clusters (BGCs), yet many clusters have remained enigmatic. The ascomycete genus Epicoccum, belonging to the family Didymellaceae, is ubiquitous that colonizes different types of substrates and is associated with phyllosphere or decaying vegetation. Species of this genus are prolific producers of bioactive substances. The epicoccamides, as biosynthetically distinct mannosylated tetramate, were first isolated in 2003 from Epicoccum sp. In this study, using a combination of genome mining, chemical identification, genetic deletion, and bioinformatic analysis, we identified the required BGC epi responsible for epicoccamide A biosynthesis in Epicoccum sp. CPCC 400996.
Results
The unconventional biosynthetic gene cluster epi was obtained from an endophyte Epicoccum sp. CPCC 400996 through AntiSMASH-based genome mining. The cluster epi includes six putative open reading frames (epiA-epiF) altogether, in which the epiA encodes a tetramate-forming polyketide synthase and nonribosomal peptide synthetases (PKS−NRPS hybrid). Sequence alignments and bioinformatic analysis to other metabolic pathways of fungal tetramates, we proposed that the gene cluster epi could be involved in generating epicoccamides. Genetic knockout of epiA completely abolished the biosynthesis of epicoccamide A (1), thereby establishing the correlation between the BGC epi and biosynthesis of epicoccamide A. Bioinformatic adenylation domain signature analysis of EpiA and other fungal PKS-NRPSs (NRPs) indicated that the EpiA is l-alanine incorporating tetramates megasynthase. Furthermore, based on the molecular structures of epicoccamide A and deduced gene functions of the cluster epi, a hypothetic metabolic pathway for biosynthesizing compound 1 was proposed. The corresponding tetramates releasing during epicoccamide A biosynthesis was catalyzed through Dieckmann-type cyclization, in which the reductive (R) domain residing in terminal module of EpiA accomplished the conversion. These results unveiled the underlying mechanism of epicoccamides biosynthesis and these findings might provide opportunities for derivatization of epicoccamides or generation of new chemical entities.
Conclusion
Genome mining and genetic inactivation experiments unveiled a previously uncharacterized PKS − NRPS hybrid-based BGC epi responsible for the generation of epicoccamide A (1) in endophyte Epicoccum sp. CPCC 400996. In addition, based on the gene cluster data, a hypothetical biosynthetic pathway of epicoccamide A was proposed.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12934-022-01975-2.
Keywords: Epicoccamide, Genome mining, PKS−NRPS hybrid, Tetramates, Biosynthesis, Epicoccum
Background
Filamentous fungi have been demonstrated to be attractive and rich repertoires for pharmaceutical drugs in human history [1, 2]. However, it is becoming challenging to acquire novel lead compounds with traditional chemical-only methodologies for high frequency of rediscovery of known molecules [3]. Thus, several approaches have been employed to activate cryptic biosynthetic pathways, including “OSMAC” approach [4, 5], co-culture [6, 7], and chemical epigenetic agents supplement [8, 9]. Additionally, genome sequencing has revolutionized natural products (NPs) exploitation endeavor, demonstrating that the capacity of filamentous fungi to yield compounds was far more than we anticipated [2, 10]. Meanwhile, we could now easily access to the sequenced genome of targeted microorganism whose metabolites have not been, or rarely, characterized. Genome-guided mining approach is usually conducted to set up the linking between secondary metabolites identification and targeted biosynthetic gene clusters (BGCs) verification [11, 12]. Also, previous studies have demonstrated that genome mining is an effective approach that facilitated exploitation for new metabolites with fascinating structures, and numerous BGCs were investigated [10, 13, 14]. Thus, the genome-guided metabolomic analysis strategy renders the bioprospecting of bioactive compounds effective and promising.
Tetramic acid derivatives bearing pyrrolidine-2, 4-dione ring system, comprise a structurally unique family of secondary metabolites (SMs) (Fig. 1) [15]. Naturally occurring tetramates have attracted increasing interest from pharmaceutical and research communities due to their diverse bioactivities including antibacterial, fungicidal, antiviral, and cytotoxic potencies [16–18]. Biosynthetically, most tetramate derivatives are originated from polyketide synthase-nonribosomal peptide synthase (PKS−NRPSs) hybrid pathways, and these polyketide −peptide compounds are generated from Dieckmann condensation of an amino acid (or nonproteinogenic) to a polyketide-derived acyl chain [16, 19]. Recently, postgenomic analysis accelerated the biosynthetic studies on this class of SMs, and numerous tetramate-forming biocatalysts have been elucidated, as exemplified by aspyridone [20], tenellin [21], tirandamycin [15], cyclopiazonic acid [22], fusarisetin A [23], pseurotin [24], streptolydigin [25], pyranoviolin [26], oxaleimide A [27], burnettramic acid [28], and calipyridone [29]. Although these studies revealed the molecular bases for these tetramates and demonstrated that diverse arrays of fascinating biocatalysts are the key components for their structural diversification [16, 18]. However, many biosynthetic reactions still remain to be unveiled.
Fig. 1.
Representatives of naturally occurring tetramic acid derivatives. The pyrrolidine-2, 4-dione ring unit is in red
Epicoccum genus is distributed widespread, which has been frequently isolated as endophytes residing in medicinal plants [30] and found to live in association with other organism [31, 32]. Species from this genus are prolific producers of bioactive secondary metabolites, including epicorazines, (dithio)diketopiperazines, triornicin, flavipins, epicocconigrones, epicoccolides, epicocconone, and epicolactone dimers (beetleane A, epicoane A) [14, 31, 33–35]. The metabolites isolated from Epicoccum strains, cover a diverse array of bioactivities including strong inhibitors of liver fibrosis, cytotoxic and antimicrobial activities, making them potential drug candidates [31]. The epicoccamides, as biosynthetically distinct tetramic acid glycoside, were first isolated in 2003 from a jellyfish-derived culture of E. purpurascens and later identified in Epicoccum sp. [36] However, the genetic basis of this metabolite has been elusive and needs to be investigated. Recently, Li and coworkers characterized a gene cluster bua involving in the burnettramic acid generation from Aspergillus burnettii, which revealed that the PKS−NRPS hybrid BuaA and the mannoyltransferase BuaB functioned in the formation of proline-incorporating polyketide aglycone skeleton and β-D-mannose transferring, respectively [28]. This example strongly proved that genome-guided metabolite mining is a feasible approach to mine potential secondary metabolites [28]. Therefore, the exploitation for rare or new Epicoccum species contributed to develop an efficient strategy for targeted genome mining of tetramates and discovery of new bioactive compounds.
Herein, we investigated an uncharacterized tetramate-forming gene cluster in the fungal strain Epicoccum sp. CPCC 400996. Furthermore, one mannosylated pyrrolizidinedione molecule named epicoccamide A was readily identified. Intriguingly, using a combination of genetic knockout, bioinformatic analysis, and a plausible biosynthetic pathway of 1 was also proposed. Our study has implications for developing a strategy for rapid targeted linkage of secondary metabolites to their encoding BGCs by genome mining and facilitates future applications for generation of bioactive molecules through metabolic engineering.
Materials and methods
Strains, plasmids, and culture
The fungus Epicoccum sp. CPCC 400996 was isolated from the medicinal plant, deposited in the China Pharmaceutical Culture Collection Center (CPCC), and used as the parental strain. The strain was routinely cultured on potato dextrose medium (PDA; BD company) under conditions at 28 °C. Escherichia coli DH5α (GenScript) was used for DNA molecular cloning. Agrobacterium tumefaciens strain AGL-1 was employed as helper strain during A. tumefaciens-mediated transformation of fungal Epicoccum. The induction medium (IM) utilized for co-culture experiments was prepared as described elsewhere [37]. The strains, plasmids, primers, and derived mutants are listed in Table 1 and preserved in 15% glycerol at − 80 °C. Large scale fermentation of Epicoccum cultures were performed using rice medium (80 g/100 mL, autoclaved at 121 °C for 30 min) and cultivated at 28 °C for 30 days.
Table 1.
Strains, plasmids and oligonucleotides used in this study
| Strains | Description | Source |
|---|---|---|
| E. coli Trans T1 | lacх74 recA1 deoR F – mcrA Δ (mrr-hsdRMS-mcrBC) ϕ80 lacZΔM15Δ araD139Δ (ara-leu)7697 galU galK | Transgen |
| T1-ΔepiA | E .coli cell carrying disruption cassette ΔepiA | This study |
| Agrobacetrium tumefaciens (AGL-1) | Carrying pCAMBIA3301 plasmid, KanR | [42] |
| AGL-1-ΔepiA | AGL-1 cell carrying ΔepiA | This study |
| Epicoccum sp. CPCC 400996 | Wild type strain | |
| Δ epiA -5 | epiA deletant of CPCC 400996 | This study |
| Δ epiA -11 | epiA deletant of CPCC 400996 | This study |
| Plasmids | Description | Source |
|---|---|---|
| pAg1-H3 | Vector for targeted gene replacement containing HYG gene as selection marker | [59] |
| H3-epiA-Dn | 3′ prime arms of epiA gene cloned into pAg1-H3 | This study |
| H3-ΔepiA | 5′ & 3′ prime arms of epiA gene cloned into pAg1-H3 | This study |
| Oligonucleotides | Sequence (5′–3′) | Purpose |
|---|---|---|
| Z01 (epiA-Up-F) | CGACTAGTTTCATGTCAGCATGTAGC | 5′ prime arm amplication |
| Z02 (epiA-Up-R) | CATTAATTAATGAGTCACGAACCTATT | |
| Z03 (epiA-Dn-F) | ATCTCGAGTCAAACGCCAAAATGAAC | 3′ prime arm amplication |
| Z04 (epiA-Dn-R) | ATGGGCCCTGAGCCCACCCGTGCCGG | |
| Z05 (epiA_In-F) | ATTGATGAAGGAGAAGAGGGAG | In deletion region characterization |
| Z06 (epiA_In-R) | GGAAACCAGGTTCGCAGT | |
| Z07 (cha-epiA-UF) | GGGGCTACAATCTTTACG | epiA 5′ prime characterization |
| Z08 (cha-epiA-UR) | GATACCAGACAACCACCTT | |
| Z09 (cha-epiA-DF) | GTAAGCGGCACCAATCTC | epiA 3′ prime characterization |
| Z10 (cha-epiA-DR) | AGCAACATCCCATCACAA | |
| Z11 (cha-hph-F) | GGGCAAAGGAATAGAGTAGATG | Hyg + gene characterization |
| Z12 (cha-hph-R) | TGCAATAGGTCAGGCTCT |
Sequencing and bioinformatic analysis
The genomic DNA (gDNA) of strain Epicoccum sp. CPCC 400996 was extracted using CTAB extraction buffer denoted previously [37]. The gDNA was recovered followed by chlorform extraction, precipitation with isopropanol and further washing with 75% alcohol. The precipitated gDNA was dissolved in 1 mL deionized water, digested with RNase, and purified by chloroform extraction. Then the precipitated gDNA was dried and redissolved in 300 μL deionized water. The shotgun genome sequencing was performed at Shanghai Majorbio Bio-pharm Technology Co. (Shanghai, China) on an Illumina Hiseq 2000 system. Sequence assembly was performed with SOAP denovo 1.05 [38]. Gene annotations were then conducted with GenomeMatcher [39] for local BLAST searching and analyzed via FGENESH platform (www.softberry.com). Protein sequences were compared with the BlastP program in the NCBI database. AntiSMASH database was carried out for bioinformatic mining of metabolic clusters [40]. PKS/NRPS analysis online platform was used for in silico prediction of PKS/NRPS domain organization [41].
General techniques for DNA manipulation
For constructing the disruption cassette of the gene epiA, the homologous arms of the epiA was amplified from gDNA of strain CPCC 400996 using primer sets (epiA-Up-F/R and epiA-Dn-F/R, respectively) listed in Table 1. PCR amplifications were carried out on a Veriti 96 Well Thermal Cycler (Applied Biosystems) using PrimeSTAR®GXL DNA polymerase (Takara). The two PCR amplicons were ligated into a pEASY®-Blunt vector (Transgen) and confirmed through DNA sequencing. The downstream amplicon epiA-Dn was recovered by restriction enzymes digestion using XhoI and ApaI (New England Biolabs), then ligated into simultaneously linearized with XhoI/ApaI digested pAg1-H3 vector to create the plasmid H3-epiA-Dn (Table 1). In addition, the upstream amplicon epiA-Up was recovered by SpeI/PacI (New England Biolabs) double enzyme digestions, and then ligated into linearized vector H3-epiA-Dn to create the plasmid H3-ΔepiA. The H3-ΔepiA was transformed into A. tumefaciens cells. DNA restriction endonucleases were employed following the instructions as recommended by the manufacturer. Primers employed to amplify the genes are listed in Table 1.
Generating Epicoccum-derived deletant ΔepiA
The gene deletion of epiA was performed by A. tumefaciens-mediated target gene disruption system, as previously described for Pseudogymnoascus dustructans [42]. The deletant strain was obtained by replacing targeted gene sequence with the selective hygromycin marker in wild type strain of CPCC 400996. The A. tumefaciens-mediated transformation (ATMT) of Epicoccum sp. was performed with minor modifications. The Agrobacterium cells were transformed with disruption plasmid H3-ΔepiA by electroporation. The co-cultivation experiments were conducted at 30 °C for 72 h. The randomly selected transformants were then inoculated onto selective plates comprising of cefotaxime (250 µg/mL) and hygromycin (150 µg/mL). The mutants were transferred into PDB selection broth to verify the genotype by diagnostic PCRs following the extraction of gDNA. Primers used for diagnositc PCR verification are listed in Table 1. The comparison in amplicons size between the target gene replaced by the hygromycin selection marker and the native gene promoted us to verify whether the mutants exhibited the correct gene deletion.
Chemicals and chemical analysis
High performance liquid chromatography (HPLC) analyses were conducted on an Agilent 1290 system with an Agilent-SBC18 column (4.6 × 250 mm, 5 μm). Thin Layer Chromatography (TLC) was carried out on silica gel GF254 plates from Qingdao marine chemical company, China. The medium pressure liquid chromatography was performed on Combi Flash Rf 200 (Teledyne Isco, Lincoln NE, USA) with a SEPAF FLASH® Flash silica gel column (330 g, Santai Technologies, China). Nuclear Magnetic Resonance (NMR) data was acquired using Bruker AVIII-600 spectrometer (150 MHz for 13C NMR and 600 MHz for 1H NMR, Bruker Corporation, Karlsruhe, Germany). High resolution electrospray ionization mass spectra (HRESIMS) were recorded on a Thermo LTQ Orbitrap XL Mass Spectrometer (Thermo Fisher Scientific, USA).
Scale-up production, isolation of metabolite epicoccamide A
Seed cultures of the strain CPCC 400996 were cultivated in 500 ml flasks (×5) each containing 200 mL of liquid medium (PDB, BD company) at 30 °C on a rotary shaker (220 rpm). After 96 h, 5 mL of the seed culture was used to inoculate into 500 mL erlenmeyer flask (×50) with a rice fermentation medium (rice 100 g/flask, deionized H2O 100 mL/flask). After 30 days cultivation, the cultures were harvested, extracted 2 times with methanol (3 × 30 L) for 30 min each under an ultrasonic bath (10% power intensity). The total methanol solutions were concentrated under reduced pressure to afford the dried extract (60.5 g). Then the methanol extract was dispersed in aqueous (1 L) and extracted by using petroleum ether (3 × 1 L) and ethyl acetate (3 × 1 L) successively. The ethyl acetate residue (5.7 g) was subjected to silica gel column chromatography eluting with a petroleum ether and ethyl acetate mixed solvent system in a step gradient (100:0–0:100, v/v) to afford five fractions (Fr.1–Fr.5). Fr.4 (5.4 g) was further chromatographed on Sephdex LH20 and ODS-MPLC (RP-C18) subsequently. The purification of sub-fractions was carried out on semi preparative HPLC [YMC-Pack ODS-A, 10 mm × 250 mm, 5 μm, flow rate: 3.5 mL/min, 55% acetonitrile-water (v/v)] to obtain epicoccamide A (1) (9.8 mg, tR 14.0 min).
Results
Bioinformatic analysis of the biosynthetic gene cluster epi
We utilized a genome sequencing strategy to investigate the biosynthetic potential of the fungus Epicoccum sp. CPCC 400996. The Illumina HiSeq 2500 sequencing of the strain produced ~ 4148 million bases in total. Assembly of the unpaired shotgun sequencing reads promoted us to obtain 514 contigs, which includes 30.92 million nonredundant bases. After careful bioinformatic analyses of the genome with AntiSMASH platform (https://fungismash.secondarymetabolites.org), we obtained two biosynthetic gene clusters in the genome of the strain CPCC 400996 that carry glycosyltransferase encoding gene. Of particular, one gene cluster caught our attention, which was somewhat similar to the BGC of the burnettramic acid and was designated as the epi cluster (Fig. 2; Table 2). Six putative open reading frames (epiA–epiF) altogether were acquired based on bioinformatic analysis of the continuous DNA region. The protein EpiA has the domain organization of KS-AT-DH-MET-KR-ACP-C-A-T-R as verified by in silico analysis. BlastP alignment illustrated that the EpiA showed 53% identity to hybrid PKS−NRPS synthetase BuaA in A. burnettii, followed by the fusaridione A synthetase FsdS, fusarisetin A synthetase Fsa1, equisetin synthetase EqxS, pyrrolocin synthetase PrlS, pyrichalasin H synthase PyiS, and Ilicicolin H IccA, members of fungal tetramate-forming PKS−NRPS hybrids.
Fig. 2.
Genetic organization of the epicoccamide A biosynthetic locus found in the Epicoccum sp. CPCC 400996 genome. The PKS − NRPS module abbreviations are: KS, ketosynthase; AT, malonyl-CoA transferase; MET, methyltransferase; DH, dehydratase; KR, ketoreductase; ER, enoyl reductase; ACP, acyl carrier protein; SAM, S-adenosyl-l-methionine; C, condensation domain; A, adenylation domain; T, thiolation domain; R, reductive domain. Predicted functions of individual ORFs are summarized in Table 2
Table 2.
Putative functions of ORFs within the BGC epi involved in epicoccamide A biosynthesis
| Protein | Bua homologues (coverage/identity) | Eqx homologues (coverage/identity) | Putative functions |
|---|---|---|---|
| EpiA | BuaA (97%/53%) | EqxS (86%/38%) | PKS-NRPS hybrid |
| EpiB | BuaB (89%/40%) | ND | Glycosyltransferase |
| EpiC | BuaC (95%/57%) | EqxC (92%/43%) | Trans-enoyl reductase |
| EpiD | ND | ND | hypothetical protein |
| EpiE | BuaG (93%/48%) | ND | Cytochrome P450 |
| EpiF | ND | EqxD (98%/48%) | N-methyltransferase |
Further closer investigation on the bilaterial sequences of the epiA facilitated the discovery of the auxilliary genes encoding tailoring enzymes for tetramic acid late stage modification. The gene products conclude one glycosyltransferase (EpiB), one LovC-like trans-enoyl reductase (EpiC), one cytochrome P450 monooxygenase (EpiE), one methyltransferase (EpiF), and one hypothetical protein (EpiD) that are in accord with the structural features of glycosylated tetramic acid derivatives. Although the biosynthetic gene cluster epi is homologous to the bua in A. burnettii, the majority of coding gene products exhibit > 50% sequence identical [28]. Nevertheless, compared to the biosynthetic gene cluster bua, the epi lacks two genes that code cytochrome P450 (buaD) and proline hydroxylase (buaE), but instead one more methyltransferase coding epiC was discovered. Additionally, BlastP alignment indicated that EpiF exhibited 47–49% identities to EqxD, Fsa4, and PynC, respectively, and the three methyltransferases are believed to catalyze the methyl group incorporation at N position during biosynthesis of tetramates equisetin [43], fusarisetin [27], and pyranonigrin [44]. Since tetramate glycoside epicoccamides have been isolated from two Epicoccum strains, we speculated that the fungus could produce epicoccamides and the gene cluster epi might be able to responsible for the biosynthesis of these molecules.
Structure elucidation of epicoccamide A from Epicoccum sp. CPCC 400996
Compound 1 was purified as yellow oil, which had a molecular formula of C29H51NO9 as verified by ESIMS (m/z 556.76, calculated for C29H51NO9 [M-H]−). On the basis of 1H, 13C NMR and HMQC data, along with the analysis of literature data [36], Compound 1 was suggested as an epicoccamide derivative—epicoccamide A. The NMR data were shown as follows, in 1H NMR data (in DMSO, 600 MHz): δH 3.87 (1H, br.s, H-4), 1.23 (3H, d, J = 6.3 Hz, H-5), 2.88 (3H, s, H-6), 3.50 (1H, m, H-8), 1.58 (1H, m, H-9), 1.41 (1H, m, H-9), 1.20–1.29 (m, H-10–H-20), 1.50 (2H, m, H-21), 3.39(1H, m, H-22), 3.74(1H, m, H-22), 1.08 (3H, d, J = 6.7Hz, H-23), 4.33 (1H, br.d, H-1′), 3.60 (1H, m, H-2′), 3.23 (1H, m, H-3′), 3.29 (1H, m, H-4′), 3.00 (1H, m, H-5′), 3.45 (1H, m, H-6′) and 3.67 (1H, m, H-6′). The 13C NMR data (in DMSO, 151 MHz): δC 172.3 (C-1), 100.2 (C-2), 189.8 (C-3), 62.2 (C-4), 14.4 (C-5), 26.0 (C-6), 194.5 (C-7), 35.2 (C-8), 33.0 (C-9), 26.6 (C-10), 28.8-29.2-(C-11-C-19), 25.6 (C-20), 29.2 (C-21), 68.4 (C-22), 16.9 (C-23), 100.2 (C-1′), 70.6 (C-2′), 73.7 (C-3′), 67.2 (C-4′), 77.5 (C-5′) and 61.4 (C-6′), which were similar to epicoccamide derivatives (Additional file 1: Figs. S1-S2). According to the above analyses, compound 1 was composed of three moieties as a tetramic acid, an aliphatic chain, and a hexose. The structures of the latter two moieties were verified by 1H-1H COSY, HMBC and ESI MS (Additional file 1: Table S1, Figs. S3–S6) analysis. Furthermore, the teramide acid moiety was determined by HMBC correlations from H-5 (δH 1.23) to C-3 (δC 189.8) and C-4 (δC 62.2), and from H-6 (δH 2.88) to C-1 (δC 172.3) and C-4 (δC 62.2), coupled with ESI MS/MS (−) data (Additional file 1: Fig. S7) at m/z 126.08 for the molecular fragment resulting from the α-cleavage of the teramide acid moiety. Thus, compound 1 was identified as epicoccamide A and the structure was shown in Fig. 1.
Characterization of the BGC epi responsible for the yielding of epicoccamide A
To verify the participation of EpiA in the yielding of epicoccamide A, disruption of the PKS−NRPS megasynthase coding gene epiA was conducted. We performed a gene inactivation experiment to supply the evidence that epiA is responsible for epicoccamide A biosynthesis. Prior to ATMT experiment, we tested two antibiotics including hygromycin B and G418. Hygromycin concentration of 100 µg/mL could completely inhibit the growth of the parental strain and was used as following selective antibiotic. A selective cassette HygR (pTrpC-HygR-tTrpC) consisting of the promoter coding gene ptrpC, hygromycin resistance gene (HygR), and the terminator coding gene tTrpC was constructed by conventional restriction enzymes digestion and ligation strategy. The knockout plasmid construction was performed based on the scaffold of pAg1-H3 by replacing one of the two nearly continuous fragments from the region of the gene epiA on bilateral of the HygR selective cassette.
Next, after A. tumefaciens-mediated transformation experiment, of 19 putative Hyg+ Epicoccum transformants analyzed, the mutants including ΔepiA-9 and ΔepiA-11 were verified by diagnostic PCR characterization. The primer pairs resided within the deleted region of the epiA, yielding a 613-bp PCR amplicon for wild type (WT) strain but not for the selected mutants (Fig. 3A, Bi). The mutants that had no amplicons were further characterized for ΔepiA::HygB+ integration at the homologous site by using four additional primers pairs. With one HygR specific primer set, both mutants had two amplicons of 3256 bp and 3191 bp in size, respectively, while the control WT gave no amplicons (Fig. 3A, Bii). Further verification with one primer set located in deletion region of epiA, two amplicons with 2741 bp and 2162 bp in size were amplified from WT, whereas no amplicons were recovered from both mutants (Fig. 3A, Biii). The thus-obtained crude extracts from ΔepiA-9 and ΔepiA-11, and parental strain were analyzed for its metabolites profile by high performance liquid chromatography (HPLC). At the same HPLC condition, the peak of epicoccamide A at 10 min that confirmed it is the target compound along with the evidence of m/z 556 [M-H]−. However, as shown in Fig. 3C, the mutant strains ΔepiA-9 and ΔepiA-11 completely abolished the production of 1. These results further corroborated with our prediction regarding the function of the gene cluster epi, confirming that the gene epiA is responsible for epicoccamide A biosynthesis in Epicoccum sp.
Fig. 3.
Gene deletion of epiA and characterization of ΔepiA mutants. A Schematic representation of the epiA−disruption cassette with the genetic map and its surrounding regions. The dashed line represents expected size product for wild-type and deletant strains. B Diagnostic PCR characterization of ΔepiA mutants. Primer pair (Z05/Z06) located within the deletion region of epiA gene (Bi-613 bp in size for WT and no PCR amplicon for mutants); Primer pairs (Z07/Z12 and Z10/Z11) targeting the Hyg gene and epiA flanking regions (Bii-3256 bp and 3191 bp in size for mutants and no PCR amplicon for WT); Primer pairs (Z07/Z08 and Z09/Z10) located in the epiA deletion region and flanking regions (Biii-2741 bp and 2162 bp in size for WT and no PCR amplicon for mutants). C HPLC profiles of organic extracts obtained from the WT and ΔepiA mutants of Epicoccum sp. The positions of epicoccamide A are indicated in the chromatograms. The elution was monitored at 280 nm and shown on the same Y-scale. HPLC-MS analysis of ΔepiA metabolites in positive ion mode, EIC at m/z 556, [M-H]−.
Investigation on the biosynthesis of metabolite epicoccamide A
Epicoccamides are unique glycosylated tetramic acid derivatives featuring a linear aliphatic chain attached to tetramate and mannose moieties. The genetic base for the biosynthesis of burnettramic acid was well determined previously, and the biosynthesis of the epicoccamide A should be highly similar to that of burnettramic acid [34]. In the light of the molecular structures of epicoccamide A and proposed gene functions of the gene cluster epi, a biosynthetic pathway of epicoccamide A was envisioned (Fig. 4). Domains of the megasynthase EpiA are programmed and generate polyketide chains with varied methylation and reduction modifications and NRPS modules are in charge of fusing the polyketide chain to an l-alanine and an offloading R domain for tetramate cyclization and chain release. Of this compound, acetate is extended seven times with seven unities of malonate by PKS domains, programmed C-methylation occurs following the first two extensions derived from an intact methylmalonate precursor, and cycles of full reduction occur after the first two extensions. The following steps involve the methyltransferase EpiF for installation of the methyl group into the nitrogen position of tetramate ring and glycosyltransferase EpiB to accomplish the β-d-mannose transferring reaction. However, in the burnettramic acid pathway, the polyketide chain of intermediate burnettramic acid aglycones occur multiple hydroxylations oxygenated by the cytochrome P450 BuaG, followed by BuaB-catalyzed mannosyltransferring for the generation of final product burnettramic acid. In contrast, the intermediate epicoccamide aglycone was N-methylated to afford the N-methyl modified intermediates, a feature that is lacking in burnettramic acid. Additionally, it is important to note that cytochrome P450 EpiE exhibited higher identities (> 40%) to P450s including HimC, BuaG, and AscH, which participated in hydroxylations or multiple oxidations of the polyketide chain during himeic acid A, and burnettramic acid biosynthesis, respectively [34, 45]. We believed that novel and further oxygenated derivatives of epicoccamides catalyzed by P450 EpiE would be mined from Epicoccum sp.
Fig. 4.
Domain organization and proposed biosynthetic pathway of epicoccamide A (1). SAM, S-adenosylmethionine. Modules in blue denote incorporation of the starter unit from malonyl-CoA or methylmalonyl-CoA, and those in orange denote incorporation of L-alanine
EpiA is quite an unconventional fungal PKS − NRPS megasynthase, as it is only the first fungal PKS−NRPS that has been exhibited to specifically recognize and activate the amino acid of l-alanine. We next phylogenetically analyzed the adenylation domains of characterized PKS-NRPSs from biosynthetic pathways of fungal tetramates. Similar analyses were performed on embedded adenylation domains in NRPSs for cyclic peptides including cyclosporin A and emericellamides [46, 47]. Notably, in this phylogenetic dendrogram, EpiA, EasA-A4, and EasA-A5 clustered in a distinct branch with CcsA-A11 of cyclosporin A formation in Tolypocladium inflatum, which are more inclined to acquire L-alanine as precursors (Fig. 5). Additionally, the 10 signature residues for the adenylation domains of the alanine-incorporating EpiA indicated that positions 235, 236, and 517 are conserved (D235L236K517), while others are flexible (Additional file 1: Table S1). We believe their significance for alanine might be uncovered with increasing alanine-incorporating PKS-NRPSs.
Fig. 5.
Phylogenetic tree of fungal adenylation domain signature sequences retrieved from characterized multimodular PKS−NRPS hybrid synthase or peptide synthetases (NRPSs). The EpiA was highlighted in red. The scale represents changes per site; numbers at branches are bootstrap values. For accession numbers and further details, the reader is referred to the Additional file 1: Table S2
Discussion
Using a targeted gene deletion, we have identified the epi family genes encoding the biosynthetic pathway for the tetramate derivative epicoccamide A in the fungal strain CPCC 400996. Interestingly, during our research on epicoccamides biosynthesis, Kwon and coworkers also characterized the genetic BGC (epc) of epicoccamide in E. nigrum KACC 40,642 [48]. It is worth noting that both epi and epc gene clusters are syntenic and highly identical, and this further demonstrated our proposal that the cluster epi is responsible for biosynthesizing epicoccamides [48]. Since the study of the tetramaic acid-originated epicoccamides identified from E. purpurascens two decades ago, the underlying genetic base and biochemcial transformation of this class of compounds remain to be characterized [36, 46]. With genome sequences becoming accessible due to plummeting costs, genomics-based methods are now commonplace and might hold the key to lead a renaissance in the field of secondary metabolites discovery [4, 13, 49, 50]. The understanding to link secondary metabolites to their corresponding BGCs and vice versa, along with ever-increasing understanding of biosynthetic machineries, has inspired the field of genome mining-guided secondary metabolites exploitation for the rational discovery of new chemical entities [3, 51]. In this report, genome guided bioinformatic analysis of the fungus CPCC 400996 revealed the localization of a novel PKS-NRPS hybrid biosynthetic gene cluster. Additionally, the gene cluster epi also includes one glycosyltransferase encoding gene epiB and one N-methyltransferase encoding gene epiF, which implies that this gene cluster might be the candidate for epicoccamides biosynthesis in the fungus Epicoccum sp. CPCC 400996 (Fig. 2). Taken together, a genome-guided secondary metabolites mining approach was performed to discover the compound epicoccamide A in the producer of Epicoccum sp. strain CPCC 400996.
We next phylogenetically analyzed the EpiA R domain with the NRPS R or R’ domains from fungal metabolic pathways and the corresponding Dieckmann cyclases or TE domains involved in bacteria-derived tetramates [15]. Four paradigms have been proposed to decipher the releasing mechanism of tetramate derivatives. These conclude the following conditions: (i) the action of a hybrid PKS-NRPS megasynthase TE carrying module involved in bacterial polycyclic tetramic macrolactams (PTMs) biosynthesis, exemplified as the HSAF [52], FtbB, and SGR-814, for which the terminal TE module of Orf6 in the HSAF biosynthetic pathway (carrying peptide ligase and protease activities) catalyzes tetramate generation [52]; (ii) the action of a reductive (R) domain locating in terminal module within the fungal PKS-NRPS hybrids as highlighted by tenellin [17], equisetin [16], fusaridione A [53], and burnettramic acid [28], in which the dissected R domain of FsdS has been demonstrated in vitro to catalyze Dieckmann-type cyclization for releasing corresponding tetramates; (iii) the action of Dieckmann cyclases as reflected by the actinomycete-derived metabolites including tirandamycin[15], kirromycin [54], and α-lipomycin [55], in which TrdC family cyclases could in vitro catalyze the cyclization of tetramate scaffolds; and (iv) chemistry performed in generating bacteria-derived spiro-linked tetramates including pyrroindomycins [56] and chlorothricins [57], these include a phylogenetically unique two gene ensemble PyrD3/PyrD4 and ChlD3/ChlD4. In this phylogenetic tree, EpiA R domain clustered in a separate branch including NRPS R or R’ domains involved in fungal tetramates biosynthesis (Fig. 6). This suggested that it might support the proposal that the releasing mechanism or cyclizations are conserved and unique during biosynthesis of fungal tetramates.
Fig. 6.
Unrooted phylogenetic tree of NRPS R domains or proteins catalyzing Dieckmann cyclization during tetramates biosynthesis. NRPS R domains involved in fungal tetramates metabolic pathways; TrdC family cyclases involved in actinomycete-derived tetramates; TEs involved in bacterial polycyclic tetramic macrolactams (PTMs) biosynthesis; PyrD3, and ChlD3 involved in pyrrolidine-2,4-dione ring formation during pyrroindomycin and chlorothricin synthesis, respectively
Investigation of the biosynhtetic gene cluster epi revealed neighboring genes that are highly homologous to reported bua cluster in A. burnettii genome. These two gene clusters contained a deduced 5-membered heterocycle formation encoding genes together with other putative tailoring ORFs conserved among the previously reported biosynthetic pathways of tetramate derivatives (Fig. 7). A more detailed cluster blast bioinformatic analysis was carried out on other fungal tetramates including equisetin from Fusarium heterosporum ATCC 74,349 [14], himeic acid from Aspergillus japonicus MF275 [13], fusarisetin A from Fusarium sp. FN080326 [23], Sch210971/2 from Hapsidospora irregularis BP-2511 [58], and pyranoviolin A from A. violaceofuscus CBS 115,571 [26]. Significantly, all these TETases genes are related to a double-gene ensemble that catalyzes the formation of the tetramate moiety. The ensemble includes genes that encode a PKS-NRPS hybrid and a trans-enoyl reductase (ER). The prevalence of these TETases-encoding gene clusters across these fungi has promoted the conclusion that they might encode for yielding of a group of structurally related tetramic acids that have a common metabolic origin (Fig. 7). Comparisons of these fungal tetramates encoding gene clusters will contribute us to elucidate the biosynthetic mechanisms of this unique class of secondary metabolites. The genetic investigations of these fascinating biocatalysts will facilitate us to rationally generate novel epicoccamide derivatives with structural diversification and improve pharmacological property.
Fig. 7.
Evolutionary conserved biosynthetic gene clusters of fungal tetramates: A epicoccamide A from Epicoccum sp. CPCC 400996; B burnettramic acids from Aspergillus burnettii FRR 5400; C equisetin from Fusarium heterosporum ATCC 74349; D himeic acid from A. japonicus MF275; E fusarisetin A from Fusarium sp. FN080326; F Sch210971/2 from Hapsidospora irregularis; G pyranoviolin A from A. violaceofuscus CBS 115571
Concluding remarks
In conclusion, we identified a previously uncharacterized PKS − NRPS hybrid based biosynthetic gene cluster of epicoccamide A (1) from Epicoccum sp. CPCC 400996, which enables us to investigate the genetic mechanism of epicoccamide A biosynthesis. The gene cluster epi for generating the compound (1) was verified by gene inactivation experiment in the native producer. Based on the gene cluster data, a putative metabolic pathway of epicoccamide A was proposed. These findings might provide the feasibility of using them for further investigation of epicoccamides biosynthesis. Our study demonstrates that genome mining targeted strategy would accelerate the discovery of secondary metabolites, and also provide opportunities for derivatization of epicoccamides via manipulating biosynthetic pathway.
Supplementary Information
Additional file 1: Table S1. NMR Data for epicoccamide A (1). Table S2. Comparison of the signature residues for amino acid selection by adenylation (A) domains of fungal PKS-NRPS (NRPS). Figure S1. The 1H NMR spectrum of compound 1. Figure S2. The 13C NMR spectrum of compound 1. Figure S3. The 1H-1H COSY spectrum of compound 1 (in DMSO). Figure S4. The HSQC spectrum of compound 1 (in DMSO). Figure S5. The HMBC spectrum of compound 1 (in DMSO). Figure S6. HRESIMS spectrum of compound 1. Figure S7. ESI MS/MS (-) spectrum of compound 1.
Acknowledgements
We are grateful to Dr. Seogchan Kang (University Park, PA, USA) for providing Agrobacterium tumefaciens AGL-1 strain. Prof. Gang Liu (IMCAS, Beijing) is thanked for the generous gift of plasmid pAg1-H3.
Author contributions
TZ and LY obtained funding support. TZ conceived the study, supervised the project, conducted experiments and bioinformatic analysis. GC and WH isolated the compound and elucidated the structures of the compound. XR, JX, BJ, HW, XL, LW, and RZ advised on the interpretation of partial data in Figs. 3, and 6. TZ wrote the original draft. TZ, WH, and LY edited the draft manuscript. All authors read and approved the final manuscript.
Funding
This work was financially supported by the National Natural Science Foundation of China (No. 31872617, 32141003), the CAMS Innovation Fund for Medical Sciences (CIFMS) (2021-I2M-1-055, 2019-I2M-1-005), and the central level, scientific research institutes for basic R & D fund business (3332018097).
Availability of data and materials
All data generated during this study are included in this article, and all material is available upon request.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
All authors approved publication.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Tao Zhang, Email: evergo218@163.com.
Wenni He, Email: wnner0047@126.com.
Liyan Yu, Email: yly@cpcc.ac.cn.
References
- 1.Bills GF, Gloer JB. Biologically active secondary metabolites from the fungi. Microbiol Spectr. 2016 doi: 10.1128/microbiolspec.FUNK-0009-2016. [DOI] [PubMed] [Google Scholar]
- 2.Keller NP. Fungal secondary metabolism: regulation, function and drug discovery. Nat Rev Microbiol. 2019;17:167–80. doi: 10.1038/s41579-018-0121-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Malit JJL, Leung HYC, Qian PY. Targeted large-scale genome mining and candidate prioritization for natural product discovery. Mar Drugs. 2022 doi: 10.3390/md20060398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Machado H, Tuttle RN, Jensen PR. Omics-based natural product discovery and the lexicon of genome mining. Curr Opin Microbiol. 2017;39:136–42. doi: 10.1016/j.mib.2017.10.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Pan R, Bai X, Chen J, Zhang H, Wang H. Exploring structural diversity of microbe secondary metabolites using OSMAC strategy: a literature review. Front Microbiol. 2019;10:294. doi: 10.3389/fmicb.2019.00294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zhuang L, Zhang H. Utilizing cross-species co-cultures for discovery of novel natural products. Curr Opin Biotechnol. 2021;69:252–62. doi: 10.1016/j.copbio.2021.01.023. [DOI] [PubMed] [Google Scholar]
- 7.Bertrand S, Bohni N, Schnee S, Schumpp O, Gindro K, Wolfender JL. Metabolite induction via microorganism co-culture: a potential way to enhance chemical diversity for drug discovery. Biotechnol Adv. 2014;32:1180–204. doi: 10.1016/j.biotechadv.2014.03.001. [DOI] [PubMed] [Google Scholar]
- 8.Toghueo RMK, Sahal D, Boyom FF. Recent advances in inducing endophytic fungal specialized metabolites using small molecule elicitors including epigenetic modifiers. Phytochemistry. 2020;174:112338. doi: 10.1016/j.phytochem.2020.112338. [DOI] [PubMed] [Google Scholar]
- 9.Cichewicz RH. Epigenome manipulation as a pathway to new natural product scaffolds and their congeners. Nat Prod Rep. 2010;27:11–22. doi: 10.1039/B920860G. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Medema MH, de Rond T, Moore BS. Mining genomes to illuminate the specialized chemistry of life. Nat Rev Genet. 2021;22:553–71. doi: 10.1038/s41576-021-00363-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhang T, Cai G, Rong X, Wang Y, Gong K, Liu W, Wang L, Pang X, Yu L. A combination of genome mining with an OSMAC approach facilitates the discovery of and contributions to the biosynthesis of melleolides from the Basidiomycete Armillaria tabescens. J Agric Food Chem. 2022;70:12430–41. doi: 10.1021/acs.jafc.2c04079. [DOI] [PubMed] [Google Scholar]
- 12.Zhang T, Pang X, Zhao J, Guo Z, He W, Cai G, Su J, Cen S, Yu L. Discovery and activation of the cryptic cluster from Aspergillus sp. CPCC 400735 for asperphenalenone biosynthesis. ACS Chem Biol. 2022;17:1524–33. doi: 10.1021/acschembio.2c00204. [DOI] [PubMed] [Google Scholar]
- 13.Bauman KD, Butler KS, Moore BS, Chekan JR. Genome mining methods to discover bioactive natural products. Nat Prod Rep. 2021;38:2100–29. doi: 10.1039/D1NP00032B. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chi LP, Li XM, Li L, Li X, Wang BG. Cytotoxic thiodiketopiperazine derivatives from the deep sea-derived fungus Epicoccum nigrum SD-388. Mar Drugs. 2020 doi: 10.3390/md18030160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gui C, Li Q, Mo X, Qin X, Ma J, Ju J. Discovery of a new family of Dieckmann cyclases essential to tetramic acid and pyridone-based natural products biosynthesis. Org Lett. 2015;17:628–31. doi: 10.1021/ol5036497. [DOI] [PubMed] [Google Scholar]
- 16.Mo X, Gulder TAM. Biosynthetic strategies for tetramic acid formation. Nat Prod Rep. 2021;38:1555–66. doi: 10.1039/D0NP00099J. [DOI] [PubMed] [Google Scholar]
- 17.Jiang M, Chen S, Li J, Liu L. The biological and chemical diversity of tetramic acid compounds from marine-derived microorganisms. Mar Drugs. 2020 doi: 10.3390/md18020114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Schobert R, Schlenk A. Tetramic and tetronic acids: an update on new derivatives and biological aspects. Bioorg Med Chem. 2008;16:4203–21. doi: 10.1016/j.bmc.2008.02.069. [DOI] [PubMed] [Google Scholar]
- 19.Zhang G, Zhang W, Saha S, Zhang C. Recent advances in discovery, biosynthesis and genome mining of medicinally relevant polycyclic tetramate macrolactams. Curr Top Med Chem. 2016;16:1727–39. doi: 10.2174/1568026616666151012112818. [DOI] [PubMed] [Google Scholar]
- 20.Xu W, Cai X, Jung ME, Tang Y. Analysis of intact and dissected fungal polyketide synthase-nonribosomal peptide synthetase in vitro and in Saccharomyces cerevisiae. J Am Chem Soc. 2010;132:13604–7. doi: 10.1021/ja107084d. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Eley KL, Halo LM, Song Z, Powles H, Cox RJ, Bailey AM, Lazarus CM, Simpson TJ. Biosynthesis of the 2-pyridone tenellin in the insect pathogenic fungus Beauveria bassiana. Chembiochem. 2007;8:289–97. doi: 10.1002/cbic.200600398. [DOI] [PubMed] [Google Scholar]
- 22.Tokuoka M, Seshime Y, Fujii I, Kitamoto K, Takahashi T, Koyama Y. Identification of a novel polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) gene required for the biosynthesis of cyclopiazonic acid in aspergillus oryzae. Fungal Genet Biol. 2008;45:1608–15. doi: 10.1016/j.fgb.2008.09.006. [DOI] [PubMed] [Google Scholar]
- 23.Kato N, Nogawa T, Hirota H, Jang JH, Takahashi S, Ahn JS, Osada H. A new enzyme involved in the control of the stereochemistry in the decalin formation during equisetin biosynthesis. Biochem Biophys Res Commun. 2015;460:210–5. doi: 10.1016/j.bbrc.2015.03.011. [DOI] [PubMed] [Google Scholar]
- 24.Maiya S, Grundmann A, Li X, Li SM, Turner G. Identification of a hybrid PKS/NRPS required for pseurotin a biosynthesis in the human pathogen Aspergillus fumigatus. Chembiochem. 2007;8:1736–43. doi: 10.1002/cbic.200700202. [DOI] [PubMed] [Google Scholar]
- 25.Olano C, Gomez C, Perez M, Palomino M, Pineda-Lucena A, Carbajo RJ, Brana AF, Mendez C, Salas JA. Deciphering biosynthesis of the RNA polymerase inhibitor streptolydigin and generation of glycosylated derivatives. Chem Biol. 2009;16:1031–44. doi: 10.1016/j.chembiol.2009.09.015. [DOI] [PubMed] [Google Scholar]
- 26.Wei X, Chen L, Tang JW, Matsuda Y. Discovery of pyranoviolin A and its biosynthetic gene cluster in Aspergillus violaceofuscus. Front Microbiol. 2020;11:562063. doi: 10.3389/fmicb.2020.562063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sato M, Dander JE, Sato C, Hung YS, Gao SS, Tang MC, Hang L, Winter JM, Garg NK, Watanabe K, Tang Y. Collaborative biosynthesis of maleimide- and succinimide-containing natural products by fungal polyketide megasynthases. J Am Chem Soc. 2017;139:5317–20. doi: 10.1021/jacs.7b02432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Li H, Gilchrist CLM, Lacey HJ, Crombie A, Vuong D, Pitt JI, Lacey E, Chooi YH, Piggott AM. Discovery and heterologous biosynthesis of the burnettramic acids: rare PKS-NRPS-derived bolaamphiphilic pyrrolizidinediones from an australian fungus, Aspergillus burnettii. Org Lett. 2019;21:1287–91. doi: 10.1021/acs.orglett.8b04042. [DOI] [PubMed] [Google Scholar]
- 29.Guo Y, Contesini FJ, Wang X, Ghidinelli S, Tornby DS, Andersen TE, Mortensen UH, Larsen TO. Biosynthesis of calipyridone A represents a fungal 2-pyridone formation without ring expansion in Aspergillus californicus. Org Lett. 2022;24:804–8. doi: 10.1021/acs.orglett.1c03792. [DOI] [PubMed] [Google Scholar]
- 30.Perveen I, Raza MA, Iqbal T, Naz I, Sehar S, Ahmed S. Isolation of anticancer and antimicrobial metabolites from Epicoccum nigrum; endophyte of Ferula sumbul. Microb Pathog. 2017;110:214–24. doi: 10.1016/j.micpath.2017.06.033. [DOI] [PubMed] [Google Scholar]
- 31.Braga RM, Padilla G, Araujo WL. The biotechnological potential of Epicoccum spp.: diversity of secondary metabolites. Crit Rev Microbiol. 2018;44:759–78. doi: 10.1080/1040841X.2018.1514364. [DOI] [PubMed] [Google Scholar]
- 32.Lahlali R, Hijri M. Screening, identification and evaluation of potential biocontrol fungal endophytes against Rhizoctonia solani AG3 on potato plants. FEMS Microbiol Lett. 2010;311:152–9. doi: 10.1111/j.1574-6968.2010.02084.x. [DOI] [PubMed] [Google Scholar]
- 33.Cao PR, Zheng YL, Zhao YQ, Wang XB, Zhang H, Zhang MH, Yang T, Gu YC, Yang MH, Kong LY. Beetleane A and epicoane A: two carbon skeletons produced by Epicoccum nigrum. Org Lett. 2021;23:3274–7. doi: 10.1021/acs.orglett.1c00731. [DOI] [PubMed] [Google Scholar]
- 34.Harwoko H, Lee J, Hartmann R, Mandi A, Kurtan T, Muller WEG, Feldbrugge M, Kalscheuer R, Ancheeva E, Daletos G, Frank M, Liu Z, Proksch P. Azacoccones F-H, new flavipin-derived alkaloids from an endophytic fungus Epicoccum nigrum MK214079. Fitoterapia. 2020;146:104698. doi: 10.1016/j.fitote.2020.104698. [DOI] [PubMed] [Google Scholar]
- 35.Zhang Y, Liu S, Che Y, Liu X, Epicoccins A-D, epipolythiodioxopiperazines from a Cordyceps-colonizing isolate of Epicoccum nigrum. J Nat Prod. 2007;70:1522–5. doi: 10.1021/np070239u. [DOI] [PubMed] [Google Scholar]
- 36.Wright AD, Osterhage C, Konig GM. Epicoccamide, a novel secondary metabolite from a jellyfish-derived culture of Epicoccum purpurascens. Org Biomol Chem. 2003;1:507–10. doi: 10.1039/b208588g. [DOI] [PubMed] [Google Scholar]
- 37.Zhang T, Zhuo Y, Jia X, Liu J, Gao H, Song F, Liu M, Zhang L. Cloning and characterization of the gene cluster required for beauvericin biosynthesis in Fusarium proliferatum. Sci China Life Sci. 2013;56:628–37. doi: 10.1007/s11427-013-4505-1. [DOI] [PubMed] [Google Scholar]
- 38.Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z, Li Y, Li S, Shan G, Kristiansen K, Li S, Yang H, Wang J, Wang J. De novo assembly of human genomes with massively parallel short read sequencing. Genome Res. 2010;20:265–72. doi: 10.1101/gr.097261.109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ohtsubo Y, Ikeda-Ohtsubo W, Nagata Y, Tsuda M. GenomeMatcher: a graphical user interface for DNA sequence comparison. BMC Bioinf. 2008;9:376. doi: 10.1186/1471-2105-9-376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Blin K, Shaw S, Kloosterman AM, Charlop-Powers Z, van Wezel GP, Medema MH, Weber T. antiSMASH 6.0: improving cluster detection and comparison capabilities. Nucleic Acids Res. 2021;49:W29–35. doi: 10.1093/nar/gkab335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bachmann BO, Ravel J. Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods Enzymol. 2009;458:181–217. doi: 10.1016/S0076-6879(09)04808-3. [DOI] [PubMed] [Google Scholar]
- 42.Zhang T, Ren P, Chaturvedi V, Chaturvedi S. Development of an Agrobacterium-mediated transformation system for the cold-adapted fungi Pseudogymnoascus destructans and P. pannorum. Fungal Genet Biol. 2015;81:73–81. doi: 10.1016/j.fgb.2015.05.009. [DOI] [PubMed] [Google Scholar]
- 43.Sims JW, Fillmore JP, Warner DD, Schmidt EW. Equisetin biosynthesis in Fusarium heterosporum. Chem Commun. 2005;14:186–8. doi: 10.1039/b413523g. [DOI] [PubMed] [Google Scholar]
- 44.Awakawa T, Yang XL, Wakimoto T, Abe I, Pyranonigrin E. A PKS-NRPS hybrid metabolite from Aspergillus niger identified by genome mining. ChemBioChem. 2013;14:2095–9. doi: 10.1002/cbic.201300430. [DOI] [PubMed] [Google Scholar]
- 45.Hashimoto M, Kato H, Katsuki A, Tsukamoto S, Fujii I. Identification of the biosynthetic gene cluster for himeic acid A: a ubiquitin-activating enzyme (E1) inhibitor in aspergillus japonicus MF275. Chembiochem. 2018;19:535–9. doi: 10.1002/cbic.201700584. [DOI] [PubMed] [Google Scholar]
- 46.Yang X, Feng P, Yin Y, Bushley K, Spatafora JW, Wang C. Cyclosporine biosynthesis in Tolypocladium inflatum benefits fungal adaptation to the environment. mBio. 2018 doi: 10.1128/mBio.01211-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Chiang YM, Szewczyk E, Nayak T, Davidson AD, Sanchez JF, Lo HC, Ho WY, Simityan H, Kuo E, Praseuth A, Watanabe K, Oakley BR, Wang CCC. Molecular genetic mining of the aspergillus secondary metabolome: discovery of the emericellamide biosynthetic pathway. Chem Biol. 2008;15:527–32. doi: 10.1016/j.chembiol.2008.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Choi EH, Park SH, Kwon HJ. Genetic localization of epicoccamide biosynthetic gene cluster in Epicoccum nigrum KACC 40642. J Appl Biol Chem. 2022;65:159–66. doi: 10.3839/jabc.2022.021. [DOI] [Google Scholar]
- 49.Gao SS, Zhang T, Garcia-Borras M, Hung YS, Billingsley JM, Houk KN, Hu Y, Tang Y. Biosynthesis of heptacyclic duclauxins requires extensive redox modifications of the phenalenone aromatic polyketide. J Am Chem Soc. 2018;140:6991–7. doi: 10.1021/jacs.8b03705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Scherlach K, Hertweck C. Mining and unearthing hidden biosynthetic potential. Nat Commun. 2021;12:3864. doi: 10.1038/s41467-021-24133-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Kang HS. Phylogeny-guided (meta)genome mining approach for the targeted discovery of new microbial natural products. J Ind Microbiol Biotechnol. 2017;44:285–93. doi: 10.1007/s10295-016-1874-z. [DOI] [PubMed] [Google Scholar]
- 52.Lou L, Qian G, Xie Y, Hang J, Chen H, Zaleta-Rivera K, Li Y, Shen Y, Dussault PH, Liu F, Du L. Biosynthesis of HSAF, a tetramic acid-containing macrolactam from Lysobacter enzymogenes. J Am Chem Soc. 2011;133:643–5. doi: 10.1021/ja105732c. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Kakule TB, Sardar D, Lin Z, Schmidt EW. Two related pyrrolidinedione synthetase loci in Fusarium heterosporum ATCC 74349 produce divergent metabolites. ACS Chem Biol. 2013;8:1549–57. doi: 10.1021/cb400159f. [DOI] [PubMed] [Google Scholar]
- 54.Weber T, Laiple KJ, Pross EK, Textor A, Grond S, Welzel K, Pelzer S, Vente A, Wohlleben W. Molecular analysis of the kirromycin biosynthetic gene cluster revealed beta-alanine as precursor of the pyridone moiety. Chem Biol. 2008;15:175–88. doi: 10.1016/j.chembiol.2007.12.009. [DOI] [PubMed] [Google Scholar]
- 55.Bihlmaier C, Welle E, Hofmann C, Welzel K, Vente A, Breitling E, Muller M, Glaser S, Bechthold A. Biosynthetic gene cluster for the polyenoyltetramic acid alpha-lipomycin. Antimicrob Agents Chemother. 2006;50:2113–21. doi: 10.1128/AAC.00007-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Wu Q, Wu Z, Qu X, Liu W. Insights into pyrroindomycin biosynthesis reveal a uniform paradigm for tetramate/tetronate formation. J Am Chem Soc. 2012;134:17342–5. doi: 10.1021/ja304829g. [DOI] [PubMed] [Google Scholar]
- 57.Jia XY, Tian ZH, Shao L, Qu XD, Zhao QF, Tang J, Tang GL, Liu W. Genetic characterization of the chlorothricin gene cluster as a model for spirotetronate antibiotic biosynthesis. Chem Biol. 2006;13:575–85. doi: 10.1016/j.chembiol.2006.03.008. [DOI] [PubMed] [Google Scholar]
- 58.Kakule TB, Zhang S, Zhan J, Schmidt EW. Biosynthesis of the tetramic acids Sch210971 and Sch210972. Org Lett. 2015;17:2295–7. doi: 10.1021/acs.orglett.5b00715. [DOI] [PubMed] [Google Scholar]
- 59.Guan F, Pan Y, Li J, Liu G. A GATA-type transcription factor AcAREB for nitrogen metabolism is involved in regulation of cephalosporin biosynthesis in Acremonium chrysogenum. Sci China Life Sci. 2017;60:958–67. doi: 10.1007/s11427-017-9118-9. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Table S1. NMR Data for epicoccamide A (1). Table S2. Comparison of the signature residues for amino acid selection by adenylation (A) domains of fungal PKS-NRPS (NRPS). Figure S1. The 1H NMR spectrum of compound 1. Figure S2. The 13C NMR spectrum of compound 1. Figure S3. The 1H-1H COSY spectrum of compound 1 (in DMSO). Figure S4. The HSQC spectrum of compound 1 (in DMSO). Figure S5. The HMBC spectrum of compound 1 (in DMSO). Figure S6. HRESIMS spectrum of compound 1. Figure S7. ESI MS/MS (-) spectrum of compound 1.
Data Availability Statement
All data generated during this study are included in this article, and all material is available upon request.







